Literature DB >> 32023254

Iron trafficking in patients with Indian Post kala-azar dermal leishmaniasis.

Aishwarya Dighal1, Debanjan Mukhopadhyay1, Ritika Sengupta1, Srija Moulik1, Shibabrata Mukherjee1, Susmita Roy1, Surya Jyati Chaudhuri2, Nilay K Das3, Mitali Chatterjee1.   

Abstract

BACKGROUND: During infections involving intracellular pathogens, iron performs a double-edged function by providing the pathogen with nutrients, but also boosts the host's antimicrobial arsenal. Although the role of iron has been described in visceral leishmaniasis, information regarding its status in the dermal sequel, Post Kala-azar Dermal Leishmaniasis (PKDL) remains limited. Accordingly, this study aimed to establish the status of iron within monocytes/macrophages of PKDL cases. METHODOLOGY/PRINCIPAL
FINDINGS: The intramonocytic labile iron pool (LIP), status of CD163 (hemoglobin-haptoglobin scavenging receptor) and CD71 (transferrin receptor, Tfr) were evaluated within CD14+ monocytes by flow cytometry, and soluble CD163 by ELISA. At the lesional sites, Fe3+ status was evaluated by Prussian blue staining, parasite load by qPCR, while the mRNA expression of Tfr (TfR1/CD71), CD163, divalent metal transporter-1 (DMT-1), Lipocalin-2 (Lcn-2), Heme-oxygenase-1 (HO-1), Ferritin, Natural resistance-associated macrophage protein (NRAMP-1) and Ferroportin (Fpn-1) was evaluated by droplet digital PCR. Circulating monocytes demonstrated elevated levels of CD71, CD163 and soluble CD163, which corroborated with an enhanced lesional mRNA expression of TfR, CD163, DMT1 and Lcn-2. Additionally, the LIP was raised along with an elevated mRNA expression of ferritin and HO-1, as also iron exporters NRAMP-1 and Fpn-1.
CONCLUSIONS/SIGNIFICANCE: In monocytes/macrophages of PKDL cases, enhancement of the iron influx gateways (TfR, CD163, DMT-1 and Lcn-2) possibly accounted for the enhanced LIP. However, enhancement of the iron exporters (NRAMP-1 and Fpn-1) defied the classical Ferritinlow/Ferroportinhigh phenotype of alternatively activated macrophages. The creation of such a pro-parasitic environment suggests incorporation of chemotherapeutic strategies wherein the availability of iron to the parasite can be restricted.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32023254      PMCID: PMC7001907          DOI: 10.1371/journal.pntd.0007991

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Leishmaniases is caused by the intracellular, digenetic protozoan parasite Leishmania that replicates within phagolysosomes of host macrophages. The diverse disease spectrum is attributed to the multiple species that can cause self healing cutaneous lesions, non healing muco-cutaneous lesions involving the mucosa or have visceral involvement of the liver and spleen and cause kala-azar or Visceral Leishmaniasis (VL), which in some apparently cured cases manifests as a dermal sequel, Post Kala-azar Dermal Leishmaniasis (PKDL) [1]. The survival of this intracellular pathogen within host macrophages relies on its ability to effectively nullify host microbicidal effector mechanisms [2], and thrive within acidified, hydrolase-rich phagolysosomes which conventionally constitute compartments responsible for elimination of invading pathogens [3]. An important evolutionary adaptation in parasites is their acquisition of essential nutrients from host cells [4], which includes iron, a trace element essential for virtually all forms of life, as it functions as a cofactor of metabolic enzymes, oxygen transport and participates in immune surveillance [5]. Accordingly, intracellular pathogens deploy several strategies for iron acquisition from host macrophages [6,7] to ensure their intracellular growth [8, 9]. However they also need to minimize the host’s oxidative stress response where iron is a cofactor for superoxide dismutase (Fe-SOD) [10], and therefore, its inactivation is essential for their intracellular survival [11]. In view of the absence of an animal model for PKDL, the role of iron, if any, remains poorly defined. Accordingly, this study was undertaken in patients with PKDL, representative of a chronic manifestation of Leishmanisis, with a view to delineate within circulating monocytes and lesional monocytes-macrophages, the acquisition and export of iron, along with the status of iron metabolism with a view to designing chemotherapeutic strategies that can potentially limit the availability of iron to Leishmania parasites.

Materials and methods

Chemicals

All antibodies were from BD Biosciences (San Jose, CA, USA) and reagents from Sigma Aldrich (St. Louis, MO, USA), except rK39 immunochromatographic test strips (InBios International, Seattle, WA, USA), QIAmp DNA Mini kit (Qiagen, Hilden, Germany), SYBR Green qPCR Master Mix (Applied Biosystems, Grand Island, NY, USA), cDNA Reverse Transcription kit (Applied Biosystems, Grand Island, NY, USA), anti-human CD68 (clone PG-M1), secondary detection system EnVision G|2 System/AP-Rabbit/Mouse (Permanent Red), EnVision FLEX Target Retrieval Solution (Dako, Glostrup, Denmark), and CD163 kit (RayBiotech, Norcross, GA, USA). All reagents, instruments and analysing software for droplet digital PCR were from Bio-Rad Laboratories (Hercules, CA, USA).

Study population

Patients clinically diagnosed with PKDL (n = 25) were recruited either from the Dermatology outpatient departments of School of Tropical Medicine/Calcutta Medical College/Institute of PG Medical Education & Research, Kolkata, West Bengal or from active field surveys conducted in endemic districts of West Bengal (Malda, Dakshin Dinajpur, Murshidabad and Birbhum) by a camp approach, wherein a door-to-door survey was conducted by Kala-azar Technical Supervisors using standard case definitions and defined risk factors e.g. living in an endemic area and having an epidemiological link (past history of VL) as also a rK39 strip test positivity [12]. These suspected cases were examined at medical camps; cases with hypopigmented macules were considered as macular PKDL, whereas an assortment of papules, nodules, macules, and/or plaques were considered as polymorphic [13, 14]; diagnosis was confirmed by ITS-1 PCR from skin biopsies [15]. Skin biopsies from healthy individuals (n = 3) undergoing voluntary circumcision were taken for the ddPCR based work; for other experiments, age and sex-matched healthy volunteers (n = 24) were recruited from endemic and non-endemic areas and were seronegative for anti-leishmanial antibodies as tested by ELISA. None suffered from any co-infection or pre-existing disease.

Measurement of parasite load by real time PCR

For measurement of parasite load, a standard curve was generated by adding a defined number of L. donovani parasites (MHOM/IN/1983/AG83) ranging from 10 to 1 X 105 to blood (180 μl) from a healthy control [15]. Real-time PCR was performed using specific primers for mini-circle kDNA (116 bp, forward 5’-CCTATTTTACACCAACCCCCAGT-3’and reverse 5’GGGTAGGGGCGTTCTGCGAAA-3’ [16]. DNA (1 μl) was added to a 19 μl reaction mixture containing SYBR Green Master mix and 400 nM of each primer. Negative controls used were DNA from a healthy donor (no amplification), and a reaction mixture with water instead of template DNA (No template control, NTC). The number of parasites was extrapolated from the standard curve and final parasite load stated as the number/μg of genomic DNA. The parasite number when <10 reported a Ct value equivalent to NTC and was accorded an arbitrary value of 1 [16].

