Literature DB >> 32032347

SHOX CNE9/10 Knockout in U2OS Osteosarcoma Cells and Its Effects on Cell Growth and Apoptosis.

Xue-Jiao Xu1, Shi-Jie Xin1, Hui-Ying Mao1, Hui-Jiao Zhang1, Lan-Ni Chen1, Li Li1, Hua-Lei Bai2, Hai-Hua Huang1, Min Shu1.   

Abstract

BACKGROUND Osteosarcoma is a common malignant tumor of musculoskeletal stromal cells. Osteosarcoma clinical behavior depends mostly on the histologic grade, the site of primary tumor, the response to chemotherapy, and the presence of pulmonary metastases. The aim of this study was to knockout SHOX CNE9/10 in U2OS osteosarcoma cells and to analyze the effects on cell growth and apoptosis. MATERIAL AND METHODS U2OS cells with CNE9 knockout and U2OS cells with CNE10 knockout were established via the CRISPR/Cas9 system. Sanger sequencing was used to detect the success of the knockdown experiment. Western blotting and quantitative polymerase chain reaction were used to detect the expression levels of short stature homeobox-containing gene (SHOX) protein and messenger RNA (mRNA) after knockdown of CNE9 and CNE10. The cell viability and apoptotic rate were detected by the Cell Counting Kit-8 method and by flow cytometry. RESULTS The Sanger sequencing results showed that the knockdown experiment was successful. The levels of SHOX mRNA and protein were significantly reduced after knocking down CNE9 and CNE10. Knockdown of CNE9 and CNE10 significantly increased the growth and inhibited the apoptosis of U2OS osteosarcoma cells. CNE9/CNE10 knockdown U2OS cells were successfully constructed. CONCLUSIONS Knockdown of CNE9 and CNE10 promoted U2OS cell growth and inhibited apoptosis by decreasing SHOX expression. This CNE9/CNE10 knockout U2OS cell model could provide a bridge for the research on SHOX and CNEs in osteosarcoma.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32032347      PMCID: PMC7020756          DOI: 10.12659/MSM.921233

Source DB:  PubMed          Journal:  Med Sci Monit        ISSN: 1234-1010


Background

Osteosarcoma is a common malignant tumor of musculoskeletal stromal cells. The incidence of osteosarcoma is approximately 3.1 per million, and the incidence is higher in males than in females [1]. Osteosarcoma occurs mostly at the medullary end of the long bone, and the tibia is the second most frequent site, followed by the proximal humerus [2]. Osteosarcoma clinical behavior depends mostly on the histologic grade, the site of the primary tumor, the response to chemotherapy and the presence of pulmonary metastases [3]. At present, the main treatment methods for osteosarcoma include surgery, chemotherapy, immunotherapy, and gene therapy, but some osteosarcoma patients still have poor prognoses [4]. Analysis of the occurrence and development of osteosarcoma is an important basis for the discovery of new methods for the diagnosis and treatment of osteosarcoma. Short stature homeobox-containing gene (SHOX) is located in the pseudo-autosomal region 1 (PAR1) of the human sex chromosomes and plays an important role in promoting bone development and longitudinal growth [5,6]. The main mechanism of action described in the literature suggests that SHOX protein may control chondrocyte growth, apoptosis, and differentiation by regulating the expression of its target genes, such as BNP, Fgfr3, and Agc1 [7-10]. Recently, a study by Ni et al. [11] showed that the methylation level of SHOX is significantly increased in lung cancer patients and can be used as a potential biomarker for lung squamous cell carcinoma, and the increase in methylation level can affect the expression level of SHOX. In human mesenchymal stem cells, SHOX can regulate cell proliferation and osteogenic differentiation [12]. In addition, Weiss et al. [13] proposed that the methylation level of SHOX can be used to distinguish patients with malignant and non-malignant lung diseases. SHOX has a role in regulating apoptosis, which may be one of the reasons for the malignant growth of tumor cells [14]. It was also reported that the level of mSHOX2 DNA in the plasma of lung cancer patients can reflect the response to cytotoxic treatment and may be a tool to guide treatment [15]. In vitro results also showed that SHOX2 breast cancer cells are involved in epithelial-mesenchymal transition and receive targeted regulation of microRNA-375 [16]. These results suggest that the expression level of the SHOX gene may be related to tumor behaviors. These findings suggest that genetic defects in non-coding regions containing conserved non-coding elements (CNEs) can underlie cancer. Seven evolutionarily conserved non-coding elements located upstream (CNE5, CNE3, and CNE2) and downstream (CNE4, CNE5, ECR1, and ECS4/CNE9) of SHOX have been identified as enhancers [17,18]. We constructed a SHOX CNE9/CNE10 knockout osteosarcoma U2OS cell line by using CRISPR/Cas9 to study the relationship between SHOX and its CNEs and to analyze the effects of CNEs and SHOX on osteosarcoma cells.

