| Literature DB >> 32050528 |
Dinh Thi Lam1,2, Katsuyuki Ichitani3, Robert J Henry4, Ryuji Ishikawa5.
Abstract
Two types of perennial wild rice, Australian Oryza rufipogon and a new taxon Jpn2 have been observed in Australia in addition to the annual species Oryza meridionalis. Jpn2 is distinct owing to its larger spikelet size but shares O. meridionalis-like morphological features including a high density of bristle cells on the awn surface. All the morphological traits resemble O. meridionalis except for the larger spikelet size. Because Jpn2 has distinct cytoplasmic genomes, including the chloroplast (cp), cp insertion/deletion/simple sequence repeats were designed to establish marker systems to distinguish wild rice in Australia in different natural populations. It was shown that the new taxon is distinct from Asian O. rufipogon but instead resembles O. meridionalis. In addition, higher diversity was detected in north-eastern Australia. Reproductive barriers among species and Jpn2 tested by cross-hybridization suggested a unique biological relationship of Jpn2 with other species. Insertions of retrotransposable elements in the Jpn2 genome were extracted from raw reads generated using next-generation sequencing. Jpn2 tended to share insertions with other O. meridionalis accessions and with Australian O. rufipogon accessions in particular cases, but not Asian O. rufipogon except for two insertions. One insertion was restricted to Jpn2 in Australia and shared with some O. rufipogon in Thailand.Entities:
Keywords: Australian continent; Oryza; divergence; life history; phylogenetic relation; speciation
Year: 2020 PMID: 32050528 PMCID: PMC7076673 DOI: 10.3390/plants9020224
Source DB: PubMed Journal: Plants (Basel) ISSN: 2223-7747
Samples collected in Australia and control core collections developed in NBRP.
| No. of | GPS Data | ||||
|---|---|---|---|---|---|
| Sites | Populations | Plants | S | E | Year |
| P26 | P26a | 8 | S16.5332 | E145.2138 | 2011 |
| P26b | 8 | S16.5529 | E145.2136 | 2011 | |
| P26c | 8 | S16.5541 | E145.2130 | 2011 | |
| P26d | 8 | S16.5539 | E145.2128 | 2011 | |
| P26e | 8 | S16.5536 | E145.2125 | 2011 | |
| P26f | 8 | S16.5536 | E145.2124 | 2011 | |
| P26g | 8 | S16.5535 | E145.2123 | 2011 | |
| P26h | 8 | S16.5534 | E145.2122 | 2011 | |
| P26i | 8 | S16.5533 | E145.2122 | 2011 | |
| Jpn1 | Jpn1 | 8 | S16.3809 | E145.1936 | 2011 |
| Jpn2 | Jpn2 | 8 | S15.2622 | E144.1239 | 2011 |
| Jpn3 | Jpn3 | 8 | S15.0431 | E143.4321 | 2011 |
| P6 | P6 | 8 | S15 41519 | E145 02473 | 2011 |
| P7 | P7E | 8 | S15 42003 | E145 04219 | 2011 |
| P7L | 8 | S15 42003 | E145 04219 | 2011 | |
| P8 | P8W | 4 | S15 41302 | E145 07237 | 2011 |
| P8R | 4 | S15 41302 | E145 07237 | 2011 | |
| P10 | P10H | 8 | S15.41416 | E145.09040 | 2011 |
| P10L | 8 | S15.41416 | E145.09040 | 2011 | |
| P12 | P12 | 8 | S15.31486 | E144.22564 | 2011 |
| P17 | P17 | 8 | S15.09256 | E143.49481 | 2011 |
| P21 | P21 | 8 | S15.23047 | E144.07228 | 2011 |
| P22 | P22 | 8 | S15.78099 | E144.14333 | 2011 |
| P23 | P23 | 8 | S15.31198 | E144.22079 | 2011 |
| P26j | P26j | 8 | S16.55118 | E145.2136 | 2011 |
| P26PL | P26PL | 8 | S16.15579 | E145.2060 | 2011 |
| P27 | P27 | ||||
| P5 | P5O | 8 | S15 45329 | E144 59419 | 2010 |
| P5N | 8 | S15 45329 | E144 59419 | 2010 | |
| P5W | 8 | S15 45329 | E144 59419 | 2010 | |
| Core collection of NBRP | |||||
|
| 19* | ||||
|
| 32 | ||||
*W1299 noted as no rank in Oryza database, was added to the core collection in this study.