Measurement of plasma iron and sCD163

Plasma iron levels were measured using commercially available kits as per the manufacturer’s instructions (Crest Biosystem, Goa, India). Briefly, plasma (200 μl) was treated with an acidic buffer to allow iron bound to Transferrin to be released, along with reduction of Fe3+ to Fe2+, which upon reaction with Ferrozine formed a violet coloured complex, and absorbances were measured at 570 nm using Spectramax M2e (Molecular devices, Sunnyvale, CA, USA). The concentration of iron in plasma was calculated against a supplied standard (100 μg/dl). Soluble CD163 was measured by ELISA; briefly, to anti-human CD163 coated 96-well plates, standards and samples (100 μl) were incubated at room temperature for 2.5 h. After 3 washes, biotinylated antihuman CD163 antibody (100 μl) was added for 1 h and using HRP-conjugated streptavidin (100 μl), binding was detected using TMB and absorbances measured at 450 nm; the concentration of sCD163 was calculated against a standard curve (0–8000 pg/ml).

Immunophenotyping of peripheral blood monocytes

Peripheral blood was layered over a monocyte isolation medium (3:1; HiSep 1073, Himedia, Mumbai, India), and centrifuged (400g for 30 minutes). The monocyte rich interface, after two washes in PBS, was resuspended in PBS and cell viability confirmed by trypan blue exclusion (>95%). Whole blood (100 μl) stained with anti-human CD14-Fluorescein isothiocyanate (FITC), transferrin receptor (CD71)-Allophycocyanin (APC), hemoglobin-haptoglobin receptor (CD163)-Phycoerythrin (PE) and hemopexin receptor (CD91)-PE was incubated for 20 minutes; erythrocytes were lysed with incubation in BD Fix-lyse lysing buffer for 10 minutes (2 ml), washed twice with PBS and finally resuspended in PBS (400 μl) for acquisition in a Flow Cytometer (BD FACSVerse). Monocytes were initially gated on their characteristic forward vs. side scatter, and quadrants set based on their fluorescence minus one (FMO) controls, after which on the basis of CD14 positivity 3000 cells were acquired per tube and analysed using BD FACS Suite software (BD Biosciences, San Jose, CA, USA). As the samples were obtained from field trips, there was a 24-48h lag period which adversely impacted on the cell morphology; accordingly, samples analyzed by Flow Cytometry were randomly selected, ensuring that at least 5–7 samples were analyzed per assay.

Determination of intramonocytic labile iron pool

Monocytes (5x105/ml) were centrifuged (400g X 5 minutes), resuspended in 500 μl PBS, and stained with Calcein acetoxymethyl ester (Calcein-AM, Molecular Probes, Carlsbad, CA, USA, 2.5 nM, 30 minutes, 37°C) [17], after which fluorescence was acquired on a flow cytometer. Cells were morphologically gated, and 2000 monocytes were acquired per tube and analysed using BD FACS Suite software.

Isolation of RNA and cDNA preparation

Total RNA from skin (4 mm punch biopsies) of patients with PKDL [n = 8; polymorphic (n = 4) and macular (n = 4)] or healthy individuals (n = 3, males undergoing voluntary circumcision) was isolated using the Trizol method and converted to cDNA using the cDNA Reverse Transcription Kit. Absolute quantification by droplet digital PCR was performed using gene specific primers for transferrin receptor (TfR1/CD71), haemoglobin/haptoglobin scavenging receptor (CD163), divalent metal transporter (DMT-1/NRAMP-2), Lipocalin-2 (Lcn-2), heme-oxygenase-1 (HO-1), ferritin-H, NRAMP-1, Ferroportin (Fpn1) and Interleukin-10 (IL-10) (. Primers were designed from the database of National center for Biotechnology Information (NCBI) and specificity confirmed.

Copy number analysis of the target genes using droplet digital PCR (ddPCR)

The cDNA from lesional or healthy skin (diluted with nuclease free water to a final concentration of 12.5 ng/μl) was used for ddPCR to quantify in terms of copy number. The reaction mixtures contained ddPCR EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA, USA), primers (6 μM) and template DNA (1 μl, 12.5 ng/μl) in 20 μl. Each reaction was then loaded into a sample well of an eight-well disposable cartridge (DG8), along with 70 μl of droplet generation oil. Droplets were formed using a QX200 droplet generator as per the manufacturer’s instructions which were then transferred to a 96-well PCR plate to perform PCR (95°C for 5 min, followed by 40 cycles of 94°C for 30s and 60°C for 1 min, with a final extension at 98°C for 10 min). The annealing temperature and cycle number were optimised for incremental separation between positive and negative partitions in ddPCR. The resultant products were scanned on a QX200 Droplet Reader, and data analysed using QuantaSoft software. Any value of copy number/μl above 0.5 was considered as 1 copy, and if below 0.5, was considered as non-detectable. Values were expressed as copy number/20 μl.

Detection of intracellular free ferric iron (Fe3+) in lesional sites by Prussian blue staining

Formalin fixed paraffin embedded (FFPE) tissue sections were deparaffinised in xylene and rehydrated using descending grades of alcohol (100–70%) and distilled water. The slides were then incubated with a working solution of equal volumes (1:1) of 5% HCl (aq) and 5% Potassium ferrocyanide [K4Fe(CN)6] at room temperature for 20 minutes. After three washes with water, slides were counterstained using Nuclear Fast Red for 5 minutes and observed under a light microscope (EVOS FL Cell Imaging System, Waltham, MA, USA). Immunohistochemical analysis was performed for identification of macrophages using anti-human CD68 [18].

Statistical analysis

Data was analyzed either by Mann-Whitney t test (in case of two groups) for non-parametric data and unpaired t test for parametric data using Graph Pad Prism software (version 5.0), p < 0.05 being significant. All data were expressed as median (Interquartile range or IQR) except the ddPCR data which was expressed as mean ± SEM (Standard Error of Mean). Correlation was by Pearson’s correlation for parametric data and Spearman’s rank correlation for non-parametric data, and the coefficient of correlation (r) when >0.4 was considered as relevant.

Ethics statement

The study received approval from the Institutional Ethics Committee of School of Tropical Medicine, Kolkata and Institute of Post Graduate Medical Education and Research, Kolkata. Written informed consent was obtained from all individuals, and for a minor (<18 years), their legally accepted representative provided the same.

Results

Patients with PKDL (n = 25; ) were randomly recruited by active or passive surveillance; the population included polymorphic (n = 10) and macular (n = 15) cases with a view to represent the present scenario of PKDL [12]. The rk39 test was positive in all cases while the presence of Leishman Donovan bodies was identified by Giemsa staining in all the polymorphic cases, but not in the macular variant. Additionally, the presence of parasites was confirmed by ITS-1 PCR [15]. Their hemoglobin levels and leukocyte counts were comparable with controls (). Amongst them, 21/25 patients (84%) gave a past history of VL and the median interval between VL and onset of PKDL was 5 years (. The parasite burden as quantified by qPCR was 5550 (1765–8891) parasites/μg of genomic DNA ( *values are given as median (IQR); NA = Not applicable

Increased entry of iron into circulating monocytes and lesional monocytes/macrophages in patients with PKDL

The entry of iron into monocytes/macrophages involves multiple ports of entry that include (a) the transferrin receptor TfR1 (CD71) that binds iron bound to ferritin and/or transferrin, (b) divalent metal transporter (DMT-1) for non-transferrin bound iron, or lipocalin-2 (Lcn-2) for siderophore bound iron that mediates transmembrane uptake of Fe2+, (c) CD163 via phagocytosis of the hemoglobin-haptoglobin (Hb-Hp) complexes and CD91 for hemopexin bound heme uptake [19]. The frequency of TfR (CD71) positive CD14+ monocytes was significantly raised by 2.42-fold vis a vis healthy controls, 16.46 (13.15–23.72) vs. 6.80 (5.31–7.84) %, p<0.001 (), but their frequency correlated poorly with the parasite load, r = 0.07.

Status of CD71, CD163 divalent metal transporter (DMT-1) and Lipocalin-2 in PKDL.

