Literature DB >> 32017796

Occurrence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China.

Xueping Zhang1, Liqin Wang2, Xinting Lan1, Jiaming Dan1, Zhihua Ren1, Suizhong Cao1, Liuhong Shen1, Junliang Deng1, Zhicai Zuo1, Shumin Yu1, Ya Wang1, Xiaoping Ma1, Haifeng Liu1, Ziyao Zhou1, Yanchun Hu1, Hualin Fu1, Changliang He1, Yi Geng1, Xiaobin Gu1, Guangneng Peng1, Yufei Wang3, Zhijun Zhong1.   

Abstract

Giardia duodenalis is a common enteric protozoan that infects a range of hosts including humans and other mammals. Multilocus genotyping of G. duodenalis in captive non-human primates (NHPs) from zoos in China is limited. In this study, we evaluated 302 NHP fecal samples collected from 32 different NHP species. The primates were from 12 zoos distributed across eight provinces and two municipalities (Chongqing and Beijing) of China. The overall infection rate was 8.3% (25/302). The six G. duodenalis-positive zoos and their infection rates were: Suzhou Zoo (40.0%, 4/10), Yangzhou Zoo (22.2%, 2/9), Dalian Zoo (16.7%, 4/24), Chengdu Zoo (12.8%, 6/47), Guiyang Forest Wildlife Zoo (12.1%, 7/58), and Changsha Zoo (4.7%, 2/43). Molecular analysis of three loci, beta-giardin (bg), triose phosphate isomerase (tpi), and glutamate dehydrogenase (gdh), showed high genetic heterogeneity, and seven novel subtypes (BIII-1, MB10-1, WB8-1, B14-1, MB9-1, DN7-1, and BIV-1) were detected within assemblage B. Additional analysis revealed 12 different assemblage B multilocus genotypes (MLGs), one known MLG and 11 novel MLGs. Based on phylogenetic analysis, 12 assemblage B MLGs formed two main clades, MLG-SW (10-12, 18) and MLG-SW (13, 14, 16, 17), the other four MLG-SW (15, 19, 20, 21) were scattered throughout the phylogenetic tree in this study. Using multilocus genotyping, this study expands our understanding of the occurrence of Giardia infection and genetic variation in Giardia in captive non-human primates from zoos in China.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32017796      PMCID: PMC6999901          DOI: 10.1371/journal.pone.0228673

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Giardia duodenalis is an intestinal parasite that causes giardiasis in humans and animals. Giardia duodenalis infection may be asymptomatic or elicit several clinical symptoms including diarrhea, vomiting, weight loss, abdominal cramps, and nutrient malabsorption [1, 2]. Giardia duodenalis commonly infects non-human primates (NHPs), and causes both veterinary and public health problems [3-7]. In NHPs, giardiasis causes diarrhea and ill thrift, especially in young animals [8]. To date, there have been numerous studies about the Giardia duodenalis infection for non-human primates in the world, such as in Thailand (7.0%, 14/200) [9], Uganda (11.1%, 9/81) [10], India (31.2%, 53/170) [11], Netherlands/Belgium (61.6%, 159/258) [12], Italy (50.0%, 5/10) [13] and Spain (70.0%, 14/20) [14]. In China, Giardia duodenalis infection rates in ten zoos are reported between 0% to 44.0%, including Changsha Wild Animal Zoo (44.0%, 33/75), Guiyang Zoo (30.0%, 15/50), Beijing Zoo (22.2%, 16/72), Shanghai Wild Animal Zoo (20.9%, 14/67), Taiyuan Zoo (13.6%, 9/66), Wuhan Zoo (7.6%, 5/66), Shijiazhuang Zoo (11.2%, 10/89), Shanghai Zoo (8.2%, 5/61), Bifengxia Zoo (0%, 0/24) and Chengdu Zoo (0%, 0/11) [8, 15]. Giardia duodenalis has at least eight assemblages (A-H), only assemblages A, B, and E have been detected in NHPs, with assemblage B dominating [8–13, 15–20]. Assemblages A and B, which are consider potentially zoonotic, were reported in NHPs from zoos [8-16], thus, NHPs may play a role in the transmission of G. duodenalis to humans. To date, most Chinese studies evaluating G. duodenalis infection in NHPs have focused on a single zoo or localized area. Only three studies have extended their investigation to include a larger geographical region [8, 15, 16]. Ongoing epidemiological surveys on intestinal zoonotic parasites of G. duodenalis, expanded previous studies to large-scale investigation of zoos and NHP species in China. We used multilocus genotyping to evaluate 302 NHP fecal samples (including 32 primate species) from 12 zoos distributed across eight Chinese provinces and two municipalities (Chongqing and Beijing), to better understand G. duodenalis infection in captive NHPs throughout China.

