Sadequllah Ahmadi1,2, Misa Takeda1, Takeshi Ohkubo1. 1. College of Agriculture, Ibaraki University, 3-21-1 Chuo, Ami, Ibaraki 300-0393, Japan. 2. Faculty of Animal Science, Afghanistan National Agricultural Sciences and Technology University (ANASTU), Kandahar, Afghanistan.
Abstract
We investigated means to improve the production of the indigenous Naked Neck chicken in Afghanistan. Specifically, we analyzed single nucleotide polymorphisms (SNPs) in the prolactin (PRL) (24 bp indel), growth hormone (GH) (T185G), and pituitary specific transcript factor 1 (PIT-1) (intron 5) genes. Blood samples were collected from 52 birds and genomic DNA was extracted. Polymorphisms in the mentioned loci were analyzed by PCR, allele-specific PCR, and PCR-restriction fragment length polymorphism (RFLP) using TaqI and MspI endonucleases. Cloning followed by DNA sequencing was performed to ascertain the accuracy of the PCR-RFLP analysis for PIT-1.Two alleles were found for the PRL 24 bp indel, GH (T185G), and PIT-1/TaqI, with the following respective allelic frequencies: PRL-In 0.64 and PRL-Del 0.36, GH-T 0.91 and GH-G 0.09, and PIT-1-A 0.64 and PIT-1-B 0.36. Regarding the PIT-1/MspI polymorphism, three novel MspI recognition sites, as well as two reported MspI recognition sites, were detected in intron 5. Moreover, during sequence screening, two novel SNPs were found that generated restriction sites for MseI. Therefore, our results suggest that the PRL indel, GH T185G, and PIT-1/TaqI polymorphisms may be used as selection markers for Afghanistan Naked Neck chickens. Intron 5 of PIT-1 in the Afghani Naked Neck chicken was highly polymorphic compared to the reported Gallus gallus PIT-1 gene (GenBank accession no. NC_006088.4). 2019, Japan Poultry Science Association.
We investigated means to improve the production of the indigenous Naked Neck chicken in Afghanistan. Specifically, we analyzed single nucleotide polymorphisms (SNPs) in the prolactin (PRL) (24 bp indel), growth hormone (GH) (T185G), and pituitary specific transcript factor 1 (PIT-1) (intron 5) genes. Blood samples were collected from 52 birds and genomic DNA was extracted. Polymorphisms in the mentioned loci were analyzed by PCR, allele-specific PCR, and PCR-restriction fragment length polymorphism (RFLP) using TaqI and MspI endonucleases. Cloning followed by DNA sequencing was performed to ascertain the accuracy of the PCR-RFLP analysis for PIT-1.Two alleles were found for the PRL24 bp indel, GH (T185G), and PIT-1/TaqI, with the following respective allelic frequencies: PRL-In 0.64 and PRL-Del 0.36, GH-T 0.91 and GH-G 0.09, and PIT-1-A 0.64 and PIT-1-B 0.36. Regarding the PIT-1/MspI polymorphism, three novel MspI recognition sites, as well as two reported MspI recognition sites, were detected in intron 5. Moreover, during sequence screening, two novel SNPs were found that generated restriction sites for MseI. Therefore, our results suggest that the PRL indel, GHT185G, and PIT-1/TaqI polymorphisms may be used as selection markers for Afghanistan Naked Neck chickens. Intron 5 of PIT-1 in the Afghani Naked Neck chicken was highly polymorphic compared to the reported Gallus gallusPIT-1 gene (GenBank accession no. NC_006088.4). 2019, Japan Poultry Science Association.