A: Representative profiles of the % of CD14+CD71+ circulating monocytes in a healthy control (i) and patient with PKDL (ii). Individual gates were set by using monocyte forward and side scatter characteristics and then with fluorochrome conjugated CD14-FITC. Scatter plots indicating frequency of CD71+ within CD14+ monocytes in healthy controls (n = 12, black filled circle) and patients with PKDL at presentation (n = 10, black filled square); each horizontal bar represents the median. B: Representative profiles of the % of CD14+CD163+ circulating monocytes in a healthy control (i) and patient with PKDL (ii) with individual gates being set using monocyte forward and side scatter characteristics followed by CD14-FITC. (iii) Scatter plots indicating frequency of CD163+ within CD14+ monocytes in healthy controls (n = 20, black filled circle) and patients with PKDL at presentation (n = 13, black filled square); each horizontal bar representing the median. C&D: One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene CD71 (C) and CD163 (D) at lesional sites. EvaGreen-bound positive droplets are shown in blue, while negative droplets are shown in black, along with bar graphs where data is expressed as mean ± SEM of the copy number/20 μl DNA. Bar graphs (open) denote healthy controls (n = 3) and filled bars represent patients with PKDL (n = 8). E&F: One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene DMT-1 (E) and lipocalin-2 (F) at lesional sites. EvaGreen-bound positive droplets are shown in blue while negative droplets are shown in black, along with bar graphs for data expressed as mean ± SEM of the copy number/20 μl DNA. Bar graphs (open) denote healthy controls (n = 3) while filled bars represent patients with PKDL (n = 8). CD163, the scavenger receptor for the haptoglobin-hemoglobin complex is expressed exclusively on monocytes/macrophages, and the frequency of CD14+163+ monocytes was significantly elevated by 6.74-fold in patients with PKDL as compared to healthy controls, 8.16 (5.59–9.61) vs. 1.21 (0.68–2.14) %, p<0.01 (), along with a significant 8.4 fold increase in the plasma levels of sCD163, 60154 (9519–77690) vs. 7046 (3094–13728) pg/ml. However, CD163 correlated poorly with parasite load, r = 0.15. Hemopexin (Hpx)-bound heme is scavenged by the CD91 receptor and the frequency of CD14+91+ monocytes remained unaltered in patients with PKDL as compared to healthy controls, 31.73 (29.85–33.62) vs. 30.87 (28.47–32.13)% () As PKDL is a dermal disease, the mRNA expression of TfR1 and CD163 were examined at the lesional sites in terms of copy number/20 μl in 4 polymorphic and 4 macular PKDL patients. In healthy controls, the mRNA expression of TfR1 was undetectable, whereas in PKDL cases there was a substantial increase, being 8.43 ± 0.99 copies/20 μl ( Similarly, in case of CD163, a 4.07-fold higher copy number was detected in PKDL vs. healthy controls, 10.00 ± 1.63 vs. 2.46 ± 1.25 copies/20 μl, p<0.05, ( The mRNA expression of CD163 correlated positively with parasite load, r = 0.58, but that was not so with TfR1, r = 0.14. Another portal of entry for non-transferrin bound iron and Fe2+ from endosomes is via the divalent metal transporter-1 (DMT-1/NRAMP-2). At the lesional sites, the mRNA expression of DMT-1 was elevated, being 14.00 ± 3.24 copies/20 μl, whereas it was undetected in healthy controls (. Another approach for iron acquisition is via lipocalin-2 (Lcn-2) whose mRNA expression was increased by 7.29-fold as endorsed by absolute quantification in PKDL lesions being 12.17 ± 3.72 vs. 1.67 ± 0.07 copies/20 μl, p<0.05 (. However, both DMT-1 and Lcn-2 showed no correlation with parasite load, r = 0.22 and 0.11 respectively.

Status of intracellular labile iron pool (LIP), iron recycling and storage in PKDL

In PKDL, as the circulating monocytes and dermal macrophages are alternatively activated [20], the labile iron pool could be raised. This was substantiated in PKDL (n = 8, polymorphic:macular = 1:1) by measuring the intra-monocytic labile iron pool (LIP) using Calcein-AM whose fluorescence is quenched by Fe2+; accordingly, the fluorescence of Calcein is inversely proportional to the intracellular iron content [17]. The LIP was enhanced in patients with PKDL as compared to healthy controls, the fluorescence expressed as geometric mean fluorescence channel (GMFC) being 2.15-fold lower, 3378 (3039–4391) vs. 7259 (6741–8232), p<0.001 (); the LIP correlated positively with parasite load, r = 0.53. In PKDL as compared to healthy controls, the plasma iron levels were significantly lowered by 3.87-fold, being 52.30 (27.05–102.90) vs. 202.40 (146.20–265.70) μg/dl, p<0.001 and negatively correlated with the parasite load, r = -0.83, p<0.05. However, in contrast to VL, the hemoglobin (Hb) levels of patients with PKDL was comparable with healthy controls 13.20 (11.60–14.20) vs. 13.23 (11.54–14.00) g/dl.

Status of intramonocytic labile iron pool and heme-oxygenase-1 in PKDL.

A: Representative histogram profile of GMFC of calcein in circulating monocytes from a healthy control (solid line) and patient with PKDL (dotted line). Scatter plot for GMFC fluorescence of calcein representing the intracellular labile iron pool in circulating monocytes from healthy controls (n = 15, black filled circle) and patients with PKDL (n = 8, black filled square). Each horizontal bar represents the median. B-D: One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene HO-1 (B), Ferritin (C) and IL-10 (D) in lesional sites. EvaGreen-bound positive droplets are shown in blue while negative droplets are shown in black, along with bar graphs for data expressed as mean ± SEM of the copy number/20 μl DNA. Bar graphs (open) denote healthy controls (n = 3) while filled bars represent patients with PKDL (n = 7). In response to CD163-mediated heme uptake and possible iron overloading secondary to the enhanced presence of IL-10 [21], monocytes/macrophages counteract the pro-oxidant milieu via enhancement of the inducible heme-oxygenase-1(HO-1), which is downstream of CD163 [22]. This was endorsed at the lesional sites, wherein the mRNA expression of HO-1 was raised, 31.72 ± 13.12 copies/20 μl, whereas it was not detectable in healthy controls (), and positively correlated with parasite load, r = 0.83, p<0.05. A crucial role for mammalian oxygen sensing transcription factor hypoxia inducible factor-1α (HIF-1 α) has been established in innate immunity against intracellular pathogens and its expression was measured. However, there was no alteration in the mRNA expression of HIF-1α in patients with PKDL as compared to healthy controls 2.34 ± 0.88 vs. 2.47 ± 1.24 copies/20 μl (). Iron storage at the dermal sites was also examined in terms of the mRNA expression of the ferritin heavy chain, wherein healthy controls showed no detectable expression, but in PKDL cases, there was a substantial elevation being 9.70 ± 2.07 copies/20 μl (, and significantly correlated with parasite load r = 0.75, p<0.05. This was accompanied by a significant 16.44-fold increase in the IL-10 copy number, 80.57 ± 19.71 vs. 4.90 ± 2.75 copies /20 μl, p<0.05 (. CD163 and HO-1 positively correlated with IL-10, r = 0.42 and 0.64 respectively.

