Literature DB >> 32084216

A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge.

Macarena Sarli1,2, María B Novoa1,2, Matilde N Mazzucco1, Marcelo L Signorini1,2, Ignacio E Echaide1, Susana T de Echaide1, María E Primo1,2.   

Abstract

Anaplasma marginale is the most prevalent tick-borne livestock pathogen with worldwide distribution. Bovine anaplasmosis is a significant threat to cattle industry. Anaplasmosis outbreaks in endemic areas are prevented via vaccination with live A. centrale produced in splenectomized calves. Since A. centrale live vaccine can carry other pathogens and cause disease in adult cattle, research efforts are directed to develop safe recombinant subunit vaccines. Previous work found that the subdominant proteins of A. marginale type IV secretion system (T4SS) and the subdominant elongation factor-Tu (Ef-Tu) were involved in the protective immunity against the experimental challenge in cattle immunized with the A. marginale outer membrane (OM). This study evaluated the immunogenicity and protection conferred by recombinant VirB9.1, VirB9.2, VirB10, VirB11, and Ef-Tu proteins cloned and expressed in E. coli. Twenty steers were randomly clustered into four groups (G) of five animals each. Cattle from G1 and G2 were immunized with a mixture of 50 μg of each recombinant protein with Quil A® or Montanide™ adjuvants, respectively. Cattle from G3 and G4 (controls) were immunized with Quil A and Montanide adjuvants, respectively. Cattle received four immunizations at three-week intervals and were challenged with 107 A. marginale-parasitized erythrocytes 42 days after the fourth immunization. After challenge, all cattle showed clinical signs, with a significant drop of packed cell volume and a significant increase of parasitized erythrocytes (p<0.05), requiring treatment with oxytetracycline to prevent death. The levels of IgG2 induced in the immunized groups did not correlate with the observed lack of protection. Additional strategies are required to evaluate the role of these proteins and their potential utility in the development of effective vaccines.

Entities:  

Year:  2020        PMID: 32084216      PMCID: PMC7034839          DOI: 10.1371/journal.pone.0229301

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Bovine anaplasmosis is an infectious disease caused by the obligate intraerythrocytic Gram-negative bacterium Anaplasma marginale (order Rickettsiales; family Anaplasmataceae) [1], transmitted either biologically by ticks or mechanically by bloodsucking flies or through blood-contaminated fomites. The disease is widely distributed in tropical and subtropical regions of the world, and is in expansion due to the movement of cattle from endemic to non-endemic areas [2,3]. Anaplasmosis, clinically characterized by anemia, hyperthermia, icterus, weight loss, and reduced milk production, can produce 50% mortality in cattle older than 2 years of age that have not received specific treatment [1,4]. Cattle that overcome the acute infection remain persistently infected for life and become a reservoir for A. marginale transmission [1,5]. In some countries, the disease is currently prevented by the administration of a live vaccine, based on the naturally less pathogenic A. marginale subsp. centrale (hereafter A. centrale), amplified in splenectomized calves [1]. Some drawbacks of the live A. centrale vaccine include the risk of transmission of other pathogens [6], the administration only to calves up to 10 months of age, and the achievement of partial protection against antigenically diverse A. marginale strains [1,7,8]. Immunization of cattle with the native purified outer membrane (OM) of A. marginale has induced complete protection against infection and clinical disease [4,9,10]. Such protection was correlated with induction of high titers of IgG2 opsonizing antibodies against A. marginale surface epitopes and macrophage activation mediated by CD4+ T cells [4,11]. The capacity of OM native proteins to induce protection has promoted their consideration as vaccine candidates [12,13]. However, this immunogen has been used only experimentally due to difficulties in scaling up and standardization [14]. Antibody response in OM-vaccinated cattle is primarily directed against several immunodominant major surface proteins (MSPs); however, these proteins failed to provide consistent and complete protective immunity when used individually [15-17]. Complete genome sequencing and proteomic studies of A. marginale allowed the identification of subdominant proteins, which are present in low abundance on the OM [13]. These proteins remain invariant during infection and are highly conserved among different strains, making them attractive potential candidates for vaccines [12,18]. Subdominant proteins of A. marginale type IV secretion system (T4SS), a 1.05-MDa complex that spans the outer and inner bacterial membranes involved in the host cell adhesion/invasion, and the subdominant elongation factor-Tu (Ef-Tu), a membrane-associated protein belonging to the family of hydrolases involved in protein synthesis, are targets for neutralizing antibodies [12,19,20]. The T4SS proteins VirB9.1, VirB9.2, VirB10, and VirB11 and the Ef-Tu have been recognized by sera from cattle immunized with OM that withstood the challenge with a virulent strain of A. marginale [12,21,22]. In the present study, the immune protection against A. marginale induced by a vaccine based on the recombinant proteins VirB9.1, VirB9.2, VirB10, VirB9.1, and Ef-Tu was evaluated in cattle.

Material and methods

Cattle

The cattle involved in this research were born and raised in an anaplasmosis-free Holstein dairy herd in Rafaela (31°12'S-61°30'W), a zone free from the cattle tick Rhipicephalus microplus in Argentina. The study group included a 4-month-old splenectomized calf used to amplify A. marginale and 20 2-year-old healthy steers used for vaccine evaluation, which were maintained in different isolation pens. All cattle received forage, concentrate and drinking water ad libitum. They were sprayed weekly with flumethrin (Bayticol® Pour-On, Bayer) to protect them from biting flies. All the animals were confirmed to be free of Anaplasma spp. infection by cELISA and nested PCR (nPCR) before the start of the experiment [23,24]. All procedures were approved by the Animal Care Committee of the Faculty of Veterinary Sciences, National University of Litoral (Protocol number 243/15).

Genomic DNA

DNA was purified from 900 μL of A. marginale-infected blood [25]. Briefly, erythrocytes were lysed with erythrocyte lysis buffer (0.14 M NH4Cl, 0.17 M TrisHCl) and the hemoglobin was eliminated by washes with distilled water. The inclusion bodies were lysed in 400 μL of cellular lysis buffer (0.05 M TrisHCl, 0.1 M EDTA, 0.1 M NaCl, 2% SDS, pH 8) with 160 μg of proteinase K. DNA was extracted with phenol/chloroform/isoamyl alcohol, precipitated with isopropyl alcohol and washed with 75% ice-cold ethanol. The pellet was suspended in 50 μL distilled water and kept at -20°C until use. The concentration and purity of DNA was assessed at 260–280 nm (NanoDrop 2000, Thermo Fisher Scientific, USA).

In silico analysis of proteins sequences

The prediction algorithm SignaIP 5.0 (http://www.cbs.dtu.dk/services/SignalP/) was used to predict signal peptides [26]. TMpred algorithm was used to predict the transmembrane domains of each protein (http://embnet.vital-it.ch/software/TMPRED_form.html) [27]. Solubility of the full-length and truncated form (without transmembrane domains) of the proteins was calculated using a prediction model based on overexpression of heterologous proteins in E. coli (http://www.biotech.ou.edu/) [28].