Material and Methods

Cell culture

The human osteosarcoma cell line U2OS was purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS, Thermo Fisher, Waltham, MA, USA). Cell culture conditions were 37°C, 5% carbon dioxide (CO2) and 95% humidity.

Plasmid design and purification

The exact positions of CNEs on the X chromosome (NCBI build 36.1) are as follows: CNE9 (804746-805567) and CNE10 (853825-854598). The CNE9 and CNE10 gRNA (guide RNA) designations were based on CRISPR design (). The CRISPR-Cas9 GFP knockout plasmid was created by preparing and ligating gRNA GFP oligos to a pSpCas9(BB)-2A-GFP (PX459) plasmid (Addgene plasmid #48138). The forward and reverse oligos were prepared to be inserted into the pSpCas9(BB)-2A-GFP plasmid according to the protocol. Plasmids were then purified using QIAGEN EndoFree Plasmid Maxi Kit (Hilden). Target sequence designations are shown in Table 1.
Table 1

Target sequence designations.

CNETarget sequencegRNA sequence (5′-3′)
CNE9-upGCCACCACCAGCTACTGGGGUp-CACCGCCACCACCAGCTACTGGGGDown-AAACCCCCAGTAGCTGGTGGTGGC
CNE9-downGAGGGTCCCCCTGGGACTGTUp-CACCGAGGGTCCCCCTGGGACTGTDown-AAACACAGTCCCAGGGGGACCCTC
CNE10-upGGGTCAGACGCAGCCACGCAUp-CACCGGGTCAGACGCAGCCACGCADown-AAACTGCGTGGCTGCGTCTGACCC
CNE10-downGGATGCTAAGTCCATTAGCGUp-CACCGGATGCTAAGTCCATTAGCGDown-AAACCGCTAATGGACTTAGCATCC

CNE9 – conserved non-coding elements 9; CNE10 – conserved non-coding elements 10.

Transfection

Transfection of CNE9 gRNA-Cas9-GFP, and CNE10 gRNA-Cas9-GFP into U2OS cells was performed with Lipofectamine™ 2000 transfection reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. At 48 hours after transfection, the cells were harvested for the follow-up experiments.

Sequencing verification

Next, the cells were expanded, and genomic DNA was extracted using a TAKARA kit. The oligo target site sequence was amplified by polymerase chain reaction (PCR), and the PCR amplification product was purified by using a TAKARA kit and ligated to a PMD18-T vector. After transformation and bacterial culture, 5 colonies were picked and placed in 3 mL LB (Luria-Bertani) liquid medium (containing 3 μL AMP) at 37°C at 200 rpm for 12 hours. PCR was performed using 1 μL of bacterial solution as a template. Then, the bacterial solution was sampled for Sanger sequencing.

Quantitative PCR

Total RNA of cells after transfection was extracted with TRIzol regent (Invitrogen, Carlsbad CA, USA) in accordance with the manufacturer’s instruction. The messenger RNA (mRNA) was isolated and applied to generate complementary DNA (cDNA) by using the iScriptTM cDNA Synthesis Kit (Bio-Rad, CA, USA). TaqMan Universal Master Mix II was used for quantitative real-time PC (qRT-PCR) and the internal control was GAPDH. The primers were showed in Table 1.

Western blotting

Western blotting analyses were performed as described. The SHOX primary rabbit monoclonal antibody (1: 500, ab84804, 32 kD) and GAPDH monoclonal antibody (1: 1000, ab181602, 36 kD) were purchased from Abcam (San Francisco, CA, USA). The cell protein was extracted and separated using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), the experimental voltage was 110 V and the duration of the experiment was 100 minutes. The proteins were transferred to polyvinylidene difluoride (PVDF) membranes, the membranes were then blocked in 5% non-fat milk for 1 hour at room temperature. The primary antibody SHOX was added (1: 500 dilution) and then incubated overnight. The protein blot bands were detected using Pierce™ ECL plus western blotting substrate (Thermo Fisher, Waltham, MA, USA).