The Naked Neck chicken breed is widespread and indigenous to numerous African and Asian countries (DAD-IS and FAO, 2012). This breed is native to Afghanistan and is well known for its egg production and resilience to disease and hot climates. An autosomal dominant gene (Na) controls the bared neck trait, which results in heat reduction and improvement in thermoregulation. The Na gene is known to be associated with heat tolerance and Na/na birds are superior in carcass yield, laying rate, mean egg weight, eggshell strength, and egg mass (Merat, 1990; Njenga, 2005). Furthermore, in high ambient temperatures and unfavorable environments, the dominant Na allele positively affects breast weight and growth rate, resulting in minimal loss of body weight during heat stress, high levels of heat shock protein 70 (HSP70), good feed conversion ratio, desirable carcass traits, and reduced effects of high ambient temperatures on fertility (Njenga, 2005; Islam and Nishibori, 2009). Thus, the Naked Neck chicken is a valuable breed for hot climates, including Afghanistan, and its characteristics can be further genetically investigated to enhance traits. Molecular markers are useful tools for improving production traits in farm animals and, to increase selection efficiency, marker-assisted selection linked to quantitative trait loci allows for the direct selection of genotypes in a population (Lamont ).The body weight and reproductive performance of vertebrates are regulated by the coordinated action of multiple factors (Sharma ), including pituitary specific transcription factor 1 (PIT-1) that regulates vertebrate pituitary development, pituitary cell proliferation, and hormone expression. Moreover, PIT-1 also regulates the mRNA expression of growth hormone (GH), prolactin (PRL), and thyroid-stimulating hormone beta subunit (TSHB) in the pituitary gland (Bodner ; Castrillo ; Cohen ). In the pituitary gland of post-hatched chicks, mRNA expression of PIT-1 was shown to correlate with GH and PRL expression (Tanaka ). Additionally, PIT-1 reportedly transactivates the chicken GHand PRL promoters in vitro (Ohkubo ; Ip ), thus influencing growth and development. Consequently, mutations in PIT-1 may result in altered expression levels of PRL, GH, TSHB, and PIT-1 itself (Li ; Cohen ).Polymorphisms in PRL, GH, and PIT-1 have been widely studied in domestic chickens with regard to reproduction, growth, and metabolism. For example, a 24 bp insertion and deletion in the promoter region of chickenPRL significantly affected egg production and occurrence of broodiness (Cui ). Single nucleotide polymorphisms (SNPs) in this gene have also been associated with egg production in chickens (Kulibaba and Podstreshnyi, 2012; Li ). Researchers have confirmed that chickenGH (cGH) has essential roles in growth, reproduction, body composition, aging, and egg production, and SNPs in cGH are associated with egg production and disease resistance (Kuhnlein ), as well as growth and carcass traits (Yan ; Wei ). It was recently reported that the T185G substitution in cGH is significantly linked with growth and egg production (Su ). Seventeen synonymous SNPs have been identified in chickenPIT-1, two of which were significantly associated with partial carcass traits (Xu ). Restriction fragment length polymorphism (RFLP) analysis for TaqI and MspI in intron 5 of chickenPIT-1 in a cross of White Recessive Rock with Chinese Xinghua chickens (Nie , 2008) revealed an association with growth performance. Since the phenotypic and genotypic characteristics of any domestic bird, including the Naked Neck chicken, have not yet been characterized in Afghanistan, the present study aimed to determine whether economically valuable polymorphisms found in the PRL, GH, and PIT-1 genes of other chicken breeds are retained in Naked Neck chickens to address the possibility of using these polymorphisms to improve the traits of this breed.
Materials and Methods
Animals and DNA Extraction
Blood samples were collected from 52 Afghani Naked Neck chickens, comprising 25 females and 27 males reared in Kandahar, Afghanistan, and placed on FTA™ ELUTE Micro Cards (GE Healthcare, Buckinghamshire, UK). Genomic DNA was extracted from the FTA™ ELUTE Micro Cards according to the manufacturer's protocol, and DNA concentrations were measured using a BioSpec-Nano (Shimadzu, Kyoto, Japan).
PCR Detection of a PRL Polymorphism
A set of primers was designed for the PRL24 bp indel (insertion/deletion) as previously reported by Cui (Table 1) and used to amplify either a 130 bp or a 154 bp fragment containing the 24 bp indel in the chickenPRL promoter. Each PCR reaction (20 µL) contained 10 µL of 2 × Green Master Mix (Promega, WI, USA), 1 µL of each forward and reverse primer (10 pmol/µL), 40–70 ng of genomic DNA as a template. PCR amplification was carried out for 35 cycles with an initial denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension for 5 min at 72°C. Finally, the PCR products were electrophoresed on 3% agarose gels and stained with ethidium bromide to visualize the DNA under UV light.