Cloning of DNA sequences

The recombinant proteins VirB9.1 and VirB9.2 were cloned and expressed as truncated form, without the signal peptide (tVirB9.1 and tVirB9.2). cDNA encoding residues 22–272 of VirB9.1 (AAV86251.1), 27–281 of VirB9.2 (AAV87107.1) and full-length sequences of VirB10 (AAV87106.1), VirB11(RCL20095.1), and Ef-Tu (WP_037348707.1) proteins were amplified by PCR using specific primers designed ad hoc (Table 1). The sequence for a six histidine tag (6 His-tag) at the C-terminus of tVirB9.2, VirB10, VirB11, and Ef-Tu proteins was added to the reverse primers (Table 1). Amplicons were cloned into pGEM-T Easy vector (Promega, USA) according to the manufacturer’s instructions. E. coli JM 109 competent cells (Promega) were transformed with the recombinant plasmids. Subsequently, a fragment was excised with restriction enzymes NdeI and BamHI (sites shown in Table 1), and subcloned into pET9b (Novagen, USA) to yield the ptVirB9.1, ptVirB9.2, pVirB10, pVirB11, and pEf-Tu plasmids. The identity of the DNA constructs was confirmed by sequencing (Biotechnology Institute, INTA CICVyA, Argentina). The constructs were used to transform E. coli BL21 RIL (DE3) pLysS competent cells (Novagen).
Table 1

Primers designed ad hoc for amplifying the DNA sequences of tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu proteins from Anaplasma marginale.

Protein nameForward primer (5´ to 3´)Reverse primer (5´ to 3´)
tVirB9.1catatgcaggaaccgcgctctatagggatcctttaaacccacgtccccttctggatg
tVirB9.2catatggtaagcggtggtgggatcctcagtgatggtgatggtgatggcggccttcaattttaaaaagcaccg
VirB11catatgacagcaggatacgcagcgttagggatccctagtgatggtgatggtgatgtttaaaatcattgccttgtgaacatttagtg
VirB10catatgtcagacgaaaccaaggataataacggatccctagtgatggtgatggtgatgtttaaacctacgcaccgcctccc
Ef-Tucatatgacagaagggagaaagccggatccctagtgatggtgatggtgatgtttaaactccaaaatctcagttatg

Sites of the restriction enzymes NdeI and BamHI are underlined. The sequences that codify for the six-histidine tag are shown in italics.

Sites of the restriction enzymes NdeI and BamHI are underlined. The sequences that codify for the six-histidine tag are shown in italics.

Protein expression and purification

E. coli BL21 RIL (DE3) pLysS competent cells carrying the plasmids ptVirB9.1, ptVirB9.2, pVirB10, pVirB11, or pEf-Tu were cultured at 37 °C in 500 mL of Luria–Bertani medium, supplemented with 50 μg/mL kanamycin and 34 μg/mL chloramphenicol to OD600nm = 1. Protein expression was induced with 1% lactose for 3 h; then, E. coli cells were harvested by centrifugation. The cells expressing tVirB9.2, VirB10, VirB11, and Ef-Tu proteins were suspended in 10 mL of lysis buffer A (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8) and those expressing tVirB9.1 were suspended in 10 mL of lysis buffer B (50 mM sodium phosphate, pH 7.2), both containing 1:1000 protease inhibitor cocktail set III (Calbiochem, USA). Finally, the cells were lysed twice at 20,000 psi using a cell disruptor (Avestin Emulsiflex B15, Canada). Soluble and insoluble fractions were isolated by centrifugation (12,000 xg, 4°C, 30 min). The tVirB9.1 and Ef-Tu proteins were purified from the soluble fraction of the E. coli lysate. The soluble fraction of tVirB9.1 was precipitated by adding saturated ammonium sulfate up to 30% saturation with stirring for 20 min on ice. The precipitated protein was separated from the supernatant by centrifugation (12,000 xg, 4 °C, 20 min). After desalting by dialysis in buffer C (25 mM TrisHCl, pH 7.2), tVirB9.1 was purified by ionic exchange chromatography on Q-sepharose fast flow resin (GE Healthcare, USA) equilibrated with the same buffer. The resin was washed with five volumes of buffer C containing 50 mM NaCl; then, the protein was eluted with five volumes of buffer C containing 200 mM NaCl. The soluble fraction of Ef-Tu was added to 2 mL of Ni+2-NTA agarose (Qiagen, Germany) previously equilibrated with lysis buffer A. After incubation at 4 °C for 1 h, the suspension was poured into a 1.5 cm x 5.0 cm column and washed with five volumes of 30 mM imidazole lysis buffer A. The protein was eluted successively with five volumes of 100 mM and then with five volumes of 200 mM imidazole lysis buffer A. The proteins tVirB9.2, VirB10, and VirB11 were purified under denaturing conditions. The inclusion bodies were obtained from the insoluble fraction of the E. coli lysate and washed three times using successively 1% of triton X-100, 2% of triton X-100 and 2 M urea, each diluted in the wash buffer (50 mM TrisHCl, 5 mM EDTA, 5 mM DTT, pH 8) and twice with ultrapure water. All washes were performed by centrifugation at 12,000 xg, at 20 °C for 15 min. The isolated inclusion bodies were solubilized by incubation at 25 °C for 3 h in denaturing buffer D (100 mM sodium phosphate, 8 M urea, 5 mM β-mercaptoetanol, pH 8) for VirB10 and VirB11. The denaturing buffer E (100 mM sodium phosphate, 6 M guanidinium chloride, 5 mM β-mercaptoethanol, pH 8) was used to solubilize tVirB9.2. After centrifugation (12,000 xg, 20 °C, 30 min), the soluble fraction was added to 2 mL of Ni+2-NTA agarose previously equilibrated with the corresponding denaturing buffer. After incubation at 20 °C for 1 h, the suspension was poured into a column and washed with five volumes of 30 mM imidazole denaturing buffer D. The proteins were eluted with five volumes of 200 mM imidazole denaturing buffer D. The purity of the proteins was assessed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) using a standard protocol [29]. The molar concentration in pure samples was calculated by absorbance at 280 nm using the molar extinction coefficient (ε280 nm) of each protein (25600 M-1cm-1, 26360 M-1cm-1, 11710 M-1cm-1, 25900 M-1cm-1, and 26025 M- 1cm-1 to tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu, respectively). Pure recombinant proteins were analyzed by Western blot (WB). Proteins were electrophoresed (0.2 μg/lane) on a 12% SDS-PAGE and transferred to a nitrocellulose membrane (Trans-Blot® 0.45 μm, Bio-Rad), by electroblotting at 50 V for 2 h. The membrane was blocked in TBS (50 mM TrisHCl, 150 mM NaCl, pH 7.6)/5% nonfat dried milk overnight at 4 °C. After five washes with TBST (TBS/0.05% Tween-20), it was incubated with mouse anti-His-tag MoAb (MA1-21315, Thermo Fisher Scientific), diluted 1:2000 in TBST/10% nonfat dried milk at room temperature for 1 h. After five washes with TBST, it was incubated with goat anti-mouse IgG peroxidase conjugate (#115-036-072 Jackson ImmunoResearch Inc., USA) at the same dilution for 1 h. The reaction was revealed by adding the colorimetric substrate 3,3’-diaminobenzidine tetrahydrochloride (DAB) (Sigma-Aldrich, USA). Three proteins, major surface protein 5 (MSP5) of A. marginale, surface antigen 1 (SAG1) of Neospora caninum, and merozoite surface antigen 2c (MSA2c) of Babesia bovis were expressed in E. coli and purified by pseudo-affinity on a Ni+2-NTA agarose column following the protocol descripted for MSP5 protein [30]. These proteins share the sequence (FKIEGRHHHHHH) in the C-terminal extreme with four of the proteins used as immunogens, and were used for the anti-His-tag adsorption step or for the determination of the presence of these antibodies at the post-absorption step.

