Literature DB >> 32021301

miR-100 Inhibits Cell Growth and Proliferation by Targeting HOXA1 in Nasopharyngeal Carcinoma.

Weifeng He1, Yun Huang2, Cheng Chuan Jiang1, Yuan Zhu3, Ling Wang4, Weiwei Zhang1, Weiguo Huang2, Ting Zhou1,5, Sanyuan Tang1.   

Abstract

BACKGROUND: Increasing evidence indicates that the dysregulation of miRNAs plays a vital role in tumorigenesis and progression of nasopharyngeal carcinoma (NPC). Thus, it is necessary to further investigate the function and mechanism of miRNAs in NPC.
METHODS: miR-100 expression was analyzed using publicly available databases and then tested using quantitative RT-PCR in NPC tissues and cell lines. MTT and colony formation assays and xenograft tumor model were used to test the NPC cell growth and proliferation abilities while modulating miR-100 expression. The target of miR-100 was predicted with TargetScan and validated with luciferase reporter assay, quantitative RT-PCR, and Western blot.
RESULTS: The expression of miR-100 was significantly reduced in NPC tissues and cell lines. Overexpression of miR-100 obviously suppressed NPC cell growth and proliferation, whereas silencing miR-100 promoted NPC cell growth and proliferation in vitro. HOXA1 (homeobox A1) was validated as a direct target of miR-100, and restoring HOXA1 expression could reverse the inhibitive effect of miR-100 on NPC cell growth and proliferation. The mRNA and protein expression of HOXA1 was increased in NPC cell lines. Furthermore, ectopic expression of miR-100 inhibited xenograft tumor growth in vivo.
CONCLUSION: Taken together, our findings suggest that miR-100 could suppress NPC growth and proliferation through targeting HOXA1, providing a novel target for the miRNA-mediated therapy for patients with NPC in the future.
© 2020 He et al.

Entities:  

Keywords:  HOXA1; invasion; miR-100; nasopharyngeal carcinoma; proliferation

Year:  2020        PMID: 32021301      PMCID: PMC6980857          DOI: 10.2147/OTT.S228783

Source DB:  PubMed          Journal:  Onco Targets Ther        ISSN: 1178-6930            Impact factor:   4.147


Introduction

Nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor with the highest incidence in China, which accounts for 47.7% of the new cases worldwide.1 As its unique anatomical location, radiotherapy is the primary treatment for NPC patients. During the past years, with the use of intensity-modulated radiation therapy and its combination with chemotherapy, the 5-year survival rate of NPC patients has been significantly improved. However, about 30% of NPC patients eventually die of relapse or metastasis.2 Therefore, it is very urgent to carry out relevant studies to clarify the underlying mechanism of NPC tumorigenesis and development and provide new molecular targets for future treatment. MiRNAs are small non-coding RNAs, and it can enhance mRNA degradation or inhibit its translation through base pairing with the 3′-untranslated region (3′-UTR) of mRNA.3 Many studies demonstrate that miRNA expression changes significantly in various tumors, making it as biomarkers for tumor diagnosis, subclassify, and prognosis prediction.4–6 More importantly, the changed miRNAs play very important roles in the process of tumorigenesis, development, and progression.7–9 It has been also found that miRNA expression is dysregulated in NPC,10–12 and the dysregulated miRNAs can promote NPC cell proliferation, invasion, and angiogenesis, including miR-125b, miR-506, miR-142-3p, miR-23a, and so on.13–16 Thus, previous studies indicate that miRNA plays vital roles in NPC carcinogenesis and development. It also should be noted that further exploration of the function and mechanism of miRNA involved in NPC development and progression would provide novel therapeutic targets. Based on analyzing several publicly available microarray data, we found that miR-100 was obviously decreased in NPC. It has been reported that miR-100 is dysregulated in many types of cancers, and it functions as either a tumor suppressor or promoter in different tumor types.17,18 In NPC, miR-100 was found to be decreased and it can suppress NPC cell migration and invasion through targeting IGF1R.19 However, no study has elucidated the function and mechanisms of miR-100 in NPC growth and proliferation. Therefore, in our present study, we performed functional studies and found that overexpression of miR-100 inhibited NPC cell growth and proliferation in vitro, while silencing miR-100 had an opposite function. Mechanism studies indicated that HOXA1 was a direct target of miR-100, and the restoration of HOXA1 expression reversed the inhibitive effect of miR-100 overexpression on NPC cell growth and proliferation. Our findings suggest that miR-100 functions as a tumor suppressor in NPC, which might serve as a treatment target for NPC patients.