Cell Counting Kit-8 (CCK-8) assay

Cell viability was detected using the Cell Counting Kit-8 (CCK-8) assay. The U2OS cells (1×104 cells, 100 μL) were seeded in a 96-well culture plate. CCK-8 reagent (Beyotime, Beijing, China) was added in accordance with the manufacturer’s instruction after the cells were cultured for a certain period of time. After added CCK-8 reagent, the samples were incubated for 2 hours under the original conditions. The cell viabilities were detected by Tecan Infinite M200 microplate reader (LabX, Switzerland).

Colony formation assay

Cells (5×103) were seeded in a 6-well plate. After 48 hours, the cell colonies were fixed with methanol and further stained with 0.5% crystal violet for 20 minutes. Colonies were detected under the microscope (Olympus IX71, Tokyo, Japan).

Flow cytometry

Cell apoptosis rates were detected by flow cytometry. The cells were washed and labelled with an apoptosis kit (Tianjin Biolite Biotech Co., Ltd., Tianjin, China.). The resulting fluorescence was measured by flow cytometry (BD FACSCanto II; BD Biosciences) and FlowJo 7.6.1 software (FlowJo LLC).

Statistical analysis

Statistical analysis was carried out with GraphPad Prism7.0 and data are shown as mean±standard deviation (SD). The comparison between the 2 groups were analyzed by Student’s t-test. The P value less than 0.05 was considered statistically significant.

Results

CNE9 and CNE10 knockout U2OS cell model was successfully established

We successfully established CNE9 and CNE10 knockout human osteosarcoma U2OS cell models. The genotypes of CNE9 and CNE10 are shown in Table 2. The sequencing results showed that there were 1088 bases of mutation/deletion in one allele of CNE9 and there were 1095 bases in another allele compared with those of the wild type CNE9 (Table 3). The sequencing results showed that there were 196 bases of mutation/deletion in one allele of CNE10 and there were 384 bases in another allele compared with the wild type of CNE10 (Table 4).
Table 2

The genotype of CNE9 and CNE10.