Immunization

Two vaccine formulations based on a mixture of 50 μg of each pure recombinant protein (tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu) diluted in PBS were adjuvanted with 1 mg/mL Quil A (Brenntag, Denmark) or 50% v/v Montanide ISA201 (Seppic Inc., France). Quil-A formulations were prepared by adding the solid compound into diluted proteins. Montanide formulations were prepared following Seppic’s indications. Briefly, a stable emulsion W/O/W was prepared in a one-step process using a low shear rate and controlled temperature at 31°C (+/-1 °C). Twenty steers were randomly clustered into four groups (G) of five animals each (n = 5) and immunized with the recombinant proteins/Quil A (G1) or recombinant proteins/Montanide (G2) and PBS/Quil A (G3) or PBS/Montanide (G4), as controls. Cattle received four doses of 2 mL of the corresponding immunogen by subcutaneous (SC) injection in the neck, at three-week intervals (days 0, 21, 42, and 63). The presence of swelling at the immunization site was recorded. The cattle were bled once before immunization and then weekly during 10 weeks; the serum samples were stored at -20 °C until use.

Challenge

An isolate of A. marginale from Salta (Argentina) that had been stored frozen was used to challenge the immunity of the cattle [31]. Cryopreserved parasitized blood was thawed and inoculated into a splenectomized calf [32] that was bled when the parasitemia reached 5%, in 5% sodium citrate as anticoagulant. Each challenge dose was adjusted to 107 parasitized erythrocytes in a 2-mL final volume and inoculated SC to the cattle, on day 42 after the fourth immunization. The clinical reaction was monitored daily during 40 days, starting 10 days post-challenge (dpch), by measuring body temperature (T) in degrees Celsius (°C), packed cell volume (PCV), and percentage of parasitized erythrocytes (PPE) through blood smears stained with Giemsa that were microscopically analyzed (1000x) [33]. Cattle were treated with 20 mg kg-1 oxytetracycline (Terramicina® LA, Pfizer) to prevent death when the clinical parameters achieved ≤15 PCV, ≥5 PPE, or when the T was ≥41 °C during three consecutive days. The clinical parameters of each group were expressed as the mean of the maximum percent (%) drop of PCV, mean of the maximum PPE and mean of the cumulative T above 39.5 °C. Cattle were bled weekly during five weeks after challenge; the whole blood was analyzed by nPCR and the serum samples were tested by cELISA [23,24].

Antibody response

An indirect ELISA (iELISA) was used to detect total IgG (IgGT), IgG1, and IgG2 specific against tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu. To eliminate antibodies directed toward remnant E. coli proteins and the C-terminal His-tag, sera from immunized cattle were adsorbed with lysate from E. coli expressing SAG1. To evaluate the removal of anti-His-tag antibodies from immune sera, IgGT against A. marginale MSP5 and Babesia bovis MSA2c were measured. Optimal dilutions were established using checkerboard titrations with dilutions of sera, antigens and conjugates [34]. Polystyrene microplates (Thermo Fisher Scientific) were individually coated with 100 μL of each recombinant protein (5 μg/mL) in PBS (145 mM NaCl, 4.4 mM NaHPO4, 18.3 mM NaH2PO4), and incubated overnight at 4 °C. The coated plates were washed with PBS three times and incubated with 300 μL of blocking buffer (PBS/10% nonfat dried milk) at 25 °C for 1 h. These conditions were also used for sera and conjugate incubations. To assess IgGT, the plates were washed with PBST (PBS/0.05% Tween-20) three times and then incubated with 100 μL of serum samples diluted 1:10 in PBST/10% nonfat dried milk. After four washes with PBST, they were incubated with 100 μL of rabbit anti-bovine IgG peroxidase conjugate (A5295, Sigma-Aldrich), diluted 1:2000 in PBST/10% nonfat dried milk. After four washes as above, 100 μL of chromogenic substrate 1 mM 2,2'-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS) (Sigma-Aldrich) in 0.05 M sodium citrate pH 4.5, 0.03% v/v H2O2 was added. The absorbance was measured in a microplate reader at 405 nm at 25 °C, 15 min after the addition of chromogenic substrate. The cutoff point for each antigen was set as the OD405nm mean for the pre-immune sera (n = 20) + 3 standard deviation (SD) [35]. To assess IgG1 and IgG2 antibodies, the ELISA protocol described above was performed with a few modifications. Serum samples were diluted 1:20 and the mouse anti-bovine IgG1 MoAb (MCA627 Serotec™, UK) or IgG2 (B8400, Sigma-Aldrich) were added at a dilution of 1:1000. As second antibody, goat anti-mouse IgG peroxidase conjugate (Jackson, ImmunoResearch) at the same dilution was used. The IgG1/IgG2 ratio of OD405nm was analyzed for G1 and G2 [36]. All field serum samples and controls were assayed in duplicate.

Specificity of antibodies

Anti tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu antibodies from sera of G1 and G2 cattle were evaluated by WB 7 days after the fourth immunization, following the previously described protocol. Before the test, cattle sera were adsorbed by overnight incubation at 4 °C with an E. coli lysate expressing SAG1. To evaluate the removal of anti-His-tag antibodies from immune sera, MSP5 was included as a control in the WB. The recognition of the proteins expressed in A. marginale by the cattle sera was evaluated by WB using a crude antigen of A. marginale purified from blood of a splenectomized calf with 80% of parasitemia. This A. marginale crude antigen was obtained following the protocol described for production of antigen of Card agluttination test [8]. In the WB, sera were diluted 1:100. The antigen-antibody reaction was detected using rabbit anti-bovine IgG peroxidase conjugate (A5295, Sigma-Aldrich) at a dilution of 1:1000.

Statistical analysis

Data were analyzed using the software InfoStat (Universidad Nacional de Córdoba, Córdoba, Argentina) (http://www.infostat.com.ar). The levels of antibodies against recombinant proteins were compared between groups using a Generalized Linear Model of repeated measurements with Gamma distribution as a link function considering the frequency distribution of the response variable. The means of the clinical parameters, cumulative T above 39.5°C, maximum % drop of PCV, and maximum PPE between groups after the challenge were compared using ANOVA. Differences in the mean of antibodies anti-MSP5 (inhibition percentage) between immunized and control groups on different dpch were analyzed by Mann Whitney test. All statistical analyses were considered significant at p<0.05.

Results

Sequences analysis, expression and purification of recombinant proteins

In silico analysis showed that VirB9.1 and VirB9.2 proteins contain a signal peptide with a cleavage site within the 20–21 and 25–26 residue region, respectively (S1 Table). No signal peptides were identified for VirB10, VirB11, or Ef-Tu proteins. The analysis of the primary structure of the proteins showed a transmembrane helix (TMH) in the N-terminus of VirB9.1 (residues 4–22) and VirB9.2 (residues 7–27) and two TMH in VirB10 (residues 29–47 and 339–357). TMH was not predicted in VirB11 or Ef-Tu. The predicted solubility for the proteins VirB9.1, VirB9.2, and VirB10, which contain a hydrophobic region, was 38.7%, 100%, and 0%, respectively. The solubility for VirB9.1 increased to 98.7% when it was expressed as truncated protein (residues 22–272). Removal of the hydrophobic region did not modify the predicted solubility for the VirB9.2 or VirB10 proteins. The VirB9.1 and VirB9.2 proteins were expressed without their signal peptide, whereas VirB10, VirB11, and Ef-Tu proteins were expressed with their full-length sequence. The recombinant proteins tVirB9.1 and Ef-Tu were expressed in soluble form in the cytoplasm of E. coli with a yield of 20 and 15 mg per liter of culture after their purification, respectively. The recombinant proteins tVirB9.2, VirB10, and VirB11 were expressed mainly in inclusion bodies and had a yield of 20, 10, and 12 mg per liter of culture, respectively, after their purification under denaturing conditions. The approximate molecular masses for the purified tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu were 28, 29, 49, 38, and 44 kDa, respectively (Fig 1A). The molecular size observed agrees with that expected for each protein. The recombinant proteins reacted with the MoAb anti-His tag (Fig 1B), except for tVirB9.1, which lacked the His-tag epitope.
Fig 1

Evaluation of Anaplasma marginale purified recombinant proteins.