Materials and methods

Ethics statement

This study was reviewed and approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University under permit number ZXP-2018303052. Prior to the collection of fecal specimens from NHPs, permission was obtained from the owners.

Sample collection

Fecal samples from 302 NHPs (including 32 primate species) were collected from March 2018 to January 2019 (S1 Table). The samples from 12 zoos are distributed throughout China (Fig 1), including Beijing Zoo (n = 12), Chengdu Zoo (n = 47), Changsha Zoo (n = 43), Chongqing Zoo (n = 33), Dalian Zoo (n = 24), Guiyang Forest Wildlife Zoo (n = 58), Guangzhou Zoo (n = 8), Kunming Zoo (n = 16), Nanjing Zoo (n = 16), Shaanxi Rare and Wildlife Zoo (n = 26), Suzhou Zoo (n = 10), and Yangzhou Zoo (n = 9). The 12 zoos have adequate facilities to accommodate the different species of primates in indoor enclosure, different species live on separated places, and the feed managements are according to the Standard Rule of Chinese Association of Zoological Gardens. All animals’ samples were collected by visiting once. At the time of faecal collections, there were no reported case of diarrhoea in the NHPs. Fresh feces were collected and packed in clear, self-sealing, disposable plastic bags marked with ID numbers, and transported in ice-filled foam boxes. Samples were stored in 2.5% potassium dichromate at 4°C until DNA was extracted.
Fig 1

Distribution of sampling sites from 12 zoos in China in this study.

Sampling sites are indicated by black triangles.

Distribution of sampling sites from 12 zoos in China in this study.

Sampling sites are indicated by black triangles.

DNA extraction and polymerase chain reaction (PCR)

Fecal samples were washed in distilled water to remove the potassium dichromate. Genomic DNA was then extracted using the PowerSoil® DNA Isolation Kit (MoBio, Carlsbad CA, USA), following manufacturer’s instructions. DNA was stored at -20°C prior to PCR analysis. The PCR primers and protocol used in this study were previously described [15]. The PCR reactions for the bg, tpi and gdh loci were conducted in 25 μL reaction mixtures containing of 12.5 μL 2× Taq PCR Master Mix (KT201-02, Tiangen, Beijing, China), 8.5 μL deionized water (Tiangen, Beijing, China), 2 μL DNA, and 1 μL each of set primers, respectively. The primers and annealing temperatures for the three genes were listed in Table 1. Secondary PCR products were visualized by 1% agarose gel electrophoresis and staining with Golden View.
Table 1

Primer sequences, annealing temperatures and the fragment lengths of the genes used in this study.

GenePrimersSequence(5’-3’)Annealing Temperature(˚C)Fragment Length(bp)
bgF1AAGCCCGACGACCTCACCCGCAGTGC60530
R1GAGGCCGCCCTGGATCTTCGAGACGAC
F2GAACGAACGAGATCGAGGTCCG55
R2CTCGACGAGCTTCGTGTT
tpiF1AAATIATGCCTGCTCGTCG50530
R1CAAACCTTITCCGCAAACC
F2CCCTTCATCGGIGGTAACTT50
R2GTGGCCACCACICCCGTGCC
gdhF1TTCCGTRTYCAGTACAACTC50511
R1ACCTCGTTCTGRGTGGCGCA
F2ATGACYGAGCTYCAGAGGCACGT50
R2GTGGCGCARGGCATGATGCA