Table 1.
Primers used in the analysis for PRL, GH and Pit-1
Primer Name
Primer sequence (5′ to 3′)
Reference
PRL 24bp Indel F
TTTAATATTGGTGGGTGAAGAGACA
Cui et al., 2006
PRL 24bp Indel R
ATGCCACTGATCCTCGAAAACT
cPIT-1F
GGACCCTCTCTAACAGCTCTC
Nie et al., 2008
cPIT-1R
GGGAAGAATACAGGGAAAGG
cGH_T185
GGTGGATTTTCTACCTGCGT
cGH_G185
GGTGGATTTTCTACCTGCGG
cGH_Common
AATGCAGATGTGTTCGCCAT
cPIT-1/SEQ1
TCTCTAACAGCTCTCTGTCT
cPIT-1/SEQ2
ATACAGGGAAAGGCCGCAGA
Allele-specific PCR Determination of a GH Polymorphism
Allele-specific PCR was used to detect the T185G polymorphism in the 5′ non-coding region of the chickenGH gene using a primer set (cGH_Common, cGH_T185, and cGH_G185) listed in Table 1. The PCR was performed in 20 µL reactions consisting of genomic DNA (40–70 ng), 10 pmol cGH_Common, 10 pmol cGH_T185 or cGH_G185, and 2 × Green Master Mix (Promega). Amplification was performed for 35 cycles with an initial denaturation at 94°C for 5 min, then denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, with a final extension of 5 min at 72°C. Finally, the PCR products were electrophoresed on 2% agarose gels that were stained with ethidium bromide to visualize the DNA.
PCR-RFLP Analysis of PIT-1
The polymorphic intron 5 of the chickenPIT-1 gene was amplified by PCR in 20 µL reactions consisting of genomic DNA (40–70 ng); reverse and forward primers (10 pmol each of Pit-1R and cPit-1F; Table 1), dNTPs (5 nmol each), and TaKaRa Ex Taq DNA polymerase (1 unit; TaKaRa Bio, Shiga, Japan). Amplification was carried out for 30 cycles with an initial denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 45 s, and extension at 72°C for 1 min, with a final extension of 5 min at 72°C. Thereafter, 3 µL of each PCR product was separately digested with TaqI (New England Biolabs, Ipswich, MA, USA) and MspI (TaKaRa Bio) incubated at 65°C or 37°C, respectively for 4 to 8 h, and then electrophoresed on a 2% agarose gel stained with ethidium bromide to visualize the DNA.
Sequencing of PIT-1 Intron 5
After PCR-RFLP, amplified DNA that showed diverse digestion patterns for PIT-1/MspI was selected for direct sequencing. The PCR products separated on 2% agarose gels were purified using the MonoFas DNA purification kit 1 (GL Sciences Inc., Tokyo, Japan). Purified DNA (200 ng) served as sequencing template using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) with each strand primer (cPIT-1/SEQ1 and cPIT-1/SEQ2; Table 1), according to the manufacturer's instructions. The products were sequenced using the ABI 3130 Sequencer (Applied Biosystems).To confirm the accuracy of the PCR-RFLP analysis and the results of direct sequencing, amplified DNA was subcloned into the pGEM-T Easy vector (Promega) followed by RFLP analysis for MspI. Cloned DNA was also sequenced in both directions, using the ABI 3130 Sequencer (Applied Biosystems).
Genotyping and Statistical Analysis
Based on the genotypes visualized on agarose gels, allelic frequencies were calculated via the maximum likelihood formula (Kulibaba and Podstreshnyi, 2012):where, P and P are the frequencies of the existing alleles, n and n are the numbers of homozygous birds, n is the number of heterozygous birds, and 2N is the number of alleles (twice the number of individuals in the study group). Moreover, the Chi-square test , where O is the observed value and E is the expected value) was used to confirm whether this population was in Hardy-Weinberg equilibrium.