(A) SDS-PAGE, stained with Coomassie Brilliant Blue R-250. (B) Western blot using anti-His-tag MoAb. MW: molecular weight marker (kDa); lane 1: VirB10; lane 2: tVirB9.1; lane 3: VirB11; lane 4: tVirB9.2; lane 5: Ef-Tu.

Evaluation of Anaplasma marginale purified recombinant proteins.

(A) SDS-PAGE, stained with Coomassie Brilliant Blue R-250. (B) Western blot using anti-His-tag MoAb. MW: molecular weight marker (kDa); lane 1: VirB10; lane 2: tVirB9.1; lane 3: VirB11; lane 4: tVirB9.2; lane 5: Ef-Tu.

Adjuvant reaction

Cattle that received Montanide as adjuvant (G2 and G4) showed a small inflammatory reaction <1.5 cm at the immunization site (neck region), whereas no reaction was observed in those that received Quil A (G1 and G3). All G1 and G2 cattle generated antibodies against each recombinant protein after immunizations, detected by iELISA, whereas G3 and G4 cattle remained negative until the challenge. The kinetics of IgGT, IgG1, and IgG2 was similar for G1 and G2, both after immunizations and after challenge with A. marginale. An increase of IgGT levels against tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu, above the cutoff point, was detected from day 7 after the second immunization (Fig 2). From this day, G1 and G2 cattle showed similar IgGT levels (p>0.05) (Fig 2). Regarding the immune response stimulated by each antigen individually, tVirB9.1 and tVirB9.2 induced a higher level of IgGT than VirB10, VirB11, and Ef-Tu (p<0.05). At 35 dpch, G3 and G4 cattle showed a significant increment of IgGT levels (p<0.05), although the values were lower than those of G1 and G2 cattle. At this time, antibodies against A. marginale MSP5 protein were detected in the four groups of cattle (Fig 2).
Fig 2

Kinetics of antibody response (IgGT, IgG1, and IgG2) to each recombinant protein measured by iELISA.

Group 1, recombinant proteins/Quil A (—); Group 2, recombinant proteins/Montanide (---); Group 3, PBS/Quil A () and Group 4, PBS/Montanide (). Each point represents the mean ± SEM of the OD405nm at different days after immunization and at 35 days after challenge (day 140). IgGT against A. marginale MSP5 and B. bovis MSA2c were measured as control of the presence of anti-His-tag antibodies. The horizontal dotted line indicates the cutoff point. The arrows indicate the days of the immunizations and the vertical dotted line indicates the day of challenge with A. marginale (on day 42 after the fourth immunization).

Kinetics of antibody response (IgGT, IgG1, and IgG2) to each recombinant protein measured by iELISA.

Group 1, recombinant proteins/Quil A (—); Group 2, recombinant proteins/Montanide (---); Group 3, PBS/Quil A () and Group 4, PBS/Montanide (). Each point represents the mean ± SEM of the OD405nm at different days after immunization and at 35 days after challenge (day 140). IgGT against A. marginale MSP5 and B. bovis MSA2c were measured as control of the presence of anti-His-tag antibodies. The horizontal dotted line indicates the cutoff point. The arrows indicate the days of the immunizations and the vertical dotted line indicates the day of challenge with A. marginale (on day 42 after the fourth immunization). tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu but not MSP5 were recognized by antibodies present in serum samples of all G1 and G2 cattle obtained 7 days after fourth immunization, when they were evaluated by WB (Fig 3). Moreover, these antibodies recognized proteins in the A. marginale crude antigen (Fig 3).
Fig 3

Reactivity of sera obtained 7 days after the fourth immunization from cattle inoculated with recombinant proteins/Quil A (Group 1) or recombinant proteins/Montanide (Group 2) by Western blot.

A representative steer of group 1 is shown. MW: molecular weight marker (20, 25, 37, 50 kDa). Lane 1: MSP5; lane 2: Ef-Tu; lane 3: tVirB9.2; lane 4: VirB11; lane 5: tVirB9.1; lane 6: VirB10; lane 7: A. marginale crude antigen. Sera were diluted 1/100 and the reaction was detected with anti-bovine IgG peroxidase conjugate.

Reactivity of sera obtained 7 days after the fourth immunization from cattle inoculated with recombinant proteins/Quil A (Group 1) or recombinant proteins/Montanide (Group 2) by Western blot.

A representative steer of group 1 is shown. MW: molecular weight marker (20, 25, 37, 50 kDa). Lane 1: MSP5; lane 2: Ef-Tu; lane 3: tVirB9.2; lane 4: VirB11; lane 5: tVirB9.1; lane 6: VirB10; lane 7: A. marginale crude antigen. Sera were diluted 1/100 and the reaction was detected with anti-bovine IgG peroxidase conjugate. The recombinant proteins tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu, using Quil A or Montanide as adjuvants, induced a stronger IgG2 response than that of IgG1 both after immunizations and after challenge (p<0.05), and the IgG1/IgG2 ratio remained <1 (Table 2). All cattle from G3 and G4 showed an increase of IgG1 and IgG2 levels after challenge (p<0.05), but with lower values than those reached by G1 and G2 cattle (Fig 2).
Table 2

Mean of IgG1/IgG2 ratio (OD405nm) in the immunized groups recorded on day 7 after the fourth immunization with recombinant proteins/Quil A (Group 1) or recombinant proteins/Montanide (Group 2) and 35 days after challenge with Anaplasma marginale.

GroupsMean of IgG1/IgG2 ratio (Day 7 after the fourth immunization/Day 35 after-challenge)
tVirB9.1tVirB9.2VirB10VirB11Ef-Tu
Group 10.43/0.520.23/0.35*0.25/0.40*0.38/0.51*0.43/0.56
Group 20.63/0.660.42/0.470.23/0.340.32/0.420.63/0.58

Significant differences (p<0.05) between pairs of values are indicated with an *

Significant differences (p<0.05) between pairs of values are indicated with an *

Response to challenge

After challenge with 107 erythrocytes parasitized with A. marginale, cattle from all groups responded with a significant drop of PCV and a significant increase of PPE (p<0.05), requiring treatment (20 mg kg-1 oxytetracycline) to prevent their death. After a prepatent period of 20 ± 1 days, A. marginale infection was confirmed through Giemsa stained blood smears in all cattle. There were no significant differences between groups in the means of the evaluated clinical parameters (p>0.05) (Table 3). The antibiotic treatment administered to cattle between days 23 and 30 after challenge attenuated the drop of PCV and the increase of PPE. The maximum % drop of PCV and the maximum PPE were recorded between days 28 and 30 after challenge in all cattle.
Table 3

Mean values (± SD) of clinical parameters for each group of cattle immunized with four doses of recombinant proteins/Quil A (Group 1), recombinant proteins/Montanide (Group 2), PBS/Quil A (Group 3), or PBS/Montanide (Group 4) after challenge with 107 Anaplasma marginale parasitized erythrocytes.