Sequence analysis

All positive secondary PCR products were sequenced by BGI Tech Solutions (Liuhe Beijing) Co., Limited and were sequenced in both directions. Sequences were aligned with reference sequences from the GenBank database using BLAST (http://blast.ncbi.nlm.nih.gov) and Clustal X (http://www.clustal.org/). To evaluate the MLGs of G. duodenalis, we only included specimens that were successfully subtyped at all three loci and sequences with ambiguous positions (double peaks) were not included for phylogenetic analyses. Sequences were concatenated for each positive isolate to form a multilocus sequence (bg + tpi + gdh). All concatenated MLGs were used in a neighbour-joining analysis using the Kimura-2 parameter model calculated with MEGA 7 (http://www.megasoftware.net/). Representative nucleotide sequences obtained in this study were deposited in GenBank under the accession numbers: MK909127, MK909131, MK909135, MK909136, MK952610, MK952598, and MK952606.

Results and discussion

In this study, infected NHPs were detected from six zoos of the 12 examined zoos. Suzhou Zoo had the highest infection rate (40.0%, 4/10), followed by Yangzhou Zoo (22.2%, 2/9), Dalian Zoo (16.7%, 4/24), Chengdu Zoo (12.8%, 6/47), Guiyang Forest Wildlife Zoo (12.1%, 7/58), and Changsha Zoo (4.7%, 2/43) (Table 2). The infection rate in Suzhou Zoo was closed to Changsha Wild Animal Zoo (44.0%, 33/75) [8]. Yangzhou Zoo and Dalian Zoo were closed to our previous study from Guiyang Zoo (30.0%, 15/50) [15]. Chengdu Zoo and Guiyang Forest Wildlife Zoo were closed to a public park in Guiyang (8.5%, 35/411) [20]. The infection rate in Changsha Zoo was similar to that detected in Wuhan Zoo (7.6%, 5/66) [8] and Guangxi Zoo (2.4%, 5/205) [21]. The various infection rates in different zoos may relate to geographic distribution [8, 11, 12, 14–16].
Table 2

Occurrence and assemblage B of G. duodenalis for NHPs from 12 zoos in China.

Zoos nameProvincePositive NHPs species (n)No.testedNo.(%)of positive specimens95% CIAssemblage (n)
Beijing ZooBeijing*120 (0)
Chengdu ZooSichuanGolden monkey (6)476 (12.8%)[2.9, 22.7]B (6)
Changsha ZooHunanRing-tailed lemur (2)432 (4.7%)[-1.9, 11.2]B (2)
Chongqing ZooChongqing*330 (0)
Dalian ZooLiaoningChimpanzee (2)244 (16.7%)[0.6, 32.7]B (4)
Golden monkey (1)
Ring-tailed lemur (1)
Guiyang Forest Wildlife ZooGuizhouGolden monkey (5)587 (12.1%)[3.4, 20.7]B (7)
Baboons (1)
White-cheeked gibbon (1)
Guangzhou ZooGuangdong80 (0)
Kunming ZooYunnan160 (0)
Nanjing ZooJiangsu160 (0)
Shaanxi Rare and Wildlife ZooShaanxi260 (0)
Suzhou ZooJiangsuRing-tailed lemur (1)104 (40.0%)[3.1, 76.9]B (4)
Japanese macaque (1)
Ruffed lemur (1)
Africa black-and-white colobus(1)
Yangzhou ZooJiangsuSquirrel monkey (1)92 (22.2%)[-11.7, 56.1]B (2)
Ring-tailed lemur (1)
Total: 12 zoosEight provinces and two municipalitiesGolden monkey (12)30225 (8.3%)[5.2, 11.4]B (25)
Squirrel monkey (1)
Japanese macaques (1)
Baboons (1)
Africa black-and-white colobus(1)
White-cheeked gibbon (1)
Chimpanzee (2)
Ring-tailed lemur (5)
Ruffed lemur (1)