Results
Frequency of the PRL 24 bp Indel Polymorphism in the Afghani Naked Neck Chicken
For the PRL24 bp indel, two alleles, In and Del, were distinguishable with three genotypes, In/In, In/Del, and Del/Del (Fig. 1). The gene frequencies for In and Del were 0.64 and 0.36, respectively, and the genotypic frequencies for In/In, In/Del, and Del/Del were 0.40, 0.48, and 0.12, respectively (Table 2). The χ2 test indicated that the genotypic distribution for the indel polymorphism was not in Hardy–Weinberg equilibrium.
Fig. 1.
Determination of the The 154 bp band represents individuals with the In/In genotype (lanes 1, 2, and 5), 154 and 130 bp bands represent individuals with the In/Del genotype (lane 4), and the 130 bp band represents individuals with the Del/Del genotype (lane 3). M shows the molecular weight marker (100 bp ladder).
Table 2.
The genotype and genetic frequency of PRL 24 bp indel, GH T185G and Pit-1/Taq1 in Afghani Naked Neck chicken population
Population
Polymorphism
Genotypic frequency
Genetic frequency
Locus equilibrium χ2 test
Naked Neck (n=52)
PRL
In/In (n)
In/Del (n)
Del/Del (n)
In
Del
P <0.05
24 bp indel
0.40 (21)
0.48 (25)
0.12 (6)
0.64
0.36
GH T185G
TT (n)
TG (n)
GG (n)
T
G
0.83 (43)
0.17 (9)
0.0 (0)
0.91
0.09
PIT-1/Taq I
AA (n)
AB (n)
BB (n)
A
B
0.38 (20)
0.52 (27)
0.10 (5)
0.64
0.36
Determination of the The 154 bp band represents individuals with the In/In genotype (lanes 1, 2, and 5), 154 and 130 bp bands represent individuals with the In/Del genotype (lane 4), and the 130 bp band represents individuals with the Del/Del genotype (lane 3). M shows the molecular weight marker (100 bp ladder).
Frequency of the GH T185G Polymorphism in the Afghani Naked Neck Chicken
For the GHT185G polymorphism, two alleles, T and G, were recognized via allele-specific PCR, in which two genotypes, TT and TG, were detected (Fig. 2). The genotypic frequencies of T and G alleles were 0.91 and 0.09, respectively (Table 2). The GG genotype was absent in this population (Table 2). The χ2 test indicated that the genotypic distribution of GHT185G was not in Hardy-Weinberg equilibrium.
Fig. 2.
Representative profile of the M shows the molecular weight marker (100 bp ladder).
Representative profile of the M shows the molecular weight marker (100 bp ladder).For the PIT-1/TaqI polymorphism, two alleles (A and B) with three genotypes (AA, AB, and BB) were clearly distinguished (Fig. 3). The fragment size generated for allele A was 599 bp without the TaqI restriction site, while for allele B, containing the PIT-1/TaqI restriction site, digestion yielded fragment sizes of 456 and 143 bp. The frequencies of the A and B alleles were 0.64 and 0.36, respectively, and the genotypic frequencies of AA, AB, and BB were 0.38, 0.52, and 0.10, respectively (Table 2). Based on the χ2 test, this population was not in Hardy-Weinberg equilibrium. Notably, the allelic frequency for allele A (0.64) was significantly higher than for allele B (0.36) (Fig. 3; Table 2).
Fig. 3.
The electrophoretic profile of Lanes 1 and 4 are heterozygous (AB) genotypes, lanes 2 and 3 are homozygous (BB) genotypes, and lanes 5 and 6 are homozygous (AA) genotypes. M shows the molecular weight marker (100 bp ladder).