Figure 1Variation in the density of bristle cells in awns. Panel A: spikelet of Jpn1, Panels B to E: enlarged SEM photos of W0120 (Panel B), Jpn1 (Panel C), W1299 (Panel D), Jpn2 (Panel E). Panel F: density of bristle cells per 200 μm2. Bars indicating standard error (n = 3).
Comparison of morphological traits, anther length, pancle length, paniclewidth, and density of bristle cells.
| Anther Length (mm) | Spikelet Length (mm) | Spikelet Width (mm) | Density of Bristle Cells (per 200 μm2) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Species | Accession | Life History | n= | mean | ± | SD | mean | ± | SD | mean | ± | SD | mean | ± | SD | ||||
|
| |||||||||||||||||||
| W0106 | Annual | 5 | 1.50 | ± | 0.07 | ** | 7.01 | ± | 0.63 | ** | 2.42 | ± | 0.20 | 4.67 | ± | 1.92 | ** | ||
| W0120 | Perennial | 5 | 1.88 | ± | 0.10 | ** | 7.06 | ± | 0.16 | ** | 2.34 | ± | 0.11 | 2.67 | ± | 1.92 | ** | ||
| W0137 | Perennial | 5 | 2.31 | ± | 0.05 | ** | 6.95 | ± | 0.25 | ** | 2.60 | ± | 0.11 | 3.67 | ± | 1.92 | ** | ||
|
| |||||||||||||||||||
| W1299 | Annual | 5 | 1.42 | ± | 0.05 | ** | 6.47 | ± | 0.27 | ** | 2.32 | ± | 0.12 | 12.67 | ± | 3.42 | |||
| W1300 | Annual | 5 | ND | 6.91 | ± | 0.19 | ** | 2.13 | ± | 0.05 | ** | 14.67 | ± | 1.60 | |||||
| Australian wild rice | |||||||||||||||||||
| Greenhouse | |||||||||||||||||||
| Jpn1 | Perennial | 5 | 3.48 | ± | 0.20 | 7.13 | ± | 0.15 | ** | 2.02 | ± | 0.16 | ** | 2.67 | ± | 3.42 | ** | ||
| Jpn2 | Perennial | 5 | 1.64 | ± | 0.07 | ** | 8.28 | ± | 0.14 | * | 2.62 | ± | 0.11 | 12.00 | ± | 2.34 | |||
| Field | |||||||||||||||||||
| Jpn1 | Perennial | 5 | 3.79 | ± | 0.20 | 7.62 | ± | 0.17 | ** | 2.00 | ± | 0.07 | ** | ND | |||||
| Jpn2 | Perennial | 5 | 1.74 | ± | 0.19 | ** | 8.60 | ± | 0.23 | 2.40 | ± | 0.23 | ND | ||||||
*,**: Significant differences compared with the longest anther of Jpn1, the largest panicle of Jpn2, the widest width of W0137, and density of bristle cells of W1300 at 5 and 1% levels, respectively.
INDEL and SSR markers in chloroplast genomes and developed markers.
| Genotype (Based on Relative Migration Distance) | INDEL Start Position in Nipponbare cp Genome | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Marker Type | Nipponbare | W0106 | W0120 | W0137 | W1299 | W1300 | Jpn1 | Jpn2 | INDEL | Forward | Reverse | |
| INDEL1 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 2 | -C | 1605 | CTATTCCGAAGAGGAAGTCTAC | TCTCCGTATCAATGATCTGGTG |
| SSR1 | 1 | 1 | 1 | 1 | 2 | 2 | 3 | 2 | +AA | 3535 | CTTTTGACTTTGGGATACAGTC | GATTAGTGCCTGATGTAGGG |
| INDEL2 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | -CAATC | 5852 | GGAATTTCCATCCTCAACAGA | GTTTTGTTACGGAAAAATGGTATG |
| SSR2 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +A | 6098 | TTCTCGTATTTCTTCGACTCG | GATAAGAACTGCTCGTTAGATAG |
| INDEL3 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +AGAAA | 8192 | GCCGCTTTAGTCCACTCAGCCATC | TCAATGCCTTTTTTCAATGGTCTC |
| SSR3 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +A | 11441 | CTGGCTCGGTTATTCTATC | GAAAACCGGTATAGTTCTAGG |
| INDEL4 | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | -AGGG | 12669 | GCAACAGGGTTCCCTAAACCG | GCCAAATTGAGCAGGTTGCG |
| INDEL5 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | -T | 13566 | GCTTCGCGACTCTGTACTCA | TACTTAAGGCGTCCTTAAGG |