“*”: municipality

“*”: municipality Twenty-five samples were positive for G. duodenalis, based on positive PCR results at any of the three genetic loci (bg, tpi, and gdh). Average infection rate in this study was 8.3% (25/302), which was lower than a previous study in captive NHPs from seven zoos (18.6%, 92/496) (Shijiazhuang Zoo, Wuhan Zoo, Taiyuan Zoo, Changsha Wild Animal Zoo, Beijing Zoo, Shanghai Zoo and Shanghai Wild Animal Zoo) and also lower than our previous study from three zoos (17.7%, 15/85) in southwestern China (Guiyang Zoo, Bifengxia Zoo and Chengdu Zoo) [8, 15]. Compared with other countries, the average infection rate in this study was closed to that in Thailand (7.0%, 14/200) [9] and Uganda (11.1%, 9/81) [10], but lower than that in North-West India (31.2%, 53/170) [11]. The differences of infection rates in NHPs may be related to animal health status, detection methods, or geo-ecological conditions [2, 8, 15, 16, 22–29]. Nested PCR protocols based on single-copy genes (bg, tpi and gdh) had considerable lower diagnostic sensitivities than those based on multiple-copy genes (e.g. SSU rRNA). In this study, we adopted single-copy genes (bg, tpi and gdh) for genotyping G. duodenalis, not use the multiple-copy gene (SSU rRNA), which may underestimate the true infection rates [19]. Giardia duodenalis infection in NHPs suggests more attention should be paid to the living conditions of NHPs, and a safe distance maintained between NHPs and humans [20]. For PCR analysis of 302 samples from 32 NHP species, only nine species were positive for G. duodenalis, including africa black-and-white colobus (100%, 1/1), ruffed lemur (50.00%, 1/2), ring-tailed lemur (31.25%, 5/16), japanese macaque (33.33%, 1/3), chimpanzee (22.22%, 2/9), golden monkey (17.39%, 12/69), white-cheeked gibbon (7.14%, 1/14), baboons (4.35%, 1/23) and squirrel monkey (3.33%, 1/30). The infection rates ranged from 3.33% to 100% in the nine NHPs species. The infection rates for chimpanzee in this study were higher than that reported in other studies [8, 15–17, 19]. Previous studies reported high infection rates in captive NHPs were concentrated on rhesus macaque (8.49%, 9/106), crab-eating macaque (38.89%, 7/18), pig-tailed macaque (56.25%, 9/16), ring-tailed lemur (57.78%, 26/45), green monkey (20.00%, 3/15), hussar monkey (31.25%, 5/16), yellow baboon (40.00%, 2/5), cheeked gibbon (38.89%, 14/36), and bornean orangutan (21.74%, 5/23) [8, 15–17]. However, the rhesus macaque, crab-eating macaque, pig-tailed macaque, green monkey, mandrill, hussar monkey and Francois' leaf monkey were all found negative in our present study. The variation of infection rate for G. duodenalis in different NHPs species needs more studies to elucidate. To date, assemblage A, B, and E have been identified in NHPs, with assemblage B dominating in China [8, 15–21]. In this study, all the G. duodenalis-positive specimens were assemblage B, which is consistent with previous studies [15, 16, 18]. Assemblage B is common in humans worldwide [6, 17, 27, 28]; therefore, NHPs may contribute to sporadic human infection [23, 24]. Of the 25 G. duodenalis-positive specimens, the bg, tpi, and gdh loci were successfully amplified and sequenced from 21, 21, and 20 specimens, respectively (Table 3). The bg, tpi, and gdh loci were highly polymorphic, with the greatest genetic variation at the tpi locus. Of the bg subtypes, three had previously been identified and the sequence of the remaining subtype BIII-1 (MK909127) was previously unpublished. Of the four tpi subtypes previously identified and the four remaining sequence subtypes, MB10-1 (MK909131), WB8-1 (MK909135), B14-1 (MK909136), and MB9-1(MK952610) were previously unpublished. Of the gdh subtypes, four were known and two had not been published (BIV-1 [MK952606] and DN7-1 [MK952598]). Twelve single nucleotide polymorphisms (SNPs) were detected within assemblage B at the bg / tpi / gdh loci (S2 Table). At the bg locus, two SNPs detected in isolate DLGB04. At the tpi locus, eight SNPs detected in six isolates (DLGT04, GYGT23, GYGT26, GYGT28, GYGT55 and SZGT10). At the gdh locus, two SNPs detected in three isolates (YZGG05, YZGG06 and GYGG97). Extensive polymorphism at the bg, tpi, and gdh loci in this study may reflect the wide geographic distribution of fecal samples. Previous studies demonstrated more genetic variation at the tpi locus (11, 7, and 3 novel sub-assemblage, respectively) [16, 18, 21]; however, our previous study found more variation at the bg locus [15]. NHPs in seven zoos in China [8]and wild rhesus macaques in India [11] had more genetic variation at the bg locus. The reason for more genetic variations at the bg and tpi loci is not clear.
Table 3