The electrophoretic profile of Lanes 1 and 4 are heterozygous (AB) genotypes, lanes 2 and 3 are homozygous (BB) genotypes, and lanes 5 and 6 are homozygous (AA) genotypes. M shows the molecular weight marker (100 bp ladder).Figure 4a shows the PCR-RFLP analysis for PIT-1/MspI digestion. Although MspI did not digest some samples completely (i.e., lanes 3, 4, and 6), multiple digestion patterns were observed in the PCR-RFLP analysis for MspI. Two MspI sites were found in intron 5 of the PIT-1 gene in the Iranian commercial broiler line (Rodbari ), generating 599 bp (A allele), 500 bp, and 99 bp (B allele); and 321 bp and 278 bp (C allele) DNA fragments. Naked Neck chickens carrying the B allele (lane 2; BB homozygote) and C allele (lane 1; CC homozygote) were identified, but AA homozygotes were absent in the population. However, unexpected PCR-RFLP patterns from a previous study were observed (lanes 3 to 9); one pattern was speculated to represent a homozygote of unknown genotype (lane 8) and heterozygotes of an unknown allele and the B allele (lanes 5 and 7) or and the C allele (lane 9). Therefore, direct sequencing was performed to validate the accuracy of our observed PCR-RFLP results.
Fig. 4.
RFLP analysis of (a) Photograph of the digest patterns of PCR-RFLP for MspI in PIT-1 intron 5. Lanes 1 and 2 represent the expected digestion pattern from a previous report (Rodbari ). Lane 8 represents a homozygous genotype (DD) newly identified in the Afghanistan Naked Neck breed. Lanes 3, 4, and 6 are the unclear genotypes. M shows a 100 bp ladder marker. (b) Sequence of the polymorphic site of a novel D allele in which panel (1) shows the MspI recognition site at nucleotide position 280 and panel (2) shows the MspI recognition site at nucleotide position 500. Therefore, the gel shows that novel patterns (320, 280, and 99 bp) were generated.
RFLP analysis of (a) Photograph of the digest patterns of PCR-RFLP for MspI in PIT-1 intron 5. Lanes 1 and 2 represent the expected digestion pattern from a previous report (Rodbari ). Lane 8 represents a homozygous genotype (DD) newly identified in the Afghanistan Naked Neck breed. Lanes 3, 4, and 6 are the unclear genotypes. M shows a 100 bp ladder marker. (b) Sequence of the polymorphic site of a novel D allele in which panel (1) shows the MspI recognition site at nucleotide position 280 and panel (2) shows the MspI recognition site at nucleotide position 500. Therefore, the gel shows that novel patterns (320, 280, and 99 bp) were generated.
Sequencing of the PIT-1 Polymorphic Region
The DD homozygote was confirmed by direct sequencing (lane 8 in Fig. 4a). The sequencing results revealed an A-to-G transition at position 280 of the amplified DNA fragment, creating a new MspI recognition site (Fig. 4b). Therefore, cloning and sequencing were performed for the unexpected digestion patterns observed by PCR-RFLP (Fig. 4a; lanes 3, 4, and 6). As a result, the observed individuals possessed two new point mutations, A-to-G and T-to-C transitions, which generated two new MspI restriction sites at nucleotide positions 500 and 519, respectively. We named this allele E (Fig. 5a, lane 1 and Fig. 5b, panel 2). Three point mutations were detected for one individual (Fig. 4a, lane 6), in which T-to-C, A-to-G, and T-to-C transitions generated three MspI recognition sites at nucleotide positions 280, 500, and 519, respectively. This allele was called F (Fig. 5a, lane 4 and Fig. 5b, panel 3).
Fig. 5.
RFLP analysis and sequencing result for (a) Lanes 1, 2 (cloned sample of lane 3 from Fig. 1a), 3, and 4 (cloned sample of lane 6 from Fig. 1a) represent alleles E, B, B, and F, respectively, in PIT-1 intron 5. The 19 bp fragment could not be visualized in this gel. M shows the molecular weight marker (100 bp ladder). (b) Panels (2) (named allele E) and (3) (named allele F) are the Naked Neck cloned sequences (of lane 3 or 4 and lane 6, respectively, from Fig. 1a) and panel (1) is the original sequence released by Gen-Bank.