GroupsMaximum percent drop of PCVMaximum PPECumulative T above 39.5 °COTC-treated cattle (n/n)
Group 148.4 ± 5.15.8 ± 0.81.2 ± 0.55/5
Group 244.4 ± 3.96.0 ± 1.01.4 ± 0.85/5
Group 345.7 ± 7.76.9 ± 0.21.1 ± 0.65/5
Group 445.7 ± 7.97.0 ± 0.61.4 ± 0.85/5

PCV, packed cell volume; PPE, percentage of parasitized erythrocytes; T, body temperature; OTC, oxytetracycline.

Values were not significantly different among groups (p>0.05)

PCV, packed cell volume; PPE, percentage of parasitized erythrocytes; T, body temperature; OTC, oxytetracycline. Values were not significantly different among groups (p>0.05) Infection was confirmed in all cattle by nPCR at 14 dpch. By cELISA and iELISA, all cattle were positive at 35 dpch (Fig 2). At 14 dpch, the mean of anti-MSP5 antibodies, determined by cELISA and expressed as percentage of inhibition, of the immunized groups was higher than the mean of the control groups. These results show a greater number of positive immunized animals (6/10) than that of positive controls animals (0/10).

Discussion

In this work, five subdominant A. marginale proteins were tested as immunogens in cattle. These proteins were postulated as vaccine candidates, but have not been evaluated in an immunization and challenge experiment [12,22]. Recombinant tVirB9.1, tVirB9.2, VirB10, VirB11, and Ef-Tu proteins failed to induce protection against the pathogenic effects of A. marginale following the experimental challenge. The outer membrane (OM) T4SS proteins are important for intracellular survival and virulence of Gram negative bacteria [12,37]. Many of those proteins are exposed on the cell surface, where they could be targeted by neutralizing antibodies. The subdominant epitopes are eligible to induce immune protection, as it was clearly established for other pathogens [38,39]. T4SS proteins and Ef-Tu are highly conserved among geographically distinct strains of A. marginale [12]. Tebele et al. (1991) and Brown et al. (1998) demonstrated that immunization of calves with fractions or the whole A. marginale OM, adjuvanted with saponin, induced immune protection against homologous challenge, characterized by a strong T helper cell immune response and high titers of IgG2 [4,9]. Despite the response of IgG2 observed in this work, both vaccine formulations failed to mitigate the course of infection. Other subdominant proteins from the OM, AM854 and AM936, were able to induce IgG2 immune response; however, they also failed to protect against the challenge [40]. Albarrak et al. (2012) demonstrated that the subdominant protein AM779 from the OM was unable to protect calves after the homologous challenge with adult males of Dermacentor andersoni infected with the A. marginale St. Maries strain [41]. In those experiments, IgG2 titers to subdominant proteins were similar in cattle immunized with recombinant proteins or purified OM. This finding supports the theory that antigen amount is not a primary determinant of subdominance for B cell responses [41]. The IgG2 titers specific for subdominant proteins obtained from cattle vaccinated with OM ranged from 100 to 5,000 [12,40,41], in contrast with IgG2 titers to MSP2, which were higher than 30,000 [12,41]. It is possible that the lack of protection in our work was due to low IgG2 levels; however, it has been shown that IgG2 titers do not correlate with protection [41]. In addition, the clinical signs observed in this work were similar to those reported for cattle immunized with subdominant recombinant proteins [40,41]. The antibody response to MSP5 14 dpch was observed in 60% of immunized cattle (G1 and G2), whereas control cattle (G3 and G4) remained negative. This difference could be attributed to the presence of opsonizing antibodies generated after immunization with the recombinant proteins. It is well known that antibodies are better opsonins for the adaptive immune system than the complement factors of the innate immune system. Thus, after the challenge, in the immunized cattle the antibodies directed against A. marginale surface exposed proteins (VirB9.1, VirB9.2, and VirB10), opsonized the bacteria and were recognized, through the Fc region of the IgG, by the phagocytic cells that processed the opsonized bacteria and presented to T cells. This process would favor the early secretion of antibodies in the immunized animals. The lack of protective immunity observed in this study could be attributed to the failure of the recombinant proteins to expose their critical epitopes with the correct conformation and generate a protective immune response. The proper conformational structure of epitopes is obtained when the recombinant proteins are expressed in native form [14,42], a task that is difficult to perform with the OM proteins of A. marginale due to their intrinsic characteristics. In previous works, recombinant VirB9.1, VirB9.2, VirB10, VirB11, and Ef-Tu proteins were obtained under denaturing conditions [12,21,22]. Zhao et al. (2016) were able to express VirB9.1 in the E. coli soluble fraction as GST-VirB9.1, whereas VirB9.2 expressed in the insoluble fraction as SUMO-VirB9.2 was then refolded [14]. The cloning and expression of heterologous recombinant proteins in E. coli that lack the signal peptide can increase the expression levels and the solubility of the proteins without affecting their immunogenicity [43]. In this work, in silico analysis showed that the expression of soluble VirB9.1 was improved without inclusion of the signal peptide; thus, tVirB9.1 (residues 22–272) was expressed in the E. coli soluble fraction. Contrary to results reported by Zhao et al. (2016) [14], refolding of tVirB9.2 without its signal peptide (residues 27–281), obtained in the insoluble fraction in E. coli, was not achieved. This difference could be explained by the use of the SUMO fusion protein, which prevents aggregation of folding intermediates, keeping them in solution long enough to adopt correct conformations [44]. Another cause of vaccine failure in this study may have been the inability of the immunogen to generate antibodies that block the parasite entry to the host cell. The most successful vaccines target highly conserved epitopes required by the pathogenic parasites for their host cell entry [45]. During A. marginale multiplication, new antigenic variants of MSP2 are generated. Studies have demonstrated that this antigenic variation of MSP2 also occurs during persistent A. centrale infections [46]. The conservation of CD4+ T-cell epitopes between A. marginale-MSP2 and A. centrale-MSP2, and the generation of new antigenic variants during the Anaplasma life cycle may contribute to the cross-protection produced by A. centrale live vaccine. In addition, studies have shown that multi-antigen vaccines may be more effective to induce a protective response than an individual antigen [47]. In this work, the five proteins evaluated may have been insufficient to generate antibodies capable to block the erythrocytes invasion by A. marginale. The development of an effective recombinant vaccine against A. marginale based on subdominant antigens of the OM to block the host cells-parasite interplay requires further studies to identify the critical epitopes of these antigens, express them as native proteins and determine the protein-protein interactions. (PDF) Click here for additional data file.

In silico analysis of protein sequences.