NamesGenotype
CNE9AATTATATATAATGTATACATATATTTAAATTATATATAATGTATACATATATTTATATATAATGTATACATATATTT AAATTATATATAATATACATATTTGGATAGTTTTATTTATTTATTTATTGGAGTCTTGCTCTGTCCCCCAGGCTGG AGTGCAGTGACATGATCTCTGCTCACTGCAACCTCCGCCTTCCAGGCTCAAGCGATCCTCCTGCCTAAGCCTC CCGAGTAGCTGGGATTACAGGCGCCCGCCACCACCAGCTACTGGGGAGGCTGAGGCAGGAGGATCGCTTGA CCCTCGGAGGCGGAGGTTGCAGTGAAGCGAGATTGCACCACTGCACTCCAGCCTGGGGGGCAGAGCCAGA CTCTGTCTAAAAAAAAAAAAGAAAGAAAAAGAAAAAAAAAACCTGCACGTTGCTGGATGAGGAAGGGCCTT TTTTCAAAAAGTTGCACTTTTTTTCCCCCTATACTTTACTTCTTTGCTGTCATTAGCTAGGACTTGAAAGGGCAG GAACTCTAATTGTGTTTCCTCTGTGGGGCACAGAGTCCTGTCTCGACCCCGTCGTGCTGCCAAAGAAAACGCC GGGTTCCCTTCCACGTTGTTCATTTTCCTTTTCCTGCCCACTTAACAAAATTATATTCAATGAGTTGTGGGGGGA ATTGACATCAACGGGCCGCGTCACGCAATTTCTGGTGAATATTCGAGAAGGGGGAAGCAAACAGTCCGGGTT CCTTCACATCTGTCAGAATCAATCACATTGTACCAAACCGAACGTAATCGCTTGCAAAGAAAATGAGGCATTTC CAGTGAAATCAGCCTCCCTTTACCCAGGAACATGTCCATAGTTAAGAGGTCTCTGTTTTAGGTTTTTTTTTTTTT ATTTTAATCTTGCCTAATTAGTTTTTTTTTAATCACCCGTGCAACCGAGTCTCCAGACTGCATAATTGATGAGAT GCAGAAGCCAGTGTCAGAAATCAAATGTCGTAAATTAAAAATAACAAGTTTGAGACGAGTGATTCAATTAAA AATCCAGAAAACATTGGATTCTGCATAACTGAACGTTTGCATAGAGACACCGCCTGTCATCCGTATCACGTTG CACCCGAGGATTGGATTGGGGCTGTCACGGGTATTTCAATCAACTCAGTAAAAAAAAAAAAAAAAAATTAGAAAACAAAGATGATATTTATTATTAACTTCCCGTGTTCAA AAACCACACGGAGACGTCTTTAGGTGGACTGCTTTACAGGACCAAGATTTATGTTAAGGGGACACTGCAGAC ACAAGAGGCCTGGCTGGCTGGGATGTAGGGAGGGTCCCCCTGGGACTGTTGGACCGTTTTCTGAGTACGTGA GGCTGCCAGGAGGACGGGGCTGCACAGAGCCGACTGGGACCCTCCAAGACGGACCCTGAGAAACCTCACTG GGTCCTCTCTCTCTTTTTTTTTTTTTTTTTTTTTGAGACGGCTTTTCACTCTTGTTTCCCAGGCTGGAGTGCAGTG GTGCAATCTTGGCTTTGCAACCTCTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGG GATGACAGGCGCGCGCCACCACGCCTGGCTAAGTTTTTGTATTTTTATTAGAGACAGAGCTTCACCATGTTGGC CAGGCTGGTCTCGAACTCCTGACCTCA
CNE10GCCTGGAATAATCCCTCCTTTCCACGTCTTGTCCCGCCATGGAGTGCCCCAGAGTTCCGGGACGTGGAAGG TGCCGTCCCCTGCCTGACACGGTGCTGCCCAGCTCCCTCCTCATCCCGGTGGCTTCCCAAACTCCCCGGGCC TGCTGGAGGAAACACCTGTGCTGAAGACTCGGAGGCCCTTCCCTCCAAACCCTGACTCCGGGGTCAGCGAC GCCAACAGGTGTTTTTTCTCAGAATCGCCTTCTTGTCTGAATTGAGCCCCAGGATCAGAAGGCCAAGGGGCC AGGGGTCAGACGCAGCCACGCAGGGTTCCCCGGGGGCCAGGGCTTACCAGGTGGTTAATATTATCAGAGCT CATTTGCTGAAGCTGGACTGGCGTGTTCTCGGCGGTCCCAAATAAATTTAACGAGAGCGACTTTCAAAGCCCA CCTATTAGGACCGTCTGTTCAATGGACAGGAGGGTTAACCGTAATTCGAGGAGGCAGCTTGGCCGTCTCCAAA TAGGAACACATGGACTGTGAGGCTTGGCCCCATTTGTGGTAATTTTAAGGTCTCGTTTCCATTTGTAAGAAACAT AACTACTTACATATGGAAAGAATGAATAAGAGAAGTCATTAAAATTTCTCTAATTTAGGAAAAAAATAAAAAAAAA AAGATGTAACGAAGTAATATCTTTACCAGGCCAGGCAGAAATGTAAATTAGACATTAGAAGAAAAACCTATTAACA GGATGGCTGGATGGCTGCGTGGCTTGCCTGTTTTTTTTTTTTTTTAATCTAATGAATTTATGAATTGCTAGTTGTGGG GGTCACAGATTTTGTTAATTTCCTATGTGTTTAGCTCTGCAGTAAGAAGGGAGGATTTGCTTATGAACCACGGATGCT AAGTCCATTAGCGGGGCGGTTGCTAATCAGAACACAAATGGTAATACGTACGGTCCAGCATTGAAAAAAAAAAAGA CAGAAAAACACATGAATTATTTCAAGTTGGGGTTTTTCCAACTTCTGTCCGTTGTCCCCACAGGTCATCAGAATATTTA AACATCAGGGAGTAAGAGGCGACCTAGCTAGGTAGCTGCCTGATTATAAAATATATGCAAAAGCTTTCTTTTTTTTTT TTTTTTTAAACAGAGTCTTGCTTTGTCGCCCAGGCTGGAGTGCAATGGTGAGATCTCGGCTCACTGCAACCTCCAG CTCCTGGGTTCCAGCGATTCTCCTGCCTCAGCCTCCCAAGGAGCTGGGATTACAAGCGCCCGCCACCACACCCAGC TCATTTTTGTATTTTTAGTAGAAACGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTTAAGTGATCC ACCTGCCTCCACTTCCCAAAGTGCTGGGATGACAGGCTTGAGCCACCGTG.