| INDEL6 | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | -AC | 14011 | GAAATCTGGGCCATAGAGAA | CTAAGCAGAGACATTCAGAATC |
| INDEL7 | NA | -TATTTCTAAGA | 14527 | - | - | |||||||
| SSR4 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | -A | 17099 | GAAAAAATCCATGGAGGGAGAG | CCCAACATATCGCACATTTTCC |
| SSR5 | 2 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | -TTTCTA | 17336 | GGTCGCTTCTAGTAGCGATTATG | TGCCGAACTTTATTCTTTCTCTC |
| SSR6 | including SSR5 to INDEL10 | -TTTCTA | 17358 | |||||||||
| INDEL8 | -ATAGAA | 17379 | ||||||||||
| INDEL9 | +AGAATTAT | 17385 | ||||||||||
| INDEL10 | +GAATTATATAGAAC | 17392 | ||||||||||
| INDEL11 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 2 | +TGG | 19001 | GAATATCATAAACTGTAAGTGGCAG | CACATGAAATTCTCGGGAACTCC |
| SSR7 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +T | 41464 | GAGGCAAGTGTTCGGATCTATTATG | CTATATTATGCTCAAGGAAAGTAGA |
| SSR8 | 1 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | -TATAT | 46086 | CTCTAATTCGCAAATCTATTTTTC | CAAGAAATTCGCATGTTCTC |
| SSR9 | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | -T | 46174 | GAGAACATGCGAATTTCTTG | CATACTATAACGCTTGATATTC |
| INDEL12 | 1 | 2 | 1 | 2 | 2 | 2 | 2 | 2 | +T | 47211 | GTCGTGAGGGTTCAAGT | CGAGTTAATAATCGACATTCCTTGCC |
| INDEL13 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 2 | +AGGAC | 50351 | GCCTGTCCAGTCTATAAACAAG | GGGTCTTTGAAACAGTTCG |
| SSR10 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +T | 53999 | CATAGAATGTACACAGGGTGTACCC | CTCACAACGACAGGGTCTAC |
| INDEL14 | INDEL14 and SSR11 | -CTTTTTTTTTAGAATA | 57017 | GGATAGAAAGGCCGCGAG including | GACTATTGTATTTTTGAGTTTGC | |||||||
| SSR11 | -A | 57061 | ||||||||||
| INDEL15 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | -CTTTTCAAT | 64815 | CCAGATGCTTTGTCATTCCC | TCATGACTCTAAGGTCCAACC |
| INDEL16 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +TTCCTATTTAATA | 65452 | GTCGTTATTGTCGTAAGCATACGA | GATGAATACCCTCGATACATATG |
| SSR12 | NA | +T | 65615 | - | - | |||||||
| INDEL17 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +t | 66896 | CCAATGGCTTTTGCTACTATAACC | GAAAGAAAGGGCTCCGGTG |
| SSR13 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +A | 71377 | GCACCTGTTATCTCTATCAAG | GTCTGGTTGCGAGGTCTGAATAG |
| SSR14 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | -TTTCTA | 75980 | GATATCCGTTTCAGGGTAAA | CTGATTCGTAGGCGTGGAC |
| SSR15 | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | -A | 76232 | CAAATTTTACGAACAGAAGCTC | CCGAAGACTCGAAGGATACC |
| SSR16 | NA | -T | 76574 | CATAACTAAACCCTCGAAAGTAA | CCCGCCTATAGCGGTAATC | |||||||
| INDEL18 | 2 | 3 | 2 | 3 | 1 | 1 | 1 | 1 | -T | 77728 | GCTACATTTAAAAGGGTCTGAGG | CTGCCAGCAAAATGCCC |
| SSR17 | NA | -T | 78423 | - | - | |||||||
| INDEL19 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +T | 80090 | GGGTTGTACCAAGTCTGAA | GCTCGAGGACGTAGTTCTCCCATAA |
| SSR18 | NA | -C | 93004 | - | - | |||||||
| SSR19 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +C | 93534 | GTTCGTCCTCAATGGGAAAATG | GGGAAGTCCTATTGATTGCTG |
| INDEL20 | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | +AACA | 104530 | GATCATTTTCTGGCGTCAGCG | GAATATTGTACCGAGGAATTCG |
| INDEL21 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | +G | 121618 | AAGGCTCGAATGGTACGATC | CTTCTCGAGAATCCATACATCCC |
| SSR20 | NA | -G | 122142 | - | - | |||||||
NA: not amplified.