Increased mRNA expression of iron exporters at the dermal sites in patients with PKDL

The natural resistance macrophage protein1 (NRAMP-1or Slc11a1) has been characterized as a late phagosomal protein that exports iron from phagosomes to the cytoplasm, followed by iron being subsequently exported through ferroportin present on the cell membrane. In PKDL, the lesional mRNA expression of NRAMP-1 was significantly enhanced by 5.67-fold as compared to healthy controls, 29.07 ± 5.85 vs. 5.13 ± 1.43 copies/20 μl, p<0.05, (Fig 3A), but correlated marginally with the parasite load, r = 0.39. At the lesional sites, the mRNA expression of ferroportin significantly increased by 4.95-fold in PKDL, 21.29 ± 2.17 vs. 4.30 ± 0.10 copies/20 μl, p<0.05 (Fig 3B), and positively correlated with the parasite load, r = 0.86, p<0.05. Despite the substantial infiltration of CD68+ macrophages in the lesional sites, staining for Prussian blue which represents the proportion of Fe3+, was negative (.
Fig 3

mRNA expression of NRAMP-1 and Ferroportin in dermal lesions of PKDL.

A&B: One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene NRAMP-1 (A) and Ferroportin (B) in lesional sites. EvaGreen-bound positive droplets are shown in blue while negative droplets are shown in black, along with bar graphs for data expressed as mean ± SEM of the copy number/20 μl DNA in lesional sites. Bar graphs (open) denote healthy controls (n = 3) while filled bars represent patients with PKDL (n = 8 for NRAMP-1 and n = 7 for Ferroportin).

mRNA expression of NRAMP-1 and Ferroportin in dermal lesions of PKDL.

A&B: One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene NRAMP-1 (A) and Ferroportin (B) in lesional sites. EvaGreen-bound positive droplets are shown in blue while negative droplets are shown in black, along with bar graphs for data expressed as mean ± SEM of the copy number/20 μl DNA in lesional sites. Bar graphs (open) denote healthy controls (n = 3) while filled bars represent patients with PKDL (n = 8 for NRAMP-1 and n = 7 for Ferroportin).

Discussion

The acquisition of iron by intracellular pathogens like Leishmania parasites is analogous to a double edged sword, as iron is essential for their cellular metabolic processes and pathogenicity [5], being a component of several iron-dependent proteins [e.g. iron superoxide dismutase (FeSOD), ascorbate peroxidase, cytochrome b5 (CytB5) and cytochrome p450 (CYP)] that participate in detoxification of reactive oxygen species [23-25]. Additionally, as iron is a component of ribonucleotide reductase and iron clusters present in the mitochondrial respiratory chain, it is critical for DNA synthesis and energy metabolism respectively [26]. However, this very property of electron transfer makes iron potentially dangerous via its participation in oxidation/reduction reactions, where by donating electrons to O2 and H2O2, it can generate toxic molecules like superoxide anion and hydroxyl radicals [27]. Accordingly, for Leishmania to survive and replicate within a hostile iron limiting parasitophorous vacuole (PV), the cellular uptake, distribution, storage and export of iron is a tightly regulated process [6]. The delivery of iron to cells is accomplished by multiple approaches that include its complexation with transferrin (Tf), a monomeric plasma iron-binding protein, which upon binding to cell-surface receptors (transferrin receptor or TfR1) facilitates the entry of iron via endocytosis [28]. However, as the Fe3+ released from transferrin is essentially insoluble at physiological pH, it is reduced to Fe2+ within endosomes by ferric reductase (STEAP3), and eventually contributes towards the labile iron pool (LIP) [28]. In the peripheral blood of patients with PKDL, the uptake of iron was supported by an increased frequency of CD71/TfR1 ( and was corroborated by its enhanced mRNA expression at lesional sites ( Leishmania upon scavenging iron from LIP causes activation of iron-sensing proteins, and the resultant enhanced interaction of Iron Responsive Elements (IREs) with TfR1 translates into an increased uptake of iron [29]. Additionally, as patients with PKDL demonstrate a mixed Th1-Th2 cytokine milieu with a tilt towards Th2, the increased levels of IL4 and IL-10 [30] too can facilitate an increased mRNA expression of TfR1 [31]. However, this did not occur in patients with VL, as a decreased expression of TfR1 was reported [31]. Similarly, studies regarding Legionella also reported decreased levels of TfR1 in activated macrophages which were attributed to the IFN-γ mediated pro-inflammatory environment [32]. Another intracellular pathogen that enhances its iron pool via increased entry through TfR1 is Francisella tularensis [33], whereas Salmonella typhimurium, Legionella pneumophila and Neisseria spp sequester iron as transferrin via siderophores [34]. While the presence of iron in endosomal membranes is associated with entry via transferrin, the uptake of non-transferrin bound iron is mediated by the membrane bound divalent metal transporter 1 (DMT1), also known as NRAMP-2 or solute carrier family 11 member 2, SLC11A2 [35]. NRAMP-2 is a symporter of H+ and metal ions, and under physiological conditions is localized in the early endosomal membranes where it is responsible for delivery of extracellularly acquired bivalent cations into the cytosol [36]. Intracellular organisms like Francisella tularensis upregulate DMT-1 expression [37] and similarly, at lesional sites of PKDL cases, the increased mRNA expression of DMT-1 endorsed its possible utilization by parasites to enhance influx of iron (). However, in VL, an unaltered expression of DMT-1 was observed, and could be attributed to it being an acute disease vis-a-vis the chronicity of PKDL [31]. To counteract siderophore mediated iron acquisition by pathogens, host monocytes infected with Mycobacterium tuberculosis produce Siderocalin, or lipocalin 2 (Lcn-2), and this translated into attenuation of infection [38, 39]. Although evidence regarding the role of siderophores and/or siderophore receptors in acquisition of iron by Leishmania is limited, in PKDL, an increased lesional mRNA expression of lcn-2 was demonstrated (), attributable to a possible pleiotropic effect of cytokines. In-vivo studies have shown that following LPS administration to neutrophils and macrophages, the resultant activation of the toll-like receptor (TLR)-4 leads to increased secretion of Lcn-2. Additionally, induction of Lcn2 can be triggered by other TLR ligands and cytokines, including IL-1β, IL-6, IL-10, IL-17, IL-22, and TNF-α [40]. Accordingly, it may be proposed that in PKDL cases, the increased expression of Lcn-2 may be attributed to the increased lesional mRNA expression of IL-10 ( along with raised circulating levels of pro- (TNF-α, IL-6, IL-1β and IL-8) and anti-inflammatory (IL-4, IL-10, IL-13 and TGF-β) cytokines, the latter being signature molecules of M2 polarization [20, 30]. The SLC39/ZIP family transporters are a new class of iron-trafficking proteins containing 14 members which includes ZIP8 and ZIP14 that transport non-transferrin bound iron above pH 7 and near physiological pH, whereas DMT-1 is most efficient at pH 5.5, which corresponds to the pH of acidified endosomes [41]. Therefore, the impact of these newer transporters on Leishmania-macrophage interaction should be explored and may well explain some of the apparent paradoxes observed. Besides TfR1, macrophages express the hemopexin receptor (CD91), which takes up heme bound to the heme-sequestering protein hemopexin [42]. However, in peripheral blood of PKDL cases, the frequency of CD91 remained unaltered. A similar function is attributed to CD163, another entry point for iron through which heme bound iron is scavenged in the form of hemoglobin bound to haptoglobin [42]. CD163 is considered as a hallmark of alternatively activated M2 macrophages, a phenotype that sustains the disease chronicity in PKDL [20, 43]. In peripheral blood, the enhanced frequency of circulatory CD163 ( was endorsed by its increased mRNA expression at lesional sites (). This enhanced uptake of heme-bound iron can induce hemeoxygenase-1 (HO-1), an enzyme responsible for degrading heme to biliverdin, carbon monoxide and Fe2+, as also mediate attenuation of the immunopathology caused by oxidative stress [44]. During Leishmania infection, the host tightly regulates the soluble Fe2+ by deploying multiple options that includes (i) incorporation into the LIP, (ii) storage as ferritin, (iii) export via ferroportin [Fpn, 45] and/or (iv) entry into the phagolysosome. The increased mRNA expression of HO-1 has been implicated in the pathogenesis of several infectious diseases, as its activation following heme degradation translates into decreased formation of the heme containing NADPH-oxidase complex. This leads to an attenuated generation of reactive oxygen species (ROS) and provides for a pro-parasitic environment [46]. Indeed, the replication of Leishmania chagasi was favoured by induction of HO-1, as it dampened leishmanicidal mechanisms such as generation of nitric oxide and ROS [47]. Furthermore, in PKDL the HO-1 catalyzed generation of CO, can lead to decreased generation of superoxide, and along with an increased availability of reduced glutathione, facilitate creation of an anti-oxidant, pro-parasitic milieu [20, 48]. In PKDL cases, the lesional mRNA expression of HO-1 was substantially elevated () and correlated positively with the parasite load. Another factor that enhances HO-1 activation is IL-10 [49] whose upregulation () represents an additional subversive mechanism adopted by Leishmania to escape the oxidative burst, and therefore its manipulation could well be considered as a therapeutic target. Intracellular pathogens can access the LIP, the metabolically active fraction of cytosolic iron that is loosely bound to low molecular-weight chelators and represents the free cytoplasmic iron pool [19, 50]. As LIP is the transition zone between import, cellular utilization and storage, it responds to the cell’s metabolic needs. During infection with Francisella tularensis, there is an active Fe2+ acquisition system associated with a sustained increase in the LIP [51]. Similarly, erythrocytes infected with Plasmodium falciparum demonstrated an increased LIP that was associated with parasite maturation [52]. Similarly, in PKDL, the increased LIP, ( via its ability to inhibit binding of the transcription repressor Bach1 to specific sequences in the HO-1 promoter, could potentially increase the expression of HO-1 and enhance parasite survival [53]. Although the calcein-AM (calcein-acetoxymethyl ester) method is a widely used technique to measure the LIP, it can only measure the cytoplasmic LIP, as it cannot enter cellular compartments. Therefore, the changes, if any, in the low-mass iron present in the phagolysosomal compartment will get overlooked. This is particularly relevant in Leishmaniasis as amastigotes reside within the phagolysosome, whereas this compartment, owing to its low pH, cannot be accessed by Calcein. Therefore, there could well be an under representation of the iron present within the amastigotes [54]. As an excess of free Fe2+, secondary to its enhanced entry (), can be potentially hazardous owing to its ability to support the generation of free radicals, an increased LIP is generally associated with an upregulation of Ferritin-H, which along with Ferritin-L subunits, forms a multimeric protein complex and stores Fe2+ [55]. This was possibly adopted by PKDL cases as evident by the upregulation of lesional ferritin ( although it was not in concordance with the classical ferritinlow phenotype associated with alternatively activated M2 polarized macrophages [22]. The replication of Leishmania within acidified, hydrolase-rich microbicidal phagolysosomes requires iron and their Fe2+ acquisition strategies includes ferric reductase (LFR1), which by converting Ferritin bound Fe3+ to Fe2+ facilitated the entry of L. amazonensis amastigotes via the Leishmania Fe2+ transporter 1(LIT-1) [50]. Alongside, macrophages express a metal transporter NRAMP-1 that functions as a pH dependent divalent cation efflux pump whose crucial role is modulating the access of pathogens to iron as substantiated by studies in NRAMP -/- animals [2]. It is a highly pH dependent antiporter that fluxes metal ions in either direction against a proton gradient. Furthermore, as NRAMP-1 is localized in late endosomal/ lysosomal membranes, it delivers bivalent cations from the cytosol into this acidic compartment and therefore can influence antimicrobial activity [36]. Accordingly, the increased transcriptional expression of NRAMP-1 in PKDL (Fig 3A) could be attributed to the subtle iron homeostasis achieved by parasites within phagolysosomes. Ferroportin (Fpn) is an established mammalian iron exporter whose regulation is critical for iron homeostasis, and its alterations can translate into iron deficiency or iron overload. It has been proposed that to increase the availability of iron, host cell derived hepcidin promotes the degradation of Fpn which translates into increased availability of iron during infections with L. amazonensis [56, 57], and has been substantiated in patients with VL [31]. However, in L. donovani models of infection where despite the levels of Hepcidin being raised, the mRNA expression of Fpn too was elevated [57]. Similarly, in PKDL cases an increased mRNA expression of Fpn was demonstrated (Fig 3B); however it should be confirmed at a translational level. Similarly, in intracellular pathogens, Salmonella and Mycobacterium, an enhanced expression of Fpn has been reported, that could be attributed to either the host and/or the pathogen regulating the export of iron to limit its availability to the installed pathogen [58-60]. Taken together, this study has established that monocytes/macrophages sourced from patients with PKDL have several ports of entry that includes TfR1, DMT-1 and lipocalin-2 (Fig 4). Additionally, there is an increased uptake of heme bound iron by CD163. This results in an increased availability of HO-1, which in turn increased the presence of Fe2+ resulting in an enhancement of the intramonocytic labile iron pool and ferritin, thus providing the pathogen with an adequate source of iron, which can be sequestered as necessary into phagolysosomes by LIT-1 (Fig 4). However, in view of iron being likened to a ‘double edged sword’, it is necessary to prevent iron mediated toxicity, and therefore host macrophages ensure this via an adequate efflux of iron through the phagolysosomal exporter NRAMP-1 and the cellular exporter Fpn (Fig 4). Collectively, to eliminate an intracellular pathogen like Leishmania, iron deprivation is necessary and is potentially achievable by either restricting the availability of iron i.e. nutritional immunity, or by dampening the microbial iron transporters, and both approachescould serve as novel therapeutic interventions.
Fig 4