The signal peptide of VirB9.1 and VirB9.2, excluded from tVirB9.1 and tVirB9.2, are highlighted with horizontal gray bars. The transmembrane helices from VirB10 are indicated in italics. (PDF) Click here for additional data file. 6 Nov 2019 PONE-D-19-26977 A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge PLOS ONE Dear miss Sarli, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. 1) It is important to assure that the antibodies is against the antigens and not to the his-tag. A non-related protein with the same his-tag can be used as control; 2) Please, answer to all the comments raised by both reviewers. We would appreciate receiving your revised manuscript by Dec 21 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Paulo Lee Ho, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 1. To comply with PLOS ONE submission requirements, in your Methods section, please ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering. 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Dear Authors, This clearly written manuscript presents negative data regarding an immunization and challenge using primarily the type 4 secretion system components of Anaplasma marginale. Overall this is nicely done work, though a few things require strengthening or clarification. The authors need to more clearly demonstrate that they are measuring the immune response directed against the recombinant proteins and not the His tag following immunization. Though it is mentioned on line 227 that the sera were adsorbed with E. coli lysate, it is not clear that the expressed His tag was included in the E. coli lysate. Additionally, there are no controls to demonstrate that the adsorption was effective in removing the anti-his tag antibodies from the immune serum. This must be clearly addressed in the indirect ELISAs measuring total IgG, IgG1 and IgG2 and the western blot (Fig. 3) in the manuscript. Ef-Tu is an elongation factor and has been identified as a vaccine candidate for A. marginale. However, it is not part of the T4SS, this should be clearly explained in the introduction, abstract and discussion. It would be useful to use A. marginale protein from infected RBCs in a western blot to confirm that the antibody response to the recombinant proteins resulted in antibodies that can bind A. marginale proteins. Line 209 and 219: A serum dilution of 1:10 (total IgG) and 1:20 for IgG1 and IgG2 is a very low dilution and suggests that the antibody response was potentially non-specific and weak. Please address this more fully in the manuscript. Line 215: Please more fully describe the origin of the negative sera? Is this pre-immune serum from the calves in the study or is these sera from other known negative animals? Line 226 and throughout the manuscript- It is difficult to put the results in context because the timeline is generally referenced based on the number of days following the first inoculation. For example, 28 days following the first inoculation is same as one week after the second inoculation. In this case is important for the reader to know that a second immunization was done and the sera were collected one week later in order to put the results in context. Please edit through the document in order to put the timeline into the context of the results. Line 227 and Fig. 3: What was the serum dilution used for the bovine immune serum in the western blot? Please include a control on the western blot indicating that absorption was sufficient to remove the anti-his tag antibodies. Please clarify why Msp5 is used as the negative control? Does it have a His-tag? Please include the production of Msp5 in the methods. Please include pre-immune serum as a negative control. Statistical analysis- Collapsing the data into a single data point for each parameter (PCV or PPE) for each animal results in a loss of data points. For example, PCV and PPE was determined daily for each animal, yet the statistical analysis was done with the maximum decrease in PCV for each animal or the maximum PPE for each animal, thus resulting in only one data point for each animal for each category and thus an overall loss of data and potentially statistical power. Admittedly this is unlikely to change the outcome of the analysis given the lack of differences between groups, but is still worth consideration. Table 3: Please clarify maximum PPCV decrease. Is this the % drop in PCV? Standard deviation, as a measure of the amount of variability is more appropriate in this case than standard error. Minor suggestions PCV is by definition a percent and is generally represented by PCV, not PPCV. If the measurement is percent drop in PCV, just say “percent drop in PCV”. Line 47,77- The use of the word, multiplied, is unusual in this context. Suggest, using either “produced” or “amplified” instead. Line 102- Add GenBank accession numbers as reference for the genes. Line 157-Add a space between dodecyl and sulfate Fig. 1- Overall this figure needs improvement. Specifically, there needs to be more space between the coomasie and the western blot as the numbers for the ladder for the western blot overlap with the coomasie. Suggest improving figure 1 and removing the supplemental results. Reviewer #2: Dear Editor, Please find below the manuscript "A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge" PONE-D-19-26977, after complete correction. The authors developed two formulations containing A. marginale type IV secretion system (T4SS) subdominant proteins: VirB9.1, VirB9.2, VirB10, VirB11, and Ef-Tu T4SS beind expressed in E. coli. This proteins were absorbed on a Quil A® adjuvant (aqueous saponin adjuvant - G1) and and Montanide ISA 201 ready-to-use adjuvants for Water-in-Oil-in-Water emulsion (G2) and control groups Quil A® (G3) and ISA 201 (G4), respectively. Recent reports describe that conserved membrane proteins that are subdominant in Anaplasma species, such as VirB9 and VirB10, are constituents of the Type 4 secretion system (T4SS) that is conserved amongst many intracellular bacteria and performs essential functions for invasion and survival in host cells (Crosby et al 2018). Therefore, here this study is important. In addition, the work used free healthy cattle and also splentomized calves with parasitized erythrocytes from A, marginale, besides to explain the participation of constituents of the Type 4 secretion system (T4SS) on the immune response against A marginale virulent. However I would like to request some explanations: line 52 -54 " Such protection was correlated with induction of high titers of IgG2 opsonizing antibodies against A. marginale surface epitopes and macrophage activation mediated by CD4+ T cells [4,11,12]". To compare the works (4,11,12) and the challenge test employed. Thus, it is important to insert on the discussion section. line 94 - 100 and 241 -267 "In silico analysis of T4SS proteins sequences". I would suggest the authors to consider the inclusion of figure or a table with the sequences. line 172 - 182 "Immunization...I would like that authors described about the adsorption methods of the vaccine formulations employed. It´s necessary to describe on the material and methods section. Line 187 - 188 "Each challenge dose was adjusted to 107 parasitized erythrocytes in a 2 mL final volume and inoculated SC to the cattle, on day 105 after the first inoculation. Why? Others reports (Santos et al 2013; Crosby et al 2018) employed 1 x 10 5 for both dominant and subdominant epitopes. it is important to insert discussion section. line 341-349 "Despite the correlation between IgG2 and protective immunity, both vaccine formulations evaluated in this work induced a strong IgG2 response but failed to mitigate the course of infection. Other subdominant proteins from the OM, AM854 and AM936, were able to induce an immune response comparable to that induced by the whole OM, based on high levels of IgG2; however, they also failed to protect against the challenge [37]" Here, I would like that authors described about the IgG2 production by dominant epitopes, and to compare with obtained data this work (subdominant epitopes). line 377 - 383 "Another cause of vaccine failure in this study may have been the inability of the immunogen to generate antibodies to block the parasite entry to the host cell. The most successful vaccines target highly conserved epitopes required by the pathogenic parasites for their host cell entry [42]". Here, I would like that authors described about the MSP-2 variants and the CD4(+)-T-cell epitopes that may be responsible for all or part of the A. centrale vaccine efficacy. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Alex Sander Rodrigues Cangussu [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PlosOne 19-26977_reviewers.docx Click here for additional data file. 21 Dec 2019 R. The authors need to more clearly demonstrate that they are measuring the immune response directed against the recombinant proteins and not the His tag following immunization. Though it is mentioned on line 227 that the sera were adsorbed with E. coli lysate, it is not clear that the expressed His tag was included in the E. coli lysate. Additionally, there are no controls to demonstrate that the adsorption was effective in removing the anti-his tag antibodies from the immune serum. This must be clearly addressed in the indirect ELISAs measuring total IgG, IgG1 and IgG2 and the western blot (Fig. 3) in the manuscript. A. We made changes in the manuscript. Briefly, in the study we used three recombinant proteins (SAG1, MSA2c and MSP5) for the adsorption of antibodies anti-His-tag and for the control of the adsorption step. These proteins were expressed in E. coli with His-tag and were purified with Ni2+-NTA agarose. The sera were adsorbed with an E. coli lysate expressing SAG1 protein of Neospora caninum. Moreover, we added MSP5 of A. marginale as control to determine the presence of anti-His-tag antibodies in the WB assay (Fig 3) and we used A. marginale MSP5 and Babesia bovis MSA2c recombinant proteins to control the presence of antibodies anti-His-tag in the iELISA assay (Fig 2). These specifications were detailed in the Material and methods and Results sections. R. Ef-Tu is an elongation factor and has been identified as a vaccine candidate for A. marginale. However, it is not part of the T4SS, this should be clearly explained in the introduction, abstract and discussion. A. We made the changes. R. It would be useful to use A. marginale protein from infected RBCs in a western blot to confirm that the antibody response to the recombinant proteins resulted in antibodies that can bind A. marginale proteins. A. We added in the WB assay (Fig 3) a control of interaction of the post-immunization antibodies with a crude antigen of A. maginale purified from the blood of a splenectomized calf with 80% of parasitemia. The crude antigen was purified following the protocol described for the Card agglutination test. R. Line 209 and 219: A serum dilution of 1:10 (total IgG) and 1:20 for IgG1 and IgG2 is a very low dilution and suggests that the antibody response was potentially non-specific and weak. Please address this more fully in the manuscript. A. Although the dilution of the sera is low, we adsorbed the sera before performing ELISA and WB, with an E. coli lysate expressing SAG1. Then, we demonstrated the specificity of antibodies by the lack of reaction of sera with MSP5 and MSA2c by ELISA and WB (Fig 2 and Fig 3) and the reaction with proteins obtained from A. marginale crude antigen (Fig 3). This point was included in the discussion. R. Line 215: Please more fully describe the origin of the negative sera? Is this pre-immune serum from the calves in the study or are these sera from other known negative animals? A. The description of the negative sera was included in the