CNE9 – conserved non-coding elements 9; CNE10 – conserved non-coding elements 10.

Table 3

Sequence of CNE9 after knockdown.

NamesSequence
One alleleAATTATATATAATGTATACATATATTTAAATTATATATAATGTATACATATATTTATATATAATGTATACATATATTTAA ATTATATATAATATACATATTTGGATAGTTTTATTTATTTATTTATTGGAGTCTTGCTCTGTCCCCCAGGCTGGAGT GCAGTGACATGATCTCTGCTCACTGAAACCTCCGCCTTCCAGGCTCAAGCGATCCTCCTGCCTAAGCCTCCCGAGTA GCTGGGATTACAGGCGCGTAGGCTGACTGGGCTAAATCCGGATTGATGAGGAAGGGCCTTTTTTCAAAAAGTTGG TCAGTCGGCTACCGTTTTCTGAGTACTTTGAGGCTGCCAGGAGGACGGGGATGCACAGAGCCGACTGGGACCCTC CAAGACGGACCCTGAGAAACCTCACTGGGTCCTCTCTCTCTTTTTTTTTTTTTTTTTTTTTGAGACGGCTTTTCACTCT TGTTTCCCAGGCTGGAGTGCAGTGGTGCAATCTTGGCTTTGCAACCTCTGCCTCCCGGGTTCAAGCGATTCTCCTGC CTCAGCCTCCCGAGTAGCTGGGATGACAGGCGCGCGCCACCACGCCTGGCTAAGTTTTTGTATTTTTATTAGAGACA GAGCTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTC
Another alleleAATTATATATAATGTATACATATATTTAAATTATATATAATGTATACATATATTTATATATAATGTATACATATATTTAAATTAT ATATAATATACATATTTGGATAGTTTTATTTATTTATTTATTGGAGTCTTGCTCTGTCCCCCAGGCTGGAGTGCAGTGAC ATGGTCTCTGCTCACTGCAACCTCCGCCTTCCAGGCTCAAGCGATCCTCCTGCCTAAGCCTCCCGAGTAGCTGGGAT TACAGGCGCGTAGGCTGAGCTGGTGATCGGAGGACGGCTACCGTTTTCTGAGTACGTGAGGCTGCCAGGAGGAC GGGGCTGCACAGAGCCGACTGGGACCCTCGAACTCGTACCCTGAGGAACCTCACTGGGTCCTCTCTCTCTTTTTTTT TTTTTTTTTTTTTGAGACGGCTTTTCACTCTTGTTTCCCAGGCTGGAGTGCAGTGGTGCAATCTTGGCTTTGCAACCT CTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATGACAGGCGCGCGCCACCACGCC TGGCTAAGTTTTTGTATTTTTATTAGAGACAGAGCTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCA

CNE9 – conserved non-coding elements 9.

Table 4

Sequence of CNE10 after knockdown.

