| Literature DB >> 32075754 |
Rowin Appanah1, Emma Claire Lones1, Umberto Aiello2, Domenico Libri2, Giacomo De Piccoli3.
Abstract
DNA replication and RNA transcription compete for the same substrate during S phase. Cells have evolved several mechanisms to minimize such conflicts. Here, we identify the mechanism by which the transcription termination helicase Sen1 associates with replisomes. We show that the N terminus of Sen1 is both sufficient and necessary for replisome association and that it binds to the replisome via the components Ctf4 and Mrc1. We generated a separation of function mutant, sen1-3, which abolishes replisome binding without affecting transcription termination. We observe that the sen1-3 mutants show increased genome instability and recombination levels. Moreover, sen1-3 is synthetically defective with mutations in genes involved in RNA metabolism and the S phase checkpoint. RNH1 overexpression suppresses defects in the former, but not the latter. These findings illustrate how Sen1 plays a key function at replication forks during DNA replication to promote fork progression and chromosome stability.Entities:
Keywords: Ctf4; DNA replication; DNA:RNA hybrids; Hpr1; Mrc1; RNA transcription; RNAse H; S phase checkpoint; Sen1; replisome
Year: 2020 PMID: 32075754 PMCID: PMC7034062 DOI: 10.1016/j.celrep.2020.01.087
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1Sen1 Interacts with the Replisome during S Phase through Its N-Terminal Domain
(A) SEN1 or SEN1-TAP cells were arrested in G1, harvested immediately, or released for either 30 min (S phase) or 60 min (G2 phase). Cell extracts and IP material were analyzed by immunoblotting (IB).
(B) Schematic of Sen1 constructs used.
(C) TAP-tagged fragments of Sen1, IPed from cells in S phase, were analyzed by IB.
(D) TAP-tagged fragments of Sen1 were analysed as above, except 4× cells were used for the IP of the fragments containing the last 330 C-terminal amino acids.
Figure 2Sen1 Binds the Replisome Components Ctf4 and Mrc1
(A) MS analysis of the proteins co-purifying with Sen1 (2–931) was conducted in S and G1 phases.
(B) IB analysis of the proteins IPed with Sen1 (2–931) and an empty control in strains carrying the PSF1 or psf1-1 allele. Cells were arrested in G1, shifted to 37°C for 1 h (G1), and then released into S phase for 20 min at 37°C (S).
(C) Sen1 (2–931) binding of GINS in G1 depends on Ctf4. IB analysis of the proteins IPed with Sen1 (2–931) and an empty control, with or without CTF4. Cells were arrested in G1 and released in S phase for 20 min at 30°C. Ctf4 and TAP-Sen1 (2–931) have similar sizes and run closely in gel electrophoresis.
(D) IB analysis of the proteins interacting with TAP-Sen1 (2–931) in the presence or absence of origin firing and CTF4. Cells were treated as described in Figure S2B. G1 samples were collected before galactose induction.
(E) Wild-type, mrc1Δ, or ctf4Δ cells expressing TAP-Sen1 (2–931) were arrested in G1. IB analysis of cell extracts and IPs is shown.
(F) Wild-type, ctf4Δ, mrc1Δ, and ctf4Δ mrc1-AID strains were arrested in G1, treated for 1 h with 0.5 mM auxin indole-3-acetic acid (IAA) final concentration, and released in S phase. IB analysis of cell extracts and IPs is shown.
(G) Quantification of the relative signal of Sen1-9MYC versus the TAP-Sld5 signal, normalized against the wild type.
(H) Experiments were conducted as in (F). Wild-type, ctf4Δ, and ctf4Δ mrc1-AID strains, carrying an untagged or a SEN1-TAP allele, were used. Asterisk indicates a non-specific band.
Figure 3Sen1-3 Does Not Interact with the Replisome
(A) Summary of the ability of N-terminal fragments of Sen1 to interact with the replisome.
(B) Cells carrying different GAL1-3HA-SEN1 fragments and a TAP-MCM3 allele were arrested in G1 and released into S phase. The samples were then used for IPs.
(C) Sen1 fragments were analysed as in (B).
(D) Cells carrying ACT1-3HA-SEN1 wild-type or mutated alleles at an ectopic locus were synchronously released into S phase. IB analysis of cell extracts and IPs is shown.
(E) Cells carrying a SEN1, SEN1-TAP, or sen1-3-TAP allele were arrested in G1 and released into S phase. IB analysis of cell extracts and IPs is shown.
(F) Fluorescence-activated cell sorting (FACS) samples for the experiment in (E).