Methods

Cell Culture

The NPC cell lines, including CNE1, CNE2, HNE1, HONE1, SUNE1, and C666-1, were maintained in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco); and the human immortalized nasopharyngeal epithelial cell line NP69 was maintained in KSFM medium (Gibco) supplemented with bovine pituitary extract (BD Biosciences, San Diego, CA, USA) in a humidified atmosphere at 37°C with 5% CO2. All NPC cell lines and NP69 were generously provided by Professor Zhiqiang Xiao (Central South University), and the use of these cell lines was approved by the Institutional Ethical Review Board of the Brain Hospital of Human Province.

RNA Isolation and Quantitative RT-PCR

Total RNA was extracted using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and then the cDNA was synthesized using a reverse transcriptase (Promega, Madison, WI, USA). Quantitative PCR was conducted using the SYBR Green reagents (Invitrogen). The primers for miR-100 were purchased from the RiboBio (Guangzhou), and for HOXA1 was synthesized: GGCTCGCCTCAATACATTCAC (forward) and CGTACTCTCCAACTTTCCCTG (reverse). All of the experiments were conducted in triplicate and normalized to the expression of U6 or GAPDH. The relative expression was calculated with the 2− ΔΔCT equation.

Transient Transfection and Stably Transfected Cell Line Construction

The miR-100 mimics or inhibitor and its controls were purchased from the GenePharma (Suzhou). The HOXA1 plasmid and its empty vector were purchased from the FulenGen (Guangzhou). Cells were transfected using the Lipofectamine 2000 reagent (Invitrogen) and harvested for assays after 48 hrs. The sequence of pri-miR-100 was amplified and cloned into the pSin-EF2-puromycin lentiviral plasmid (Addgene, Cambridge, MA, USA). The lenti-miR-Ctrl or lenti-miR-100 was used to transfect SUNE1 cells and then selected using puromycin.

MTT and Colony Formation Assay

Cells were seeded into 96-well plates with a density of 1000 NPC cells per well, and then incubated for 0–4 days. On each day, the cells were stained with MTT dye (Sigma, St. Louis, MO, USA), and the absorbance was tested at 490 nm using a spectrophotometer. In addition, cells were seeded into 6-well plates with a density of 400 cells and cultured for 10 days. Colonies were fixed and stained, and then counted with an inverted microscope.

Luciferase Reporter Assay

The wild type (WT) and mutant (MT) 3′-UTR sequences of HOXA1 were amplified and inserted into the psiCHECK™ vector (Promega). Then, the reporter plasmids, together with p-TK Renilla plasmid and miR-100 mimics or control were used to transfect NPC cells using Lipofectamine 2000 (Invitrogen). Cells were harvested 48 h later, and the luciferase signals were tested using the Dual-Luciferase Reporter Assay System (Promega).

Western Blot

Total protein was extracted from NPC cells with RIPA buffer, separated with 9% gels, and then transfected to PVDF membranes (Millipore, Billerica, MA, USA). The membranes were firstly incubated with anti-HOXA1 antibody (Abcam, Cambridge, MA, USA), and then with secondary antibody (Sigma). The α-tubulin was used as a loading control, and the bands were obtained with enhanced chemiluminescence.