Iron trafficking in Leishmania infected monocytes/macrophages.

Following the phagocytosis of senescent erythrocytes (erythophagocytosis), the heme-bound iron is released and recycled to the labile iron pool. Other alternatives for uptake of iron include Transferrin-bound iron that is internalized through the transferrin receptor (CD71, TfR1), non-transferrin bound iron (NTBI) is taken up through the divalent metal transporter-1 (DMT-1), and hemoglobin-bound heme through CD163. Following metabolism of heme by hemeoxygenase-1 (HO-1), there is generation of carbon monoxide (CO), bilirubin and free iron, the latter being stored as ferritin or is added to the labile iron pool, and/or can be exported via ferroportin. Leishmania amastigotes can augment the iron-poor environment of the parasitophorous vacuole (PV) via Leishmania ferric reductase-1 (LFR1) which converts Fe3+ to Fe2+, which is then translocated across the membrane by Leishmania Fe2+ iron transporter (LIT1). Additionally, monocytes-macrophages strive to limit the availability of iron to intracellular pathogens by enhancing its removal from the parasitophorous vacuole (PV) to the cytoplasm via natural resistance-associated macrophage protein (NRAMP-1), which is further exported through ferroportin.

Iron trafficking in Leishmania infected monocytes/macrophages.

Following the phagocytosis of senescent erythrocytes (erythophagocytosis), the heme-bound iron is released and recycled to the labile iron pool. Other alternatives for uptake of iron include Transferrin-bound iron that is internalized through the transferrin receptor (CD71, TfR1), non-transferrin bound iron (NTBI) is taken up through the divalent metal transporter-1 (DMT-1), and hemoglobin-bound heme through CD163. Following metabolism of heme by hemeoxygenase-1 (HO-1), there is generation of carbon monoxide (CO), bilirubin and free iron, the latter being stored as ferritin or is added to the labile iron pool, and/or can be exported via ferroportin. Leishmania amastigotes can augment the iron-poor environment of the parasitophorous vacuole (PV) via Leishmania ferric reductase-1 (LFR1) which converts Fe3+ to Fe2+, which is then translocated across the membrane by Leishmania Fe2+ iron transporter (LIT1). Additionally, monocytes-macrophages strive to limit the availability of iron to intracellular pathogens by enhancing its removal from the parasitophorous vacuole (PV) to the cytoplasm via natural resistance-associated macrophage protein (NRAMP-1), which is further exported through ferroportin.