Figure 4The sen1-3 Allele Is Proficient in RNAPII Termination but Is Essential in the Absence of RNase H Activity
(A) sen1-3 cells are proficient for transcription termination. qRT-PCR analysis of RNAs derived from the strains indicated is shown. The ratio of the readthrough fraction (position RT) over the total amount of SNR13 RNA is shown (triplicate biological repeats). n.s., not significant.
(B) Metagene analysis of RNAPII density detected by CRAC on CUTs. Average read counts are plotted on regions aligned to both the transcription start site (TSS) (left) and the transcript end site (TES) (right) of the CUTs (reads count in Table S1). The profiles of RNAPII density following Nrd1 depletion (nrd1-AID + auxin) are included for comparison (dataset from Candelli et al., 2018). nrd1-AID strain behaves as a hypomorphic allele.
(C) Examples of the meiotic progeny of the indicated diploids strains are shown.
(D) Serial dilution spotting of the indicated strains is shown. rnh1Δ rnh201Δ is abbreviated as rnhΔΔ.
(E) Serial dilution spotting of the indicated strains is shown. Cells (+RNH1) carry GAL-RNH1 inserted ectopically.
(F) The indicated strains, carrying a RAD52-GFP allele with or without the GAL-RNH1 construct, were grown as shown in Figures S4A–S4D. Samples were taken at the indicated time points, fixed, and analyzed for the presence of Rad52 foci (triplicate biological repeats). n.s., not significant; ∗∗p < 0.05; ∗∗∗p < 0.01.
(G) The indicated strains were grown to exponential phase at 28°C; DNA:RNA hybrids were analyzed by immunofluorescence of chromosome spreads (triplicate biological repeats). Samples were treated in parallel with RNase H.
Figure 5sen1-3 Presents Synthetic Defects with mrc1Δ, ctf18Δ, and rad53Δ, Leading to Increased Recombination and Mini-chromosome Loss
(A) Summary of the genetic interactions tested with the sen1-3 allele. Some double mutants (orange line) showed marked differences in temperature sensitivity and DNA damage sensitivity although others did not (green line).
(B) Examples of the defects observed with sen1-3. Serial dilution spotting of the indicated strains is shown. The double mutant rad53Δ sml1Δ is indicated as rad53Δ.
(C) The indicated strains were arrested in G1, shifted to 37°C for 1 h, and released in S phase at 37°C. FACS samples were taken at the indicated times. Red bar, length of DNA replication; green arrow, beginning of the end of mitosis.
(D) Cells, carrying a RAD52-GFP allele, were treated as in (C). Samples were taken at the indicated time points, fixed, and analyzed for the presence of Rad52 foci (triplicate biological repeats). ∗∗p < 0.05; ∗∗∗p < 0.01.
(E) Examples of the microscopy data of the experiment in (D). Scale bars represent 5 μm.
(F) Serial dilution spotting of the indicated strains is shown. Cells (+RNH1) carry an ectopic GAL1-RNH1 construct.
(G) RNH1 overexpression does not suppress the increase in recombination in mrc1Δ sen1-3 cells. Cell cultures were treated as in (C), except they were grown in YPGAL medium (triplicate biological repeats). ∗∗p < 0.05; ∗∗∗p < 0.01.
(H) The sen1-3 allele causes an increase in recombination. The cells were transformed with the plasmids pL or pLYΔNS. The ratio of the number of the colonies carrying a recombinant plasmid (LEU2) over the total number of cells carrying a plasmid (URA3) is shown.
(I) Cells were transformed with plasmids carrying an ADE2 marker and 1 or 2 origins. Percentage of white colonies over the total number of colonies scored is shown (a measure of genome stability; ∗∗∗p < 0.5 10−7).