Xenograft Tumor Growth

Female BALB/c nude mice aged 3~4 weeks were purchased from the Charles River Laboratories (Beijing). SUNE1 cells stably expressing miR-100 or miR-Ctrl were injected into the dorsal flank of mice. The tumor size was measured every 3 days for the calculation of the tumor volume. On day 30, the mice were sacrificed, and the tumors were weighted. All animal study protocols were performed following the guidelines of the Experimental Animal Care and Use Ethics Committee of the Brain Hospital of Hunan Province.

Statistical Analyses

All experiments were conducted at least three times, and all results were shown as mean ± SD. SPSS 22.0 (SPSS Inc., Chicago, IL, USA) was used for data analysis by comparing with Student’s t-test, and p<0.05 was considered as a significant difference.

Results

miR-100 Is Reduced in NPC Clinical Samples and Cell Lines

We firstly analyzed the biggest publicly available NPC microarray data (GSE32960) and found that miR-100 was significantly reduced in NPC tissues (n=312) compared with normal nasopharynx tissues (n=18) (Figure 1A, p<0.001). Then, miR-100 was verified to be reduced in NPC tissues based on the other two publicly available microarray data with the accession number GSE36682 (Figure 1B, p<0.001) and GSE43039 (Figure 1C, p=0.049). In addition, we detected the miR-100 expression in the immortalized nasopharyngeal epithelial cell line NP69 and six NPC cell lines using quantitative RT-PCR, and found that miR-100 was obviously decreased in all NPC cell lines (Figure 1D, all p<0.05). These results indicate that miR-100 is reduced in NPC tissue samples and cell lines.
Figure 1

Mir-100 is reduced in NPC clinical samples and cell lines. (A–C) Relative miR-100 expression in NPC tissues and normal nasopharynx tissues in three publicly available microarray data. (D) Relative expression of miR-100 in the immortalized nasopharyngeal epithelial cell line NP69 and six NPC cell lines. (E, F) Relative expression of miR-100 in SUNE1 and HONE1 cells transfected with miR-100 mimics, miR-100 inhibitor or miR-Ctrl. U6 was used as the endogenous control. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Mir-100 is reduced in NPC clinical samples and cell lines. (A–C) Relative miR-100 expression in NPC tissues and normal nasopharynx tissues in three publicly available microarray data. (D) Relative expression of miR-100 in the immortalized nasopharyngeal epithelial cell line NP69 and six NPC cell lines. (E, F) Relative expression of miR-100 in SUNE1 and HONE1 cells transfected with miR-100 mimics, miR-100 inhibitor or miR-Ctrl. U6 was used as the endogenous control. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Overexpression of miR-100 Inhibits NPC Cell Growth and Proliferation

We transiently transfected SUNE1 and HONE1 cells with miR-100 mimics or its control (miR-Ctrl), and confirmed the transfection efficiency with quantitative RT-PCR (Figure 1E, all p<0.05). Then, we did functional experiments including MTT and colony formation assays. MTT assay showed that NPC cells transfected with miR-100 mimics grew more slowly than cells transfected with miR-Ctrl (Figure 2A and B, p<0.05). Colony formation assay found that NPC cells transfected with miR-100 mimics formed fewer and smaller colonies than cells transfected with miR-Ctrl (Figure 2C and D, p<0.05). These results indicate that overexpression of miR-100 inhibits NPC cell growth and proliferation.
Figure 2

Overexpression of miR-100 inhibits NPC cell growth and proliferation. (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl determined by the MTT assay. (C–D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl determined by the colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Overexpression of miR-100 inhibits NPC cell growth and proliferation. (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl determined by the MTT assay. (C–D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl determined by the colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Silencing miR-100 Promotes NPC Cell Growth and Proliferation

We also transiently transfected SUNE1 and HONE1 cells with miR-100 inhibitor or its control (miR-Ctrl) and verified the transfection efficiency with quantitative RT-PCR (Figure 1F, p<0.05). Then, we also conducted the same functional experiments as mentioned above. We found that the reduction of miR-100 expression distinctly promoted SUNE1 and HONE1 cell growth and increased their colony formation rates (Figure 3A–D, p<0.05). These results indicate that silencing miR-100 promotes NPC cell growth and proliferation.
Figure 3