STROBE checklist.

(DOCX) Click here for additional data file.

Representative profiles of the % of CD14+CD91+ circulating monocytes in a healthy control (i) and patient with PKDL (ii).

Individual gates were set by using monocyte forward and side scatter characteristics and then with fluorochrome conjugated CD14-FITC; (iii) scatter plots indicating frequency of CD91+ within CD14+ monocytes in healthy controls (n = 6, black filled circle) and patients with PKDL at presentation (n = 5, black filled square);each horizontal bar represents the median. (TIF) Click here for additional data file.

One-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on y-axis) emitted from the gene HIF-1α in lesional sites.

EvaGreen-bound positive droplets are shown in blue while negative droplets are shown in black, along with bar graphs for data expressed as mean ± SEM of the copy number/20 μl DNA Bar graphs (open) denote healthy controls (n = 2) while filled bars represent patients with PKDL (n = 8). (TIF) Click here for additional data file.

Status of intracellular free Fe3+ in lesional biopsies.

A&B: Representative H&E profiles from dermal biopsies of a healthy control and patient with PKDL (magnification 10X).C&D: Representative immunohistochemical profiles of CD68+ macrophages from dermal biopsies from a healthy control and patient with PKDL (magnification 10X). E&F: Representative Prussian blue stained profiles from dermal biopsies of a healthy control and patient with PKDL (magnification 10X) showing absence of free ferric ion. G&H: Positive control (Hemochromatosis liver section; magnification 10X and 40X). (TIF) Click here for additional data file. 15 Sep 2019 Dear Prof. Chatterjee: Thank you very much for submitting your manuscript "Iron trafficking in patients with Indian Post kala-azar dermal leishmaniasis" (PNTD-D-19-01246) for review by PLOS Neglected Tropical Diseases. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved. We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In addition, when you are ready to resubmit, please be prepared to provide the following: (1) A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. (2) Two versions of the manuscript: one with either highlights or tracked changes denoting where the text has been changed (uploaded as a "Revised Article with Changes Highlighted" file ); the other a clean version (uploaded as the article file). (3) If available, a striking still image (a new image if one is available or an existing one from within your manuscript). If your manuscript is accepted for publication, this image may be featured on our website. Images should ideally be high resolution, eye-catching, single panel images; where one is available, please use 'add file' at the time of resubmission and select 'striking image' as the file type. Please provide a short caption, including credits, uploaded as a separate "Other" file. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License at http://journals.plos.org/plosntds/s/content-license (NOTE: we cannot publish copyrighted images). (4) Appropriate Figure Files Please remove all name and figure # text from your figure files upon submitting your revision. Please also take this time to check that your figures are of high resolution, which will improve both the editorial review process and help expedite your manuscript's publication should it be accepted. Please note that figures must have been originally created at 300dpi or higher. Do not manually increase the resolution of your files. For instructions on how to properly obtain high quality images, please review our Figure Guidelines, with examples at: http://journals.plos.org/plosntds/s/figures While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We hope to receive your revised manuscript by Nov 14 2019 11:59PM. If you anticipate any delay in its return, we ask that you let us know the expected resubmission date by replying to this email. To submit your revised files, please log in to https://www.editorialmanager.com/pntd/ If you have any questions or concerns while you make these revisions, please let us know. Sincerely, Syamal Roy Guest Editor PLOS Neglected Tropical Diseases Brian Weiss Deputy Editor PLOS Neglected Tropical Diseases *********************** The authors should address the concerns raised by the reviewes. It is an important piece of contribution. The authors have claimed that iron metabolism alone is a major mechanism of parasite adaptation. I think they should tone down such a conclusion. Reviewer's Responses to Questions Key Review Criteria Required for Acceptance? As you describe the new analyses required for acceptance, please consider the following: Methods -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? -Is the study design appropriate to address the stated objectives? -Is the population clearly described and appropriate for the hypothesis being tested? -Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? -Were correct statistical analysis used to support conclusions? -Are there concerns about ethical or regulatory requirements being met? Reviewer #1: Major revision Reviewer #2: There is no additional experiments to be done. The data are robust and aligned with the study objective. One aspect on statistics that deserves better explanation are concerned with the threshold to define significan and non significan correlation between parasite load and expressed biomarkers. Reviewer #3: Are the objectives of the study clearly articulated with a clear testable hypothesis? Yes Is the study design appropriate to meet the stated objectives? Is correct Is the population clearly described and appropriate for the hypothesis being tested? Yes Is the sample size sufficient to ensure adequate energy to deal with the hypothesis being tested? Yes - Was the correct statistical analysis used to support the conclusions? It's correct Are there concerns about ethical or regulatory requirements being met? No worries, the work was submitted to the ethics committee. I suggest placing reference on the primers used. -------------------- Results -Does the analysis presented match the analysis plan? -Are the results clearly and completely presented? -Are the figures (Tables, Images) of sufficient quality for clarity? Reviewer #1: (No Response) Reviewer #2: Quality presentation of figures need to be improved, not in terms of scientific meaning but like art graphs. Reviewer #3: Does the analysis presented match the analysis plan? Yes -Are the results clearly and completely presented? Yes -Are the figures (Tables, Images) of sufficient quality for clarity? The figures are not clear, need to improve the quality. -------------------- Conclusions -Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? -Is public health relevance addressed? Reviewer #1: (No Response) Reviewer #2: This work contributes to PKDL understanding which is a positive and wellcomed contribution. The conclusions are supported by presented data but there are other possible interpretations that cannot be discarded. The literature related to the study subject permits a more critical discussion and the authors should point out the inherent limitations. This will not decrease the value of the research work but will expose the methodological limitations imposed by the current technology. Reviewer #3: Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? Yes -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? Yes -Is public health relevance addressed? Yes -------------------- Editorial and Data Presentation Modifications? Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”. Reviewer #1: (No Response) Reviewer #2: As it is mentioned in the Summary and general comments, the writing requires to be re-structured because some aspects of the parasite iron regulation are put at the same relevance category than the host. This work is focused on the host ant parasite participation must be quoted to stress their effect on iron host regulation. Reviewer #3: (No Response) -------------------- Summary and General Comments Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed. Reviewer #1: (No Response) Reviewer #2: The PNTD-D-19-01246 entitled “Iron trafficking in patients with Indian Post kala-azar dermal leishmaniasis” analyzed different macrophage biomarkers involved in iron homeostasis that may play a role in host-parasite interactions. The manuscript (MS) results are addressed to fill a major gap of knowledge on those mechanisms that Leishmania intracellular amastigotes have to survive within host macrophages. The main author´s claim is that iron influx gateways are overexpressed and as consequence iron will be available to intracellular amastigotes and therefore they will promote Leishmania infection persistence. On the other hand, iron macrophage exporters NRAMP-1 and ferroportin mRNA, although overexpressed, would not be enough to impair Leishmania survival. The research carried out is original because there are no reports on this subject and it is a key topic to understand Leishmania intracellular survival and evading host defense mechanisms occurring in PKDL patients. Moreover, if you search for similar topic for the classic visceral leishmaniasis there are scarce number of similar approaches. MS reported differences on iron homeostasis between PKDL patients and healthy volunteers are of such magnitude that authors´ main conclusions provides robust experimental support to propose iron metabolism as a major topic for parasite adaptation. Nevertheless, there are MS structure and specific aspects that must be addressed by MS authors: MS structure: The Discussion is the MS section that demands more attention to ensure fluid reading. For example, at second paragraph where the authors start to discuss the iron entry to macrophages (line 322 to 336), dealing with observed TfR1 increase expression in PKDL patients, this is perturbed by referring the parasite iron acquisition pathways, like the ferrous iron transporter LIT-1 that scavenges iron from the labile iron pool (LIP) (LIT-1 was not mentioned by its name but quoted in reference 31). This paragraph should be only centered in TfR1, even more because the authors have identified a clear difference between PKDL and TfR1 reported observation for VL (quoted in ref 32). If they want to mention parasite iron acquisition it should be like a possible explanation to observed macrophage TfR1 increase. The MS is not on parasite iron incorporation but on iron homeostasis perturbation in PKDL patients. The authors should extend further the comparison with VL and other diseases caused by intracellular pathogens. Here, I would translate the paragraph on Ferroportin (Fpn) (lines 390 to 395), where Fpn is upregulated in PKDL (based upon mRNA levels) whereas in VL is downregulated via Ferroportin degradation. The third paragraph, where the increase of DMT-1 and lipocalin 2 are mentioned, there is no discussion that contributes to either define apparent contradictions or to explain them. If lipocalin 2 is increased in Mycobacterium infected cells to counteract bacterial siderophores, as mentioned by authors, nothing is mentioned to the fact that there are no siderophores described for Leishmania. If this lipocalin 2 increase has another possible explanation I would have discussed other factors, for example IL-10 that was also found upregulated in PKDL patients. This apparent paradox is much more interesting because there is an interesting concept where extracellular pathogens (at least for bacteria) evokes iron sequestration by macrophages whereas intracellular ones go in opposite direction, i.e. invaded host cells exports iron to limit its availability to installed pathogens (Gan Z. et al. Metallomics, 2019. 