RFLP analysis and sequencing result for (a) Lanes 1, 2 (cloned sample of lane 3 from Fig. 1a), 3, and 4 (cloned sample of lane 6 from Fig. 1a) represent alleles E, B, B, and F, respectively, in PIT-1 intron 5. The 19 bp fragment could not be visualized in this gel. M shows the molecular weight marker (100 bp ladder). (b) Panels (2) (named allele E) and (3) (named allele F) are the Naked Neck cloned sequences (of lane 3 or 4 and lane 6, respectively, from Fig. 1a) and panel (1) is the original sequence released by Gen-Bank.Moreover, while screening the PIT-1 intron 5 sequence, we also found a double point mutation resulting in a CG-to-TA transition and a single point mutation resulting in an A-to-T transversion compared to the reported Gallus gallusPIT-1 sequence (GenBank accession no. NC_006088.4). These mutations generated new MseI restriction sites (Fig. 6).
Fig. 6.
Novel restriction sites for the Arrowhead indicates the SNPs in intron 5 of PIT-1 of the Naked Neck chicken. The upper sequence shows the original sequence reported by GenBank that contains only one MseI restriction site (GenBank accession no. NC_006088.4). The middle and lower sequences exhibit more than one MseI recognition site.
Novel restriction sites for the Arrowhead indicates the SNPs in intron 5 of PIT-1 of the Naked Neck chicken. The upper sequence shows the original sequence reported by GenBank that contains only one MseI restriction site (GenBank accession no. NC_006088.4). The middle and lower sequences exhibit more than one MseI recognition site.
Discussion
Even in environments that are poor and unfavorable for animal production, the Naked Neck chicken breed in Afghanistan still provides high-quality protein in the form of meat and eggs to the rural population, which comprises 75% of the total population of Afghanistan. The resilience of the Naked Neck chicken breed in high ambient temperatures promotes productivity (Islam and Nishibori, 2009). Genetic selection, in addition to livestock management such as feeding and veterinary care, plays an important role in further improving the productivity of local breeds (Padhi, 2016). In the present study, PCR, allele-specific PCR and PCR-RFLP were used to scrutinize known mutations in somatotropic axis-related genes (PRL, GH, and PIT-1) that are significantly associated with growth and reproduction in diverse chicken breeds (Cui ; Nie ; Su ), to determine the utility of adapting these polymorphisms to enhance the productive performance of the Naked Neck chicken in Afghanistan. Among these genes, PIT-1 regulates not only its own transcription but also that of PRL, GH and TSHB. In the pituitary gland, PIT-1 mRNA has been detected in somatotropic, thyrotrophic, and lactotrophic cells (Simmons ).The PRL gene is known to be responsible for egg production and broodiness in chickens (Shimada ). Polymorphisms in PRL were significantly correlated with egg production in the Muscovy duck (Zhang ) and egg quality and number in chickens (Cui ; Bhattacharya ). Moreover, the indel polymorphism of PRL is also associated with egg laying and broodiness (Cui ; Bagheri ). The In allele has significant effects on egg production and the frequency of the In allele was higher (0.98) than that of the Del allele (0.02) in the White Leghorn chicken that produces more than 300 eggs in a year. The In and Del frequencies in Taihe chickens were 0.14 and 0.86, respectively, and this breed shows strong incubation behavior and reduced egg production (Cui ). This group further concluded that the Del allele might also be associated with broodiness, which results in the loss of egg production (Cui ). In this study, we found that the allelic frequency of In was higher than that of Del in Naked Neck chickens. This result may indicate that the PRL genetic background is a limiting factor for productivity in Naked Neck chickens in Afghanistan.Schematic representation of Each box shows a different allele (A, B, C, D*, E*, and F*); the solid horizontal line in parentheses represents the 599 bp sequence of PIT-1 intron 5 in which / is the recognition site for MspI created by a point mutation. The double line between the solid circles represents the agarose gel fragment sizes visualized after digestion with MspI in agarose gel. Asterisk (*) indicates a new allele.Regarding the T185G polymorphism in GH, the genotypic frequency was significantly