Silencing of miR-100 promotes NPC cell growth and proliferation. (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 inhibitor or miR-Ctrl determined by the MTT assay. (C, D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 inhibitor or miR-Ctrl determined by the colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Silencing of miR-100 promotes NPC cell growth and proliferation. (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 inhibitor or miR-Ctrl determined by the MTT assay. (C, D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 inhibitor or miR-Ctrl determined by the colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

HOXA1 Is a Direct Target of miR-100 and Its Expression Is Increased in NPC

We predicted the potential target of miR-100 using the online database TargetScan and selected HOXA1 for further validation because of its crucial effect on cell growth. Figure 4A shows the putative binding site between miR-100 and HOXA1. Luciferase report assay found that overexpression of miR-100 could inhibit the luciferase activities of the HOXA1 3′-UTR WT reporter plasmid, but not the HOXA1 3′-UTR MT reporter plasmid (Figure 4B, p<0.05). Then, quantitative PCR and Western blot showed that overexpression of miR-100 could suppress the mRNA and protein expression of HOXA1 (Figure 4C and D, p<0.05). Furthermore, HOXA1 mRNA and protein were upregulated in NPC cell lines (Figure 4E and F). These results indicate that HOXA1 is a direct target of miR-100 in NPC.
Figure 4

HOXA1 is a direct target of miR-100 and its expression is decreased in NPC (A) Wild-type (WT) and mutant (MT) 3′-UTR of HOXA1 with putative bind site of miR-100. (B) Relative luciferase activities of SUNE1 and HONE1 cells determined by the luciferase reporter assay. (C, D) The mRNA and protein expression of HOXA1 in SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl. (E, F) The mRNA and protein expression of HOXA1 in NPC cell lines determined by quantitative RT-PCR and Western blot. The data are presented as the mean ± SD; p values were calculated using Student’s t-test; * p<0.05.

HOXA1 is a direct target of miR-100 and its expression is decreased in NPC (A) Wild-type (WT) and mutant (MT) 3′-UTR of HOXA1 with putative bind site of miR-100. (B) Relative luciferase activities of SUNE1 and HONE1 cells determined by the luciferase reporter assay. (C, D) The mRNA and protein expression of HOXA1 in SUNE1 and HONE1 cells transfected with miR-100 mimics or miR-Ctrl. (E, F) The mRNA and protein expression of HOXA1 in NPC cell lines determined by quantitative RT-PCR and Western blot. The data are presented as the mean ± SD; p values were calculated using Student’s t-test; * p<0.05.

Restoration of HOXA1 Reverses the Inhibitive Effects of miR-100 in NPC

We then investigate whether HOXA1 was essential for the regulatory effect of miR-100 on NPC cell growth and proliferation. We transiently co-transfected SUNE1 and HONE1 cells with miR-100 mimics and HOXA1 plasmid or its empty vector, and then did MTT and colony formation assays. The functional results showed that the ectopic expression of HOXA1 reversed the inhibitive effects of miR-100 on NPC cell growth and proliferation (Figure 5A–D, p<0.05). These results indicate that HOXA1 is a functional target of miR-100 in NPC.
Figure 5

Restoration of HOXA1 reverses the inhibitive effect of miR-100 in NPC (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 mimics and HOXA1 plasmids or empty vector determined by the MTT assay. (C, D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 mimics and HOXA1 plasmids or empty vector determined by colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Restoration of HOXA1 reverses the inhibitive effect of miR-100 in NPC (A, B) Cell growth viabilities of SUNE1 and HONE1 cells transfected with miR-100 mimics and HOXA1 plasmids or empty vector determined by the MTT assay. (C, D) Representative images and quantification of colonies of SUNE1 and HONE1 cells transfected with miR-100 mimics and HOXA1 plasmids or empty vector determined by colony formation assay. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Overexpression of miR-100 Inhibits NPC Xenograft Tumor Growth