manuscript (line 235). Pre-immune sera from cattle were used in this study. R. Line 226 and throughout the manuscript- It is difficult to put the results in context because the timeline is generally referenced based on the number of days following the first inoculation. For example, 28 days following the first inoculation is same as one week after the second inoculation. In this case is important for the reader to know that a second immunization was done and the sera were collected one week later in order to put the results in context. Please edit through the document in order to put the timeline into the context of the results. A. We made the changes in the manuscript. R. Line 227 and Fig. 3: What was the serum dilution used for the bovine immune serum in the western blot? Please include a control on the western blot indicating that absorption was sufficient to remove the anti-his tag antibodies. Please clarify why Msp5 is used as the negative control? Does it have a His-tag? Please include the production of Msp5 in the methods. Please include pre-immune serum as a negative control. A. We included the data in the manuscript. The dilution of sera in the WB was 1:100. As control of anti-His-tag antibodies removal, MSP5-His-tag was included. MSP5 was used as a negative control because it is not part of the immunogen formulation, but contains a His-tag. The production of MSP5 was referenced (line 178). R. Statistical analysis- Collapsing the data into a single data point for each parameter (PCV or PPE) for each animal results in a loss of data points. For example, PCV and PPE was determined daily for each animal, yet the statistical analysis was done with the maximum decrease in PCV for each animal or the maximum PPE for each animal, thus resulting in only one data point for each animal for each category and thus an overall loss of data and potentially statistical power. Admittedly this is unlikely to change the outcome of the analysis given the lack of differences between groups, but is still worth consideration. A. We admit the loss of data in this analysis but we chose this methodology to present the results due to the absence of differences between groups. R. Table 3: Please clarify maximum PPCV decrease. Is this the % drop in PCV? Standard deviation, as a measure of the amount of variability is more appropriate in this case than standard error. A. We made the changes in the manuscript. PPCV is the % drop in PCV. Minor suggestions R. PCV is by definition a percent and is generally represented by PCV, not PPCV. If the measurement is percent drop in PCV, just say “percent drop in PCV”. A. We made the change in the manuscript. R. Line 47,77- The use of the word, multiplied, is unusual in this context. Suggest, using either “produced” or “amplified” instead. A. We made the change in the manuscript. R. Line 102- Add GenBank accession numbers as reference for the genes. A. We added the access in the manuscript (lines 106 to 107). R. Line 157-Add a space between dodecyl and sulfate A. We made the change in the manuscript. R. Fig. 1- Overall this figure needs improvement. Specifically, there needs to be more space between the coomasie and the western blot as the numbers for the ladder for the western blot overlap with the coomasie. Suggest improving figure 1 and removing the supplemental results. A. We improved the figure. R. line 52 -54 " Such protection was correlated with induction of high titers of IgG2 opsonizing antibodies against A. marginale surface epitopes and macrophage activation mediated by CD4+ T cells [4,11,12]". To compare the works (4,11,12) and the challenge test employed. Thus, it is important to insert on the discussion section. A. The authors of reference 11 did not perform a challenge. They demonstrated that in A. marginale outer membrane-vaccinated cattle, VirB9, VirB10, and CTP are recognized by serum IgG2 and stimulate memory T-lymphocyte proliferation and gamma interferon secretion. Reference 12 is a review. R. line 94 - 100 and 241 -267 "In silico analysis of T4SS proteins sequences". I would suggest the authors to consider the inclusion of figure or a table with the sequences. A. We included the sequences in the manuscript as supporting information (S1 Table). R. line 172 - 182 "Immunization...I would like that authors described about the adsorption methods of the vaccine formulations employed. It´s necessary to describe on the material and methods section. A. We described the methods in the manuscript (lines 187 to 191). R. Line 187 - 188 "Each challenge dose was adjusted to 107 parasitized erythrocytes in a 2 mL final volume and inoculated SC to the cattle, on day 105 after the first inoculation. Why? Others reports (Santos et al 2013; Crosby et al 2018) employed 1 x 10 5 for both dominant and subdominant epitopes. it is important to insert discussion section. A. In the cited reports, the protection conferred by different antigens is evaluated in mice. In this species, the challenge dose and the challenge via are different than in cattle. Also in Crosby et al 2018, the mice are challenged with A. phagocytophilum that has tropism by a different cell (netrophils). The challenge dose depends on the species and via used. Different A. marginale challenge doses in cattle are evaluated in Abdala et al 1990. R. line 341-349 "Despite the correlation between IgG2 and protective immunity, both vaccine formulations evaluated in this work induced a strong IgG2 response but failed to mitigate the course of infection. Other subdominant proteins from the OM, AM854 and AM936, were able to induce an immune response comparable to that induced by the whole OM, based on high levels of IgG2; however, they also failed to protect against the challenge [37]" Here, I would like that authors described about the IgG2 production by dominant epitopes, and to compare with obtained data this work (subdominant epitopes). A. We incorporated the description in the manuscript (lines 379 to 386). R. line 377 - 383 "Another cause of vaccine failure in this study may have been the inability of the immunogen to generate antibodies to block the parasite entry to the host cell. The most successful vaccines target highly conserved epitopes required by the pathogenic parasites for their host cell entry [42]". Here, I would like that authors described about the MSP-2 variants and the CD4(+)-T-cell epitopes that may be responsible for all or part of the A. centrale vaccine efficacy. A. We incorporated the description in the manuscript (lines 419 to423). Submitted filename: Response to Reviewers.docx Click here for additional data file. 31 Jan 2020 PONE-D-19-26977R1 A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge PLOS ONE Dear miss Sarli, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Mar 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Paulo Lee Ho, Ph.D. Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have addressed all concerns and suggestions from this reviewer. We appreciate their efforts. Below are a few more minor suggestions, mostly regarding word choice: Line 15: Suggest replacing “multiplied” with “produced” or “amplified”. Line 16: suggest replacing “vector” with “carry” or “transmit” Line 18: Replace “works” with “work” Line 23 and 26: Cattle from G1 and G2 were inoculated with a mixture of 50 ug of each recombinant protein with QuilA and Montanide adjuvants. Edit as follows: Cattle from G1 and G2 were inoculated with a mixture of 50 ug of each recombinant protein with QuilA or Montanide adjuvants, respectively. Line 26: “Cattle received four doses…”. I suggest: Cattle received four immunizations…” Line 28, line 245, 294, 298, 300, 311, 314, 319 and throughout the manuscript, for clarity, I suggest using immunization instead of inoculation when referring to administration of the antigens. This more specific language helps differentiate between immunization and challenge. Line 289: “(B) Western blot revealed with…” suggest “(B) Western blot using anti-His-tag….” Line 312: Replace Babesia bovis with B. bovis Line 315: Replace Anaplasma marginale with A. marginale Reviewer #2: I'm satisfied with the authors responses and recommend the publication of the work. However, I suggest a minor revision as described in the attached. Grateful for the opportunity to evaluate this work. The work it is important to elucide about the subdominant epitopes participation of Anaplasma marginale and the immunization of bovines. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Alex Sander Rodrigues Cangussu [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE D_19_26977R1_Reviewer#1.docx Click here for additional data file. 31 Jan 2020 Reviewer #1 Line 15: Suggest replacing “multiplied” with “produced” or “amplified”. We made the change in the manuscript. Line 16: suggest replacing “vector” with “carry” or “transmit” We made the change in the manuscript. Line 18: Replace “works” with “work” We made the change in the manuscript. Line 23 and 26: Cattle from G1 and G2 were inoculated with a mixture of 50 ug of each recombinant protein with QuilA and Montanide adjuvants. Edit as follows: Cattle from G1 and G2 were inoculated with a mixture of 50 ug of each recombinant protein with QuilA or Montanide adjuvants, respectively. We made the change in the manuscript. Line 26: “Cattle received four doses…”. I suggest: Cattle received four immunizations…” We made the change in the manuscript. Line 28, line 245, 294, 298, 300, 311, 314, 319 and throughout the manuscript, for clarity, I suggest using immunization instead of inoculation when referring to administration of the antigens. This more specific language helps differentiate between immunization and challenge. We made the changes in the manuscript. Line 289: “(B) Western blot revealed with…” suggest “(B) Western blot using anti-His-tag….” We made the change in the manuscript. Line 312: Replace Babesia bovis with B. bovis We made the change in the manuscript. Line 315: Replace Anaplasma marginale with A. marginale We made the change in the manuscript. Reviewer #2 Line 52 – 54 Here, I would like that authors excluded "protection", because mentioned authors did not perform the challenge test. If possible, to replace the reference 12 by : Linkage between Anaplasma marginale Outer Membrane Proteins Enhances Immunogenicity but Is Not Required for Protection from Challenge. Clin Vaccine Immunol. 2013 May; 20(5): 651–656. Noh et al 2013 We replace the reference 12 and exclude the reference 11 because it has not challenge test. (line 55). Line 202-203 Noh et al 2013 (Linkage between Anaplasma marginale Outer Membrane Proteins Enhances Immunogenicity but Is Not Required for Protection from Challenge) it also describes about the challenge test of bovine (Holstein steers) and also can be used to discute the work. The challenge dose, the challenge via (subcutaneous or intravenous), the challenge method (infected blood or infected ticks) and the challenge time post-immunization are different in the bibliography. However, in all works A. marginale OM induced protection (Tebele et al 1991, Brown et al 1998, Ducken et al 2015, Albarrak et al 2012, Noh et al 2013). For this reason we decide not include the point in the discussion. Submitted filename: Response to Reviewers.docx Click here for additional data file. 4 Feb 2020 A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge PONE-D-19-26977R2 Dear Dr. Sarli, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Paulo Lee Ho, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 6 Feb 2020 PONE-D-19-26977R2 A vaccine using Anaplasma marginale subdominant type IV secretion system recombinant proteins was not protective against a virulent challenge Dear Dr. Sarli: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Paulo Lee Ho Academic Editor PLOS ONE
  43 in total