biased; TT and GT genotypes were found, but the GG genotype was not detected in the studied population (Table 2). The T185G polymorphism is known to be associated with increased total egg number in 300-day-old birds (EN 300), as well as egg and body weight in Recessive White chickens (RW) and Qingyuan partridges (QY). Birds possessing the TT and GT genotypes in QY and RW strains showed good performance in EN 300 (Su ). Our results suggest that the T185G polymorphism in the GH gene has been almost fixed to T and further consideration of this SNP may not be relevant.Polymorphism in intron 5 of the PIT-1 gene is also associated with productivity in highly selected exotic chicken breeds (Xu ). In this study, PCR-RFLP and sequence analyses were carried out on the 599 bp fragment of intron 5 in the Naked Neck chicken. The results for the PIT-1/TaqI mutation were in accordance with both Nie and Rodbari . However, the frequency of the B allele was significantly lower (36%) than that of the A allele (64%) in the Naked Neck chicken, which is an economically important locus for early growth rates in chickens. In the studied population, five novel polymorphisms were identified that generated three novel restriction sites for MspI and two for MseI. Only one restriction site for MspI was found in the originally reported sequence of the chickenPIT-1 gene and one recognition site for MseI (Nie ). In the same region, Rodbari found an extra allele, named C, in an Iranian line of broiler chicken by PCR-RFLP for MspI. It was previously shown that the PIT-1/MspI locus (BB genotype) had a positive correlation with average daily gain at 4–8 weeks of age in chickens (P<0.05). According to the different band patterns in the PCR-RFLP analysis, two alleles (A and B) with three genotypes (AA, AB, and BB) were identified for the PIT-1/MspI locus in Chinese broiler chickens (Nie ). Remarkably, in Naked Neck chickens, the A allele for PIT-1/MspI was absent; this allele had previously been shown to have negative impacts on the early growth rate in Chinese native chickens and Iranian broiler chickens (Nie ; Rodbari ). In addition, the C allele found in Iranian broiler chickens was significantly associated with early growth rate (Rodbari ). The absence of the A allele and presence of the C and D alleles in the Naked Neck chicken population were valuable observations noted in this study (Fig. 1a, lane 2). Importantly, the DD genotype found in the Naked Neck chicken comprised two different growth-associated alleles (B and C) that might influence the early growth rate of this breed (Fig. 4d). Additional research is needed to confirm this result. None of these SNPs have been associated with fat deposition and carcass traits in chickens (Nie ).The sequencing results after cloning and PCR-RFLP analysis revealed three novel SNPs that generated MspI recognition sites in intron 5 of Naked Neck chickenPIT-1 (Figs. 1b and 2), named alleles D, E, and F (Fig. 4). The mutations in the E and F alleles resulted in different fragment sizes after digestion with MspI (500 bp + 19 bp + 80 bp and 280 bp + 220 bp + 19 bp + 80 bp, respectively (Fig. 2a). It was difficult to determine the allelic frequency for the PIT-1/MspI locus of intron 5 in our studied population, as also demonstrated in other breeds (Nie ; Rodbari ). Two novel MspI sites were found in intron 5 of Naked Neck chickenPIT-1 that have yet to be reported in other chicken breeds and their association with productive traits have yet to be identified. Our results support the idea that nucleotide diversity in native chickens is greater than in commercial breeds (Nie ).In conclusion, the PRL24 bp indel, GHT185G, and PIT-1/TaqI polymorphisms are fixed in Afghani Naked Neck chickens and may be viable selection markers to improve the breed. In addition, the 599 bp fragment from intron 5 of the PIT-1 gene in the Naked Neck chicken was highly polymorphic, and five novel SNPs were found in the population, generating three novel restriction sites for MspI and two for MseI. Further investigation is required to characterize these SNPs that may improve the productivity of this breed and thus enhance the economic value of the Naked Neck chicken in Afghanistan.
Authors: S J Lamont; N Lakshmanan; Y Plotsky; M G Kaiser; M Kuhn; J A Arthur; N J Beck; N P O'Sullivan Journal: Anim Genet Date: 1996-02 Impact factor: 3.169