Multi-locus sequences of bg, tpi and gdh genes for 25 G. duodenalis positive faecal samples.

Geographic source(China)IsolateHostSubtype / Host or source / GenBank accession numberMLGs
β-giardintpigdh
Chengdu ZooCDZOO36Golden monkeyBb-1/squirrel monkey/ KJ888974
CDZOO38Golden monkeyB14/rhesus macaque/KF679737
CDZOO39Golden monkeyBb-1/squirrel monkey/KJ888974B14/rhesus macaque/KF679737BIV/rhesus macaque/KF679731SW10#
CDZOO40Golden monkeyBb-1/squirrel monkey/KJ888974B14/rhesus macaque/KF679737BIV/japanese macaque/KF679730SW11#
CDZOO42Golden monkeyBb-1/squirrel monkey/KJ888974
CDZOO47Golden monkeyBb-1/squirrel monkey/KJ888974B14/rhesus macaque/KF679737B:DN2/Homo sapiens/MG746605SW12#
Changsha ZooCSZOO23Ring-tailed lemurBb-4/ring-tailed lemur/ KJ888977BIV/Homo sapiens/HG970113BIV/japanese macaque/KF679730SW13#
CSZOO41Ring-tailed lemurBb-4/ring-tailed lemur/ KJ888977BIV/Homo sapiens/HG970113Bh-2/ring-tailed lemur/KJ888982SW14#
Dalian ZooDLZOO1/DLZOO8ChimpanzeeB3 like4/Homo sapiens/KT948089MB2/rhesus macaque/KF679740Bh-1/squirrel monkey/KJ888981SW15
DLZOO2Golden monkeyB3 like4/Homo sapiens/KT948089MB2/rhesus macaque/KF679740Bh-1/squirrel monkey/KJ888981SW15
DLZOO4Ring-tailed lemurBIII-1/lemur catta/MK909127#MB10-1/lemur catta/MK909131#
Guiyang Forest Wildlife ZooGYZOO23Golden monkeyB/Homo sapiens/FJ560593WB8-1/golden monkey/MK909135#BIV/rhesus macaque/KF679731SW16#
GYZOO24Golden monkeyB3 like4/Homo sapiens/KT948089BIV/Homo sapiens/HG970113BIV/rhesus macaque/KF679731SW17#
GYZOO25Golden monkeyB/Homo sapiens/KT948096
GYZOO26/GYZOO28Golden monkeyBb-1/squirrel monkey/KJ888974B14-1/golden monkey/MK909136#BIV/japanese macaque/KF679730SW18#
GYZOO55BaboonsB/Homo sapiens/FJ560593WB8-1/baboons/MK909135#
GYZOO97White-cheeked gibbonBIV-1/rhesus macaque/MK952606#
Suzhou ZooSZZOO3Japanese macaqueB3 like4/Homo sapiens/KT948089BIV/Homo sapiens/HG970113BIV/rhesus macaque/KF679729SW19#
SZZOO5Ruffed LemurB3 like4/Homo sapiens/KT948089BIV/Homo sapiens/HG970113BIV/rhesus macaque/KF679729SW19#
SZZOO9Africa Black-and-white ColobusB3 like4/Homo sapiens/KT948089MB9/ring-tailed lemur/KJ888985BIV/japanese macaque/KF679730SW20#
SZZOO10Ring-tailed lemurMB9-1/ring-tailed lemur/MK952610#Bh-2/ring-tailed lemur/KJ888982
Yangzhou ZooYZZOO5Squirrel monkeyB3 like4/Homo sapiens/KT948089BIV/Homo sapiens/HG970113DN7-1/squirrel monkey/MK952598#SW21#
YZZOO6Ring-tailed lemurB3 like4/Homo sapiens/KT948089BIV/Homo sapiens/HG970113DN7-1/ring-tailed lemur/MK952598#SW21#