We constructed xenograft tumor growth model through injecting SUNE1 cells that stably expressing miR-100 or miR-Ctrl into the dorsal flank of nude mice, and all of the mice formed xenograft tumors (Figure 6A). The tumors formed in the miR-100 overexpression group grew more slowly and smaller than the miR-Ctrl group (Figure 6B, p<0.05). In addition, the tumor size and weight were significantly different between the two groups (Figure 6C and D, p<0.05). The expression of miR-100 was increased in xenograft tumor tissues of miR-100 overexpression group than the miR-Ctrl group (Figure 6E, p<0.05). These results indicate that overexpression of miR-100 inhibits NPC xenograft tumor growth.
Figure 6

Overexpression of miR-100 inhibits NPC xenograft tumor growth (A) Xenograft tumor growth models in nude mice were constructed by injecting with SUNE1 cells stably expressing miR-100 or miR-Ctrl, and the xenograft tumors were formed. (B) The growth curves of the tumor volumes. (C) Representative images of the excised tumors. (D) The weights of the excised tumors. (E) Relative expression of miR-100 in xenograft tumors of the miR-100 overexpression group and miR-Ctrl group. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Overexpression of miR-100 inhibits NPC xenograft tumor growth (A) Xenograft tumor growth models in nude mice were constructed by injecting with SUNE1 cells stably expressing miR-100 or miR-Ctrl, and the xenograft tumors were formed. (B) The growth curves of the tumor volumes. (C) Representative images of the excised tumors. (D) The weights of the excised tumors. (E) Relative expression of miR-100 in xenograft tumors of the miR-100 overexpression group and miR-Ctrl group. Data are presented as the mean ± SD, and the p values were calculated using the Student’s t-test; * p<0.05.

Discussion

Recurrence and metastasis are two major causes of treatment failure and death for patients with NPC, and it is urgent to better understanding the molecular mechanisms related to NPC tumorigenesis and progression, which would guide a more personalized therapy for NPC. In our present study, we reported that miR-100 was decreased in NPC and functioned as a tumor suppressor by inhibiting NPC cell growth and proliferation. Recently, miRNAs have been reported to be dysregulated in NPC based on genome-wide profiling.10,12 The dysregulated miRNAs play an important role in NPC tumorigenesis and progression by promoting NPC cell proliferation, invasion, and angiogenesis.13–16 It has been found that miR-125b is upregulated in NPC, and it can promote NPC cell proliferation and inhibit cell apoptosis by targeting A20 and activating the NF-kB signaling pathway.13 miR-506 can inhibit NPC tumor growth and metastasis through inactivating the Wnt/β-catenin signaling pathway by targeting LHX2.14 EZH2-DNMT1-mediated epigenetic silencing of miR-142-3p promotes NPC cell invasion and metastasis by targeting ZEB2.15 miR-23a can promote NPC cell growth, migration, and angiogenesis by targeting TSGA10.16 Here, in our present study, we found that miR-100 was obviously decreased in NPC tissue samples by analyzing three publicly available microarray data. Functional experiments verified that miR-100 could suppress NPC cell growth and proliferation in vitro and inhibit xenograft tumor growth in vivo. It is worth noting that a recent study reports that miR-100 can inhibit NPC cell migration and invasion by targeting IGF1R.19 These findings indicate that miR-100 plays important roles in NPC development and progression. miR-100, as a member of the miR-99 family, has been reported to be dysregulated in many types of cancers, and it can function as either a tumor suppressor or promoter, which depends on the tumor types and microenvironment.17,18 Downregulation of miR-100 has been found in esophageal squamous cell carcinoma, non-small cell lung cancer, breast cancer, and so on.20–22 On the other hand, upregulation of miR-100 is observed in small cell lung cancer, renal cell carcinoma, and pancreatic adenocarcinoma, and so on.23–25 It has been also found that miR-100 play vital roles in various biological processes, such as cell proliferation, apoptosis, cell cycle, migration, differentiation, and angiogenesis.17,18 For example, miR-100 inhibits breast cancer proliferation and survival by targeting IGF2.22 miR-100 inhibits gastric cancer tumor growth and metastasis and growth by targeting ZBTB7A.26 miR-100 promotes cell differentiation and survival in acute myeloid leukemia by targeting RBSP3.27 miR-100 promotes hepatocellular carcinoma cell metastasis by enhancing ICMT-Rac1 signaling.28 In this study, we found that miR-100 was decreased in NPC and functioned as a tumor-suppressive miRNA, enriching the understanding of the function and mechanism of miR-100 in tumors. As we have known, miRNAs exert their function by base-pairing with the 3′-UTR of their target genes.3 Many target genes of miR-100 have been identified and verified, including mTOR, IGFR, PLK1, AKT1, RAP1B, FGFR3, and so on.29–34 As each miRNA can regulate multiple different target genes, our study predicted HOXA1 as a potential direct target of miR-100 with the public available database TargetScan. We then verified HOXA1 as the target of miR-100 in NPC using luciferase report assay, quantitative RT-PCR and Western blot. Similarly, HOXA1 was also found to be a direct target of miR-100 in lung cancer and breast cancer.23,35 It should be noted that HOXA1 can be regulated by several other miRNAs, such as miR-30b, miR-99a, and miR-577, and so on.36–38 More importantly, HOXA1 has been reported as an oncogene in various types of cancers.39–41 In our study, we found that HOXA1 was increased in NPC and it was regulated by miR-100, thereby enriching the understanding of miR-100/HOXA1 signaling pathway involvement in NPC tumorigenesis and progression. In conclusion, our study revealed that miR-100 expression was reduced, and functioned as a tumor suppressor in NPC. Ectopic expression of miR-100 could suppress NPC cell growth and proliferation in vitro, and inhibit xenograft tumor growth in vivo by targeting HOXA1. Our findings make a better understanding of the mechanisms involved in miR-100-mediated NPC tumorigenesis and progression, further providing an opportunity for the exploration of novel miRNA-based targeted treatments for NPC patients.
  41 in total