11: 454- 461). Again, the indirect effects of other factors like cytokines or HO-1 related signals might be involved. The Figure texts are immersed within different parts of the main body text. This fact affects fluid reading. I would re-write paragraphs 404 to 407 to make explicit that the observed measurements may reflect the “double edged sword” mentioned by the MS authors at the beginning of discussion section. The authors should also mention that not all described transporters have been studied. See the review of Bogdan A.R. et al. Trends in Biochemical Sciences 2016. 41: 274 -286, where other transporters are mentioned and therefore some of the observed apparent paradoxes might be explained by their participation in Leishmania macrophage infection. I would expect to discuss the role of pH on transporter or iron binding molecules. One good example of this is the work of Goswami T. et al. Biochem. J. (2001) 354, 511–519, where they demosntrate that Nramp2 is a H+/bivalent catión antiporter where the flow of ions depends on its localization an affected by the pH. Specific Comments The use of Calcein acetoxymethyl ester to measure labile iron pool (LIP) has limitations to measure non bound iron when present inside membrane compartments with acidic pH (Tenopoulo M. et al. Biochem. J. (2007) 403, 261–266; doi:10.1042/BJ20061840). Because amastigotes live within the phagolyzosome, a compartment that cannot be reached by Calcein and/or the acidic pH, it will cause an error when trying to interpret the iron impact on amastigotes. The measures iron should correspond to cytoplasmic iron and therefore without direct impact on amastigotes that are in another compartment. To mention enhanced entry of siderophore bound iron (lines 397 to 399) should be conciliated with the fact that Leishmania does not have reported siderophores. Perhaps a pleiotropic effect of cytokines would be an approach to this fact. The sentence comprised in lines 387 to 388 may have several interpretations according the readers. I suggest to re-write to understand what do the authors wants to express. It is incorrect to say in lane 78 that the role of iron in leishmaniasis was derived from in vitro models. There are in vivo models and also indirect results working with patients where iron metabolism has been addressed. The Figures requires a better art graph but more important is to review if they are properly presented. For example in Figure 1 A, i) and ii) each of them has a different gateway that alters the values at such extent that comparison conditions are not adequate. In contrast Figure 1 B is correct. Like this, there are minor but important revision an corrections to be made. Another example is in lane 214 to lane 216 wehere the ratio does not correspond to the quoted values but in contrast lanse 218 to 220 lead to a ratio with the expected value. Reviewer #3: (No Response) -------------------- PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: Yes: Manoel Sebastião da Costa Lima Junior Submitted filename: review.docx Click here for additional data file. 12 Dec 2019 Dear Prof. Chatterjee, We are pleased to inform you that your manuscript, "Iron trafficking in patients with Indian Post kala-azar dermal leishmaniasis", has been editorially accepted for publication at PLOS Neglected Tropical Diseases. Before your manuscript can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please note: your manuscript will not be scheduled for publication until you have made the required changes. IMPORTANT NOTES * Copyediting and Author Proofs: To ensure prompt publication, your manuscript will NOT be subject to detailed copyediting and you will NOT receive a typeset proof for review. The corresponding author will have one final opportunity to correct any errors when sent the requests mentioned above. Please review this version of your manuscript for any errors. * If you or your institution will be preparing press materials for this manuscript, please inform our press team in advance at plosntds@plos.org. If you need to know your paper's publication date for media purposes, you must coordinate with our press team, and your manuscript will remain under a strict press embargo until the publication date and time. PLOS NTDs may choose to issue a press release for your article. If there is anything that the journal should know, please get in touch. *Now that your manuscript has been provisionally accepted, please log into EM and update your profile. Go to http://www.editorialmanager.com/pntd, log in, and click on the "Update My Information" link at the top of the page. Please update your user information to ensure an efficient production and billing process. *Note to LaTeX users only - Our staff will ask you to upload a TEX file in addition to the PDF before the paper can be sent to typesetting, so please carefully review our Latex Guidelines [http://www.plosntds.org/static/latexGuidelines.action] in the meantime. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Syamal Roy Guest Editor PLOS Neglected Tropical Diseases Brian Weiss Deputy Editor PLOS Neglected Tropical Diseases *********************************************************** Reviewer's Responses to Questions Key Review Criteria Required for Acceptance? As you describe the new analyses required for acceptance, please consider the following: Methods -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? -Is the study design appropriate to address the stated objectives? -Is the population clearly described and appropriate for the hypothesis being tested? -Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? -Were correct statistical analysis used to support conclusions? -Are there concerns about ethical or regulatory requirements being met? Reviewer #1: (No Response) Reviewer #2: Accepted. The statistical analysis specification on the threshold to define correlation between parasite load and expressed biomarkers were incorporated as it was requested. Reviewer #3: Are the objectives of the study clearly articulated with a clear testable hypothesis? Yes Is the study design appropriate to meet the stated objectives? Yes Is the population clearly described and appropriate for the hypothesis being tested? Yes Is the sample size sufficient to ensure adequate energy to deal with the hypothesis being tested? No, statistically there should be 30 people analyzed - Was the correct statistical analysis used to support the conclusions? Correct Are there concerns about ethical or regulatory requirements being met? No problems ********** Results -Does the analysis presented match the analysis plan? -Are the results clearly and completely presented? -Are the figures (Tables, Images) of sufficient quality for clarity? Reviewer #1: (No Response) Reviewer #2: Accepted. Changes were made although the final quality of figures is an issue of the journal editors. Reviewer #3: Does the analysis presented correspond to the analysis plan? Yes Are the results presented clearly and completely? Yes Are the figures (tables, images) of sufficient quality for clarity? Yes ********** Conclusions -Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? -Is public health relevance addressed? Reviewer #1: (No Response) Reviewer #2: Accepted. Different questions about aspects mentioned in the original work were addressed the reading is straightforward. Reviewer #3: Are the conclusions supported by the data presented? Yes Are the limitations of the analysis clearly described? Not Do the authors discuss how this data can be helpful in improving our understanding of the topic under study? Yes Is the relevance of public health addressed? Yes, indirectly. ********** Editorial and Data Presentation Modifications? Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”. Reviewer #1: (No Response) Reviewer #2: Accept. Reviewer #3: Change the order of description in the material and methods, first describe the population and then enter the information of the enter the information about the antibodies. To extrapolate the conclusion of the results must be completed for 30 people for the statistical analysis to be more accurate. Parasitic load should be expressed in parasites / µL of blood. ********** Summary and General Comments Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed. Reviewer #1: (No Response) Reviewer #2: The MS is a significant and original contribution to the relationship between iron and parasite adaptation mechanism. Reviewer #3: The article has great potential, but needs less revision, landing is known about iron metabolism, and this work will be of great contribution. Minor corrections should improve it, especially in the discussion. Explain what represents the low expression CD91 ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 21 Jan 2020 Dear Prof. Chatterjee, We are delighted to inform you that your manuscript, "Iron trafficking in patients with Indian Post kala-azar dermal leishmaniasis," has been formally accepted for publication in PLOS Neglected Tropical Diseases. We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Serap Aksoy Editor-in-Chief PLOS Neglected Tropical Diseases Shaden Kamhawi Editor-in-Chief PLOS Neglected Tropical Diseases
Table 1