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Anti-mouse-HRP | Cell Signaling Technology | #7076; RRID: |
| Anti-sheep-HRP | Sigma | A3415; RRID: |
| Anti-Cdc45 | Labib Lab | N/A |
| Anti-Csm3 | Labib Lab | N/A |
| Anti-Ctf4 | Labib Lab | N/A |
| Anti-Dpb2 | Labib Lab | N/A |
| Anti-FLAG | Sigma | F3165; RRID: |
| Anti-HA (12CA5) | Sigma | 11583816001; RRID: |
| Sheep IgG | Sigma | S1265; RRID: |
| Anti-Mcm3 | Labib Lab | N/A |
| Anti-Mcm4 | Labib Lab | N/A |
| Anti-Mcm5 | Labib Lab | N/A |
| Anti-Mcm6 | Labib Lab | N/A |
| Anti-Mrc1 | Labib Lab | N/A |
| Anti-MYC | Sigma | M4439; RRID: |
| Anti-Nrd1 | Libri Lab | N/A |
| Anti Nab3 | Libri Lab | N/A |
| Anti-Psf1 | Labib Lab | N/A |
| Anti-Pob3 | Labib Lab | N/A |
| Anti-Pol1 | Labib Lab | N/A |
| Anti-Pol2 | De Piccoli Lab | N/A |
| Anti-Rad53 | Abcam | ab166859; RRID: |
| Anti-Rpo21 | Novus Biologicals | NB200-598SS; RRID: |
| Anti-Sld5 | K. Labib | N/A |
| Anti-TAP-HRP | Sigma | P1291; RRID: |
| Anti DNA:RNA hybrids S9.6 | Kerafast | ENH001; RRID: |
| Cy3-conjucated anti-mouse | Jackson laboratories | #115165003; RRID: |
| Anti-dsDNA | Abcam | ab27156; RRID: |
| α-factor | Pepceuticals | N/A |
| AcTEV protease | Thermo-Fischer | 12575015 |
| Calmodulin | Sigma | A6112 |
| Complete protease inhibitor cocktail | Roche | 11 836 153 001 |
| Dithiothreitol | Sigma | D0632 |
| Dynabeads | Invitrogen | 14302D |
| Ethidium bromide | Sigma | E1510 |
| Hydroxyurea | Sigma | H8627 |
| Methyl methanesulfonate | Sigma | 129925 |
| Propidium iodide | Sigma | P4864 |
| Protease Inhibitor Cocktail | Sigma | P8215 |
| Sodium fluoride | Thermo-Fischer | S299500 |
| Zymolyase | Zymo research | #E1005 |
| RNase H | Invitrogen | #18021071 |
| Sodium glycerophosphate | Johnson Matthey | 170096 |
| Universal Nuclease | Pierce | 88700 |
| Amersham ECL Western Blotting Detection Reagent | GE Healthcare | RPN2108 |
| LightCycler® FastStart DNA Master SYBR Green I | Roche | 03003230001 |
| MLV-Reverse Transcriptase | Thermofischer | 28025013 |
| QuikChange Lightning Site-Directed Mutagenesis Kit | QIAGEN | #210519 |
| Rothstein’s lab | N/A | |
| Lab strain | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| Lab strain | N/A | |
| Lab strain | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| C | This study | N/A |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| Lab strain | N/A | |
| Lab strain | N/A | |
| This study | N/A | |
| This study | N/A | |
| This study | N/A | |
| DL377ATGTTCCCAGGTATTGCCGA | This study | N/A |
| DL378ACACTTGTGGTGAACGATAG | This study | N/A |
| DL474GCAAAGATCTGTATGAAAGG | This study | N/A |
| DL475CGCAGAGTTCTTACCAAACG | This study | N/A |
| DL481TAAATGGCCAACCGCTGTTG | This study | N/A |
| DL482CCAGCGTACTGCACGCCAGG | This study | N/A |
| DL1119AAGTGACGAAGTTCATGCTA | This study | N/A |
| DL1120TCCGTGTCTCTTGTCCTGCA | This study | N/A |
| pYM-N24 | Euroscarf | |
| pCS14pRS305- | This study | N/A |
| pCS25pRS305- | This study | N/A |
| pCS26pRS305- | This study | N/A |
| pCS30pRS305- | This study | N/A |
| pCS31pRS305- | This study | N/A |
| pCS32pRS305- | This study | N/A |
| pCS33pRS305- | This study | N/A |
| pCS39pRS305- | This study | N/A |
| pCS40pRS305- | This study | N/A |
| pCS42pRS305- | This study | N/A |
| pCS43pRS305- | This study | N/A |
| pCS59pRS305- | This study | N/A |
| pCS61pRS305- | This study | N/A |
| pCS118pRS305- | This study | N/A |
| pCS120pRS305- | This study | N/A |
| pCS123pRS305- | This study | N/A |
| pCS124pRS305- | This study | N/A |
| pCS125pRS305- | This study | N/A |
| pCS127pRS305- | This study | N/A |
| pCS128pRS305- | This study | N/A |
| pCS129pRS305- | This study | N/A |
| pCS188pRS305- | This study | N/A |
| pCS196pRS424- | From Palancade’s lab | N/A |
| pCS197pRS315- | This study | N/A |
| pCS198pRS315- | This study | N/A |
| pLpRS316 | From Aguilera’s lab | N/A |
| pLYΔNSpRS316 | From Aguilera’s lab | N/A |
| Excel | Microsoft | RRID: |
| Illustrator | Adobe | RRID: |
| ImageJ | NIH | |
| Photoshop | Adobe | RRID: |
| PredictProtein.org | ||
| RStudio | RStudio | RRID: |