NamesSequence
One alleleGCCTGGAATAATCCCTCCTTTCCACGTCTTGTCCCGCCATGGAGTGCCCCAGAGTTCCGGGACGTGGAAGGTGCCGTCC CCTGCCTGACACGGTGCTGCCCAGCTCCCTCCTCATCCCGGTGGCTTCCCAAACTCCCCGGGCCTGCTGGAGGAAACAC CTGTGCTGAAGACTCGGAGGCCCTTCCCTCCAAACCCTGACTCCGGGGTCAGCGACGCCAACAGGTGTTTTTTCTCAGA ATCGCCTTCTTGTCTGAATTGAGCCCCAGGATCAGAAGGCCAAGGGGCCAGGGGTCACATAGTCTCCTAATAGGAACAC ATGGACCGTGATAGCTTGGCCCCATTTGTGGTAATTTTAAGGTCTCGTTTCCATTTGTAAGAAACATAACTACTTACATATG GAAAGAATGAATAAGAGAAGTCATTAAAATTTCTCTAATTTAGGAAAAAAATAAAAAAAAAAAGATGTAACGAAGTAATAT CTTTACCAGGCCAGGCAGAAATGTAAATTAGACATTAGAAGAAAAACCTATTAACAGGATGGCTGGATGGCTGCGTGGCTT GCCTGTTTTTTTTTTTTTTTAATCTAATGAATTTATGAATTGCTAGTTGTGGGGGTCACAGATTTTGTTAATTTCCTATGTGTTTA GCTCTGCAGTAAGAAGGGAGGATTTGCTTATGAACCACGGATGCTAAGTCCATTAGCGGGGCGGTTGCTAATCAGAACACA AATGGTAATACGTACGGTCCAGCATTGAAAAAAAAAAAGACAGAAAAACACATGAATTATTTCAAGTTGGGGTTTTTCCAACT TCTGTCCGTTGTCCCCACAGGTCATCAGAATATTTAAACATCAGGGAGTAAGAGGCGACCTAGCTAGGTAGCTGCCTGATTATA AAATATATGCAAAAGCTTTCTTTTTTTTTTTTTTTTTAAACAGAGTCTTGCTTTGTCGCCCAGGCTGGAGTGCAATGGTGAGATCT CGGCTCACTGCAACCTCCAGCTCCTGGGTTCCAGCGATTCTCCTGCCTCAGCCTCCCAAGGAGCTGGGATTACAAGCGCCCGCC ACCACACCCAGCTCATTTTTGTATTTTTAGTAGAAACGGGGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTTAAGT GATCCACCTGCCTCCACTTCCCAAAGTGCTGGGATGACAGGCTTGAGCCACCGTG
Another alleleGCCTGGAATAATCCCTCCTTTCCACGTCTTGTCCCGCCATGGAGTGCCCCAGAGTTCCGGGACGTGGAAGGTGCC GTCCCCTGCCTGACACGGTGCTGCCCAGCTCCCTCCTCATCCCGGTGGCTTCCCAAACTCCCCGGGCCTGCTGGA GGAAACACCTGTGCTGAAGACTCGGAGGCCCTTCCCTCCAAACCCTG ACTCCGGGGTCAGCGACGCCAACAGGT GTTTTTTCTCAGAATCGCCTTCTTGTCTGAATTGAGCCCCAGGATCAGAAGGCCAAGGGGCCACCTACCTGATGTG ATTGATTTTCTCTAATTTAGGAAAAAAATAAAAAAAAAAAGATGTAACGAAGTAATATCTTTACCAGGCCAGGCAG AAATGTAAATTAGACATTAGAAGA AAAACCTATTAACAGGATGGCTGGATGGCTGCGTGGCTTGCCTGTTTTTTTTT TTTTTTAATCTAATGAATTTATGAATTGCTAGTTGTGGGGGTCACAGATTTTGTTAATTTCCTATGTGTTTAGCTCTGCA GTAAGAA GGGAGGATTTGCTTATGAACCACGGATGCTAAGTCCATTAGCGGGGCGGTTGCTAATCAGAACACAAATG GTAATACGTACGGTCCAGCATTGAAAAAAAAAAAGACAGAAAAACACATGAATTATTTCAAGTTGGGGTTTTTCCAAC TTCTGTCCGTTGTCCCCACAGGTCATCAGAATATTTAAACATCAGGGAGTAAGAGGCGACCTAGCTAGGTAGCTGCCT GATTATAAAATATATGCAAAAGCTTTCTTTTTTTTTTTTTTTTTAAACAGAGTCTTGCTTTGTCGCCCAGGCTGGAGTG CAATGGTGAGATCTCGGCTCACTGCAACCTCCAGCTCCTGGGTTCCAGCGATTCTCCTGCCTCAGCCTCCCAAGGA GCTGGGATTACAAGCGCCCGCCACCACACCCAGCTCATTTTTGTATTTTTAGTAGAAAC GGGGTTTCACCATGTTGG CCAGGCTGGTCTCGAACTCCTGACCTTAAGTGATCCACCTGCCTCCACTTCCCAAAGTGCTGGGATGACAGGC TTGAGCCACCGTG

CNE10 – conserved non-coding elements 10.