Primers and amplification conditions for RT-PCR (https://www.ncbi.nlm.nih.gov).

NameSequence (5’-3’)Annealing Temperature (oC)
TfR1 (F)CAGCAGAGACCAGCCCTTAG55.5
TfR1 (R)TGCCTTGTGTGTTGTTTTCGT
CD163 (F)ACCTCTTCAACAGACCCCCAGTGAA57.8
CD163 (R)GAGGACTGAGAGCTCTTCTGGCATT
DMT-1 (F)AGCCAGAGCCAGGTACTCAA57.8
DMT-1 (R)GTGCAATGCAGGATTCAATG
Lipocalin-2 (F)GGGAGAACCAAGGAGCTGAC56.5
Lipocalin-2 (R)AGCTCCCTCAATGGTGTTCG
HO-1 (F)TTCTCTCCCAACCCTGCTTGCGT57.8
HO-1 (R)AGGTGGGCAGACCAAGGTTCAA
HIF-1α (F)ACCTATGACCTGCTTGGTGC59
HIF-1α (R)GGCTGTGTCGACTGAGGAAA
Ferritin (F)AATCCAAGACAGCCACACCTT60
Ferritin (R)TTGGGAAAGCTGCCCACTAA
NRAMP-1 (F)AAACCCGGCCTGATTAAAGT57.8
NRAMP-1 (R)GCCTGACGGAAAGAAGTG
Ferroportin (F)CGAGATGGATGGGTCTCCTA55.5
Ferroportin (R)ACCACATTTTCGACGTAGCC
IL-10 (F)ACCCAGTCTGAGAACAGCTGC59.4
IL-`10 (R)GTTCACATGCGCCTTGATGTCT
Table 2

Study population.

CharacteristicsPatients with PKDL(n = 25)Healthy controls(n = 24)
Age (years)*29.00 (18.50–43.50)25.00 (7.70–29.50)
Sex ratio (M:F)2:31:1
Hb (g/dl)*13.20 (11.60–14.20)13.23 (11.54–14.00)
WBC (count/mm3)*4.65 (3.80–5.40)5.35 (4.12–6.09)
Lesion type(Macular: Polymorphic)3:2NA
Disease duration (years)*2.00 (0.60–5.50)NA
Interval between cure of VL and onset of PKDL (years)*5.00 (3.00–10.00)NA
ITS-1 PCR +ve25/25, 100%NA
Parasite load (number of parasites/μg of genomic DNA)*5550 (1765–8891)NA

*values are given as median (IQR); NA = Not applicable

  60 in total

1.  Miltefosine effectively modulates the cytokine milieu in Indian post kala-azar dermal leishmaniasis.

Authors:  Debanjan Mukhopadhyay; Nilay Kanti Das; Susmita Roy; Sunanda Kundu; J N Barbhuiya; Mitali Chatterjee
Journal:  J Infect Dis       Date:  2011-09-20       Impact factor: 5.226

2.  Hepcidin mediated iron homoeostasis as immune regulator in visceral leishmaniasis patients.

Authors:  Bhawana Singh; Siddharth Sankar Singh; Shyam Sundar
Journal:  Parasite Immunol       Date:  2018-12-03       Impact factor: 2.280

3.  Decreased presence of Langerhans cells is a critical determinant for Indian Post kala-azar dermal leishmaniasis.

Authors:  Shibabrata Mukherjee; Debanjan Mukhopadhyay; Claudia Braun; Joyashree N Barbhuiya; Nilay K Das; Uttara Chatterjee; Esther von Stebut; Mitali Chatterjee
Journal:  Exp Dermatol       Date:  2015-03       Impact factor: 3.960

4.  Both Nramp1 and DMT1 are necessary for efficient macrophage iron recycling.

Authors:  Shan Soe-Lin; Sameer S Apte; Marc R Mikhael; Lidia K Kayembe; Guangjun Nie; Prem Ponka
Journal:  Exp Hematol       Date:  2010-04-13       Impact factor: 3.084

5.  Quercetin interferes with iron metabolism in Leishmania donovani and targets ribonucleotide reductase to exert leishmanicidal activity.

Authors:  Gargi Sen; Sibabrata Mukhopadhyay; Manju Ray; Tuli Biswas
Journal:  J Antimicrob Chemother       Date:  2008-02-19       Impact factor: 5.790

6.  Salmonella acquires ferrous iron from haemophagocytic macrophages.

Authors:  Toni A Nagy; Sarah M Moreland; Corrella S Detweiler
Journal:  Mol Microbiol       Date:  2014-08-14       Impact factor: 3.501

7.  Interferon gamma-activated human monocytes downregulate transferrin receptors and inhibit the intracellular multiplication of Legionella pneumophila by limiting the availability of iron.

Authors:  T F Byrd; M A Horwitz
Journal:  J Clin Invest       Date:  1989-05       Impact factor: 14.808

8.  Monitoring of Parasite Kinetics in Indian Post-Kala-azar Dermal Leishmaniasis.

Authors:  Srija Moulik; Surya Jyati Chaudhuri; Bikash Sardar; Manab Ghosh; Bibhuti Saha; Nilay Kanti Das; Mitali Chatterjee
Journal:  Clin Infect Dis       Date:  2018-01-18       Impact factor: 9.079

Review 9.  Survival Mechanisms Used by Some Leishmania Species to Escape Neutrophil Killing.

Authors:  Ivo B Regli; Katiuska Passelli; Benjamin P Hurrell; Fabienne Tacchini-Cottier
Journal:  Front Immunol       Date:  2017-11-16       Impact factor: 7.561

10.  M2 Polarization of Monocytes-Macrophages Is a Hallmark of Indian Post Kala-Azar Dermal Leishmaniasis.

Authors:  Debanjan Mukhopadhyay; Shibabrata Mukherjee; Susmita Roy; Jane E Dalton; Sunanda Kundu; Avijit Sarkar; Nilay K Das; Paul M Kaye; Mitali Chatterjee
Journal:  PLoS Negl Trop Dis       Date:  2015-10-23
View more
  2 in total

Review 1.  Potential biomarkers of immune protection in human leishmaniasis.

Authors:  Mahmoud Nateghi Rostami; Ali Khamesipour
Journal:  Med Microbiol Immunol       Date:  2021-05-02       Impact factor: 3.402

2.  Persistent Cutaneous Leishmania major Infection Promotes Infection-Adapted Myelopoiesis.

Authors:  Fabio Luiz Bandeira Ferreira; Olivier Séguin; Albert Descoteaux; Krista M Heinonen
Journal:  Microorganisms       Date:  2022-02-28
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.