1.  Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein.

Authors:  Bao Hua Li; Jian Song Zhou; Feng Ye; Xiao Dong Cheng; Cai Yun Zhou; Wei Guo Lu; Xing Xie
Journal:  Eur J Cancer       Date:  2011-06-01       Impact factor: 9.162

2.  Prognostic value of a microRNA signature in nasopharyngeal carcinoma: a microRNA expression analysis.

Authors:  Na Liu; Nian-Yong Chen; Rui-Xue Cui; Wen-Fei Li; Yan Li; Rong-Rong Wei; Mei-Yin Zhang; Ying Sun; Bi-Jun Huang; Mo Chen; Qing-Mei He; Ning Jiang; Lei Chen; William C S Cho; Jing-Ping Yun; Jing Zeng; Li-Zhi Liu; Li Li; Ying Guo; Hui-Yun Wang; Jun Ma
Journal:  Lancet Oncol       Date:  2012-05-03       Impact factor: 41.316

Review 3.  miRNA Deregulation in Cancer Cells and the Tumor Microenvironment.

Authors:  Rajesha Rupaimoole; George A Calin; Gabriel Lopez-Berestein; Anil K Sood
Journal:  Cancer Discov       Date:  2016-02-10       Impact factor: 39.397

4.  MicroRNA-100 regulates IGF1-receptor expression in metastatic pancreatic cancer cells.

Authors:  J S Huang; M E Egger; W E Grizzle; L R McNally
Journal:  Biotech Histochem       Date:  2013-02-04       Impact factor: 1.718

5.  C/EBPα-induced miR-100 expression suppresses tumor metastasis and growth by targeting ZBTB7A in gastric cancer.

Authors:  Duan-Bo Shi; Ya-Wen Wang; Ai-Yan Xing; Ji-Wei Gao; Hui Zhang; Xiang-Yu Guo; Peng Gao
Journal:  Cancer Lett       Date:  2015-09-25       Impact factor: 8.679

6.  Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.