1.  Identification of novel antigenic proteins in a complex Anaplasma marginale outer membrane immunogen by mass spectrometry and genomic mapping.

Authors:  Job E Lopez; William F Siems; Guy H Palmer; Kelly A Brayton; Travis C McGuire; Junzo Norimine; Wendy C Brown
Journal:  Infect Immun       Date:  2005-12       Impact factor: 3.441

2.  Linkage between Anaplasma marginale outer membrane proteins enhances immunogenicity but is not required for protection from challenge.

Authors:  Susan M Noh; Joshua E Turse; Wendy C Brown; Junzo Norimine; Guy H Palmer
Journal:  Clin Vaccine Immunol       Date:  2013-02-27

3.  Babesia bovis biological clones and the inter-strain allelic diversity of the Bv80 gene support subpopulation selection as a mechanism involved in the attenuation of two virulent isolates.

Authors:  M E Baravalle; C Thompson; B Valentini; M Ferreira; S Torioni de Echaide; M Florín Christensen; I Echaide
Journal:  Vet Parasitol       Date:  2012-07-04       Impact factor: 2.738

4.  Frozen and fresh Anaplasma centrale vaccines in the protection of cattle against Anaplasma marginale infection.

Authors:  A A Abdala; E Pipano; D H Aguirre; A B Gaido; M A Zurbriggen; A J Mangold; A A Guglielmone
Journal:  Rev Elev Med Vet Pays Trop       Date:  1990

5.  Rapid and long-term disappearance of CD4+ T lymphocyte responses specific for Anaplasma marginale major surface protein-2 (MSP2) in MSP2 vaccinates following challenge with live A. marginale.

Authors:  Jeffrey R Abbott; Guy H Palmer; Kimberly A Kegerreis; Peter F Hetrick; Chris J Howard; Jayne C Hope; Wendy C Brown
Journal:  J Immunol       Date:  2005-06-01       Impact factor: 5.422

Review 6.  Antigens and alternatives for control of Anaplasma marginale infection in cattle.

Authors:  Katherine M Kocan; José de la Fuente; Alberto A Guglielmone; Roy D Meléndez
Journal:  Clin Microbiol Rev       Date:  2003-10       Impact factor: 26.132

7.  A protective cytotoxic T cell response to a subdominant epitope is influenced by the stability of the MHC class I/peptide complex and the overall spectrum of viral peptides generated within infected cells.

Authors:  A Gallimore; J Hombach; T Dumrese; H G Rammensee; R M Zinkernagel; H Hengartner
Journal:  Eur J Immunol       Date:  1998-10       Impact factor: 5.532

8.  CD4(+) T-lymphocyte and immunoglobulin G2 responses in calves immunized with Anaplasma marginale outer membranes and protected against homologous challenge.

Authors:  W C Brown; V Shkap; D Zhu; T C McGuire; W Tuo; T F McElwain; G H Palmer
Journal:  Infect Immun       Date:  1998-11       Impact factor: 3.441

9.  Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine.

Authors:  Eric L Sutten; Junzo Norimine; Paul A Beare; Robert A Heinzen; Job E Lopez; Kaitlyn Morse; Kelly A Brayton; Joseph J Gillespie; Wendy C Brown
Journal:  Infect Immun       Date:  2010-01-11       Impact factor: 3.441

10.  Subdominant antigens in bacterial vaccines: AM779 is subdominant in the Anaplasma marginale outer membrane vaccine but does not associate with protective immunity.

Authors:  Saleh M Albarrak; Wendy C Brown; Susan M Noh; Kathryn E Reif; Glen A Scoles; Joshua E Turse; Junzo Norimine; Massaro W Ueti; Guy H Palmer
Journal:  PLoS One       Date:  2012-09-28       Impact factor: 3.240

View more
  1 in total

Review 1.  Immune Response to Tick-Borne Hemoparasites: Host Adaptive Immune Response Mechanisms as Potential Targets for Therapies and Vaccines.

Authors:  Alessandra Torina; Valeria Blanda; Sara Villari; Antonio Piazza; Francesco La Russa; Francesca Grippi; Marco Pio La Manna; Diana Di Liberto; José de la Fuente; Guido Sireci
Journal:  Int J Mol Sci       Date:  2020-11-20       Impact factor: 5.923

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.