“#”: Novel subtypes and novel MLGs: “MLG-SW” follow by our previous study [15].

“#”: Novel subtypes and novel MLGs: “MLG-SW” follow by our previous study [15]. To better understand the diversity of G. duodenalis infection, we used multilocus genotyping. Seventeen isolates from NHPs yielded 12 MLGs (MLG-SW10 to MLG-SW21). The most common MLG was MLG-SW15 (17.65%, 3/17), followed by MLG-SW18 (11.76%, 2/17), MLG-SW19 (11.76%, 2/17), and MLG-SW21 (11.76%, 2/17). The remaining MLGs were only detected in one specimen. Moreover, seven MLGs (MLG-SW10-12, 15–18) were identified in golden monkeys and three types of MLGs (MLG-SW13, 14, 21) were identified in ring-tailed lemurs. More MLGs detected in golden monkeys and ring-tailed lemurs implies a higher relative genetic diversity [8]. A phylogenetic, evolutionary tree based on concatenated sequences was constructed to better understand the diversity and relationship between MLGs in NHPs and humans (Fig 2). Of the 12 MLGs we identified, 11 clustered with the NHPs isolates and 1 MLG (MLG21) clustered with human isolates from Sweden. The MLGs formed two main clades, MLG-SW (10–12, 18) and MLG-SW (13, 14, 16, 17). MLG-SW (15, 19, 20, 21) was scattered throughout the phylogenetic tree. The role of NHPs in the transmission of G. duodenalis to humans is not clear; however, the occurrence of assemblage B detected in captive NHPs suggests transmission from humans or an adaptation to primate host [4, 8].
Fig 2

Phylogenetic relationship of G. duodenalis assemblage B multilocus genotypes (MLGs) inferred by the neighbor-joining analysis of concatenated bg, tpi, and gdh sequences.

Reference sequences used are from the studies by Karim et al.[8], Levecke et al.[12], Zhong et al.[15], Chen et al.[18], Ye et al.[21], Lebbadet al.[28] and Du et al.[30]. Bootstrap values greater than 50% from 1000 replicates are shown. Concatenated sequences from this study are marked by filed roundness.

Phylogenetic relationship of G. duodenalis assemblage B multilocus genotypes (MLGs) inferred by the neighbor-joining analysis of concatenated bg, tpi, and gdh sequences.

Reference sequences used are from the studies by Karim et al.[8], Levecke et al.[12], Zhong et al.[15], Chen et al.[18], Ye et al.[21], Lebbadet al.[28] and Du et al.[30]. Bootstrap values greater than 50% from 1000 replicates are shown. Concatenated sequences from this study are marked by filed roundness.

Conclusion

This study evaluated the occurrence of G. duodenalis in NHPs from 12 zoos distributed across 8 provinces and 2 municipalities (Chongqing and Beijing) in China. All G. duodenalis infections belonged to assemblage B, including seven novel subtypes: BIII-1, MB10-1, WB8-1, B14-1, MB9-1, DN7-1, and BIV-1. The tpi locus was the most genetically heterogeneous of the three loci evaluated. Multilocus genotyping identified twelve different assemblage B MLGs (one known MLG and eleven novel MLGs), implied relative higher genetic diversity. This study enlarge our