Authors:  Freddie Bray; Jacques Ferlay; Isabelle Soerjomataram; Rebecca L Siegel; Lindsey A Torre; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2018-09-12       Impact factor: 508.702

7.  MicroRNA-506 inhibits tumor growth and metastasis in nasopharyngeal carcinoma through the inactivation of the Wnt/β-catenin signaling pathway by down-regulating LHX2.

Authors:  Tian-Song Liang; Ying-Juan Zheng; Juan Wang; Jing-Yi Zhao; Dao-Ke Yang; Zhang-Suo Liu
Journal:  J Exp Clin Cancer Res       Date:  2019-02-21

8.  MicroRNA deregulation and pathway alterations in nasopharyngeal carcinoma.

Authors:  H-C Chen; G-H Chen; Y-H Chen; W-L Liao; C-Y Liu; K-P Chang; Y-S Chang; S-J Chen
Journal:  Br J Cancer       Date:  2009-03-24       Impact factor: 7.640

9.  miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion.

Authors:  Dahu Chen; Yutong Sun; Yuan Yuan; Zhenbo Han; Peijing Zhang; Jinsong Zhang; M James You; Julie Teruya-Feldstein; Min Wang; Sumeet Gupta; Mien-Chie Hung; Han Liang; Li Ma
Journal:  PLoS Genet       Date:  2014-02-27       Impact factor: 5.917

10.  MiR-125b regulates proliferation and apoptosis of nasopharyngeal carcinoma by targeting A20/NF-κB signaling pathway.

Authors:  Zhen Zheng; Jia-Quan Qu; Hong-Mei Yi; Xu Ye; Wei Huang; Ta Xiao; Jiao-Yang Li; Yuan-Yuan Wang; Juan Feng; Jin-Feng Zhu; Shan-Shan Lu; Hong Yi; Zhi-Qiang Xiao
Journal:  Cell Death Dis       Date:  2017-06-01       Impact factor: 8.469

View more
  6 in total

1.  TMPO-AS1 Regulates the Aggressiveness-Associated Traits of Nasopharyngeal Carcinoma Cells Through Sponging miR-320a.

Authors:  Biao Xing; Xiao-Feng Qiao; Yan-Hua Qiu; Xin Li
Journal:  Cancer Manag Res       Date:  2021-01-15       Impact factor: 3.989

2.  MicroRNA-100 Reduced Fetal Bovine Muscle Satellite Cell Myogenesis and Augmented Intramuscular Lipid Deposition by Modulating IGF1R.

Authors:  Bilal Ahmad Mir; Elke Albrecht; Asghar Ali; Ola Hansson; Steffen Maak
Journal:  Cells       Date:  2022-01-28       Impact factor: 6.600

3.  Silencing long non-coding RNA DLX6-AS1 or restoring microRNA-193b-3p enhances thyroid carcinoma cell autophagy and apoptosis via depressing HOXA1.

Authors:  Ling Feng; Ru Wang; Yifan Wang; Xixi Shen; Qian Shi; Meng Lian; Hongzhi Ma; Jugao Fang
Journal:  J Cell Mol Med       Date:  2021-09-12       Impact factor: 5.310

4.  HOXA1 is a radioresistance marker in multiple cancer types.

Authors:  Lu He; Min Liang; Weisheng Guo; Jinquan Liu; Yi Yu
Journal:  Front Oncol       Date:  2022-09-02       Impact factor: 5.738

5.  MicroRNA-100 Enhances Autophagy and Suppresses Migration and Invasion of Renal Cell Carcinoma Cells via Disruption of NOX4-Dependent mTOR Pathway.

Authors:  Xiumin Liu; Lili Zhong; Ping Li; Peng Zhao
Journal:  Clin Transl Sci       Date:  2020-06-25       Impact factor: 4.438

6.  FBXL19‑AS1 promotes the progression of nasopharyngeal carcinoma by acting as a competing endogenous RNA to sponge miR‑431 and upregulate PBOV1.

Authors:  Hongjun Dong; Chao Huang; Jingjing Huang
Journal:  Mol Med Rep       Date:  2021-07-19       Impact factor: 2.952

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.