Pollen and seed fertility of self pollinated plants and F1 plants among Asian O. rufipogon, O. meridionalis and alternative perennials in Australia.
| Pollen and Seed Fertilitty (%) | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Female | Male | Self Pollinated | Crossed with Jpn1 | Crossed with Jpn2 | Crossed with W1297 | ||||
| Pollen | Seed | Pollen | Seed | Pollen | Seed | Pollen | Seed | ||
| W0106 | 97.2 | 30.1 | 87.2 | 15.7 | 10.2 | 0.0 | 0.1 | 0.0 | |
| 98.8 | 8.9 | 95.7 | 18.3 | 0.8 | 0.0 | 0.1 | 0.0 | ||
| Mean* | 98.0 | 19.5 | 91.4 | 17.0 | 5.5 | 0.0 | 0.1 | 0.0 | |
| W0120 | 98.1 | 96.8 | 84.0 | 24.5 | 10.2 | 0.0 | 21.3 | 0.0 | |
| 98.7 | 74.5 | 78.3 | 21.6 | 12.7 | 0.0 | 20.2 | 0.0 | ||
| Mean | 98.4 | 85.6 | 81.2 | 23.1 | 11.5 | 0.0 | 20.8 | 0.0 | |
| W1299 | 95.7 | 20.0 | 0.0 | 0.0 | 29.4 | 0.0 | 99.3 | 42.9 | |
| 96.1 | 24.5 | 4.5 | 0.0 | 39.8 | 0.3 | - | - | ||
| Mean | 95.9 | 22.3 | 2.2 | 0.0 | 34.6 | 0.1 | - | - | |
| W1297 | 95.7 | 54.4 | 5.3 | 0.0 | 53.2 | 0.0 | - | - | |
| 96.9 | 75.9 | 6.4 | 0.0 | 33.8 | 0.0 | - | - | ||
| Mean | 96.3 | 65.2 | 2.2 | 0.0 | 34.6 | 0.1 | - | - | |
*Mean: data obtained from multiple plants were averaged and noted the mean.
Screening retrotransposable element insertions.
| Flanking Primers to Confirm | Insertion (+) / no-Insertion (-) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Genome | |||||||||||
| with Inner Primers toward Outside | Sequence | Position | Nipponbare | W0106 | W0120 | W0137 | Jpn1 | Jpn2 | W1299 | W1300 | Remarks |
|
| |||||||||||
| Jpn2-meridionalis class | |||||||||||
| Chr2-7291280-r (w/L) | TCTCTCTACAGATAATGCTC | 7291535 | - | - | - | - | - | + | + | + | Other |
| Chr9-12952747-r (w/L) | CACACCCATCTACATCGATG | 12953007 | - | - | - | - | - | + | + | + | Other |
| Chr10-11030242-f (w/L) | GATTGCCGGCTTCTTTACTAG | 11029860 | |||||||||
| Australia class | |||||||||||
| Chr3-10559212-r (w/L) | ACCTATAACAACTGAGAGAC | 10559538 | - | - | - | - | + | + | + | + | Other |
| Jpn2-meridionalis-W0106 class | |||||||||||
| Chr1-4067055-f (w/ L) | GAAAGAGATCACAGGTAAAC | 4066713 | - | + | - | - | - | + | + | + | Other |
| Jpn2-W0180,W1921 class | |||||||||||
| Chr3-10203820-f (w/L) | TCCACCGACTTATAAATCAC | 10203450 | - | - | - | - | - | + | - | - | No other |
| Inner primer toward outside | |||||||||||
| pSINE1-L | GAAGACCCCTGGGCGTTTCT | ||||||||||
| (paired primer to amplify | |||||||||||
|
| |||||||||||
| Chr3-33707528-f (w/L) | GTGTAAATATGTATTGTACC | 33702014 | - | - | - | - | - | + | + | + | Other |
| Chr8-24323118-f (w/L) | GCCTATTACTATCAATCACC | 24322813 | - | - | - | - | - | + | + | + | Other |
| Chr5-576201-f (w/R) | GATAACTAGGGTAAATGAC | 575868 | - | - | - | - | + | + | + | Other | |
| Inner primer toward outside | |||||||||||
| pSINE3-R | TCCTTCCTAGATTGGTCCC | ||||||||||
| pSINE3-L | TGCTAGCCGGGAAGACC | ||||||||||
| (paired primer to amplify | |||||||||||
Figure 2pSINE1 and pSINE3 insertions amplified with flanking primers and outward primers from pSINE consensus sequences. From lane 1 to 8, Nipponbare, W0106, W0120, W0137, Jpn1, Jpn2, W1299, and W1300 were used as each DNA template.