Knockdown of CNE9 and CNE10 could inhibit SHOX

The results of this study showed that the expression levels of SHOX2 mRNA and protein were significantly lower in the CNE9 or CNE10 knockout groups than in the control group (Figure 1A, 1B). This suggested that knockdown of CNE9 or CNE10 could inhibit the expression of the SHOX gene.
Figure 1

Knockdown of CNE9 and CNE10 inhibited SHOX. (A, B) The effects of knockdown of CNE9 and CNE10 on SHOX mRNA and protein in osteosarcoma cell U2OS. * P<0.05 versus si-NC group.

Knocking down CNE9 and CNE10 promoted cell growth and proliferation

These studies showed that knockdown of CNE9 and CNE10 significantly promoted U2OS cell viability and cell proliferation (Figure 2A, 2B). This suggested that downregulation of CNE9 and CNE10 promoted osteosarcoma cell proliferation by inhibiting SHOX levels.
Figure 2

Knockdown of CNE9 and CNE10 promoted cell growth and proliferation. (A, B) The effects of knockdown of CNE9 and CNE10 on cell viability and proliferation of U2OS cells.* P<0.05 versus si-NC group.

Knocking down CNE9 and CNE10 inhibited apoptosis

Knockdown of CNE9 and CNE10 significantly inhibited U2OS cell apoptosis (Figure 3). This suggested that downregulation of CNE9 and CNE10 inhibited osteosarcoma cell apoptosis.
Figure 3

Knockdown of CNE9 and CNE10 inhibited cell growth and apoptosis. The effects of CNE9 and CNE10 knockdown on U2OS cell apoptosis. * P<0.05 versus si-NC group.

Discussion

In this study, we successfully established CNE9 and CNE10 knockdown osteosarcoma cell line U2OS cells. It was found that knocking down CNE9 and CNE10 could decrease the expression levels of the SHOX gene and promote osteosarcoma cell proliferation and inhibit apoptosis. Osteosarcoma is the most common primary malignancy in children and adolescents, and the 5-year survival rate for osteosarcoma patients receiving standard therapy is approximately 70%. Surveillance, Epidemiology, and End Results (SEER) data in children and adolescents show that the survival for patients age <25 years is 61.6% (females, 65.8%; males, 58.4%) [19,20]. Analysis of the pathogenesis of osteosarcoma lung metastasis is one of the means of discovering new approaches to osteosarcoma treatment. In humans, SHOX is mainly found in the bone marrow fibroblasts, skeletal muscles, and placenta and plays an important role in the formation of the upper and lower limbs of the fetus. A recent study showed that in U2OS osteosarcoma cells, SHOX expression causes oxidative stress and induces rupture of the lysosomal membrane, causing cell death [14]. A study also found that the loss of SHOX promotes the expression of osteogenic genes during osteoblast differentiation [12]. There are many conserved CNE-regulated transcription factors upstream and downstream of the SHOX gene [21,22]. To analyze the effects of CNE9/CNE10 on the expression level of SHOX, we constructed a CNE9/10 knockout U2OS cell line using the CRISPR/Cas9 system. The knockdown results were verified by sequencing techniques. The protein expression levels of SHOX in CNE9 and CNE10 knockout U2OS cells were decreased. This suggested that knockdown of CNE9/CNE10 could downregulate the level of SHOX transcription and translation and regulate the expression of the SHOX gene. To further analyze the effects of knockdown of CNE9 and CNE10 on osteosarcoma cells, we examined the proliferation and apoptosis levels of cells. The results showed that after knocking down CNE9 and CNE10, cell viability was significantly promoted, while apoptosis was inhibited. Mutations in CNE affect the expression of SHOX, which may affect cellular function [17]. Bunyan et al. [23] also showed that SHOX expression is regulated by upstream and downstream regulatory elements, thereby participating in disease development. This indicates that knockdown of CNE9 and CNE10 could inhibit the expression of SHOX, thereby promoting the growth of osteosarcoma cells and inhibiting apoptosis.

Conclusions

We successfully constructed CNE9/CNE10 knockdown U2OS cells. Furthermore, we found that knockdown of CNE9 and CNE10 promotes osteosarcoma cell growth and inhibits apoptosis by inhibiting SHOX expression. This CNE9/CNE10 knockout U2OS cell model could provide a bridge for the research between SHOX and CNEs in osteosarcoma.
  23 in total

1.  Childhood osteosarcoma: Incidence and survival in Argentina. Report from the National Pediatric Cancer Registry, ROHA Network 2000-2013.

Authors:  F Moreno; W Cacciavillano; M Cipolla; M Coirini; P Streitenberger; J López Martí; M Palladino; M Morici; M Onoratelli; G Drago; A Schifino; M Cores; A Rose; J Jotomliansky; M Varel; M García Lombardi
Journal:  Pediatr Blood Cancer       Date:  2017-04-14       Impact factor: 3.167

2.  Survival and prognostic factors in Chinese patients with osteosarcoma: 13-year experience in 365 patients treated at a single institution.

Authors:  Wei Wang; Jing Yang; Yun Wang; Dianjun Wang; Gang Han; Jinpeng Jia; Meng Xu; Wenzhi Bi
Journal:  Pathol Res Pract       Date:  2016-11-13       Impact factor: 3.250

3.  Enhancer elements upstream of the SHOX gene are active in the developing limb.

Authors:  Claudia Durand; Fiona Bangs; Jason Signolet; Eva Decker; Cheryll Tickle; Gudrun Rappold
Journal:  Eur J Hum Genet       Date:  2009-12-09       Impact factor: 4.246

4.  Duplications upstream and downstream of SHOX identified as novel causes of Leri-Weill dyschondrosteosis or idiopathic short stature.

Authors:  David J Bunyan; Maria Baffico; Lucia Capone; Silvia Vannelli; Lorenzo Iughetti; Sébastien Schmitt; Emma-Jane Taylor; Adam A Herridge; Deborah Shears; Antonino Forabosco; Domenico A Coviello
Journal:  Am J Med Genet A       Date:  2015-12-24       Impact factor: 2.802

Review 5.  Amputation Versus Limb-Salvage Surgery in Patients with Osteosarcoma: A Meta-analysis.

Authors:  Gang Han; Wen-Zhi Bi; Meng Xu; Jin-Peng Jia; Yan Wang
Journal:  World J Surg       Date:  2016-08       Impact factor: 3.352

6.  The short stature homeobox gene SHOX is involved in skeletal abnormalities in Turner syndrome.

Authors:  M Clement-Jones; S Schiller; E Rao; R J Blaschke; A Zuniga; R Zeller; S C Robson; G Binder; I Glass; T Strachan; S Lindsay; G A Rappold
Journal:  Hum Mol Genet       Date:  2000-03-22       Impact factor: 6.150

7.  Long-range conserved non-coding SHOX sequences regulate expression in developing chicken limb and are associated with short stature phenotypes in human patients.

Authors:  Nitin Sabherwal; Fiona Bangs; Ralph Röth; Birgit Weiss; Karin Jantz; Eva Tiecke; Georg K Hinkel; Christiane Spaich; Berthold P Hauffa; Hetty van der Kamp; Johannes Kapeller; Cheryll Tickle; Gudrun Rappold
Journal:  Hum Mol Genet       Date:  2007-01-02       Impact factor: 6.150

8.  Quantification of cell-free mSHOX2 Plasma DNA for therapy monitoring in advanced stage non-small cell (NSCLC) and small-cell lung cancer (SCLC) patients.

Authors:  Bernd Schmidt; Julia Beyer; Dimo Dietrich; Ines Bork; Volker Liebenberg; Michael Fleischhacker
Journal:  PLoS One       Date:  2015-02-12       Impact factor: 3.240

Review 9.  Primary osteosarcoma of frontal bone: A case report and review of literature.

Authors:  Guangyong Wu; Qi Liang; Yu Liu
Journal:  Medicine (Baltimore)       Date:  2017-12       Impact factor: 1.817

10.  Short stature homeobox 2 methylation as a potential noninvasive biomarker in bronchial aspirates for lung cancer diagnosis.

Authors:  Shumin Ni; Meng Ye; Tao Huang
Journal:  Oncotarget       Date:  2017-05-22
View more
  1 in total

Review 1.  Applications of CRISPR/Cas9 in the research of malignant musculoskeletal tumors.

Authors:  Wei Liu; Shubin Wang; Binhui Lin; Wei Zhang; Guangrong Ji
Journal:  BMC Musculoskelet Disord       Date:  2021-02-05       Impact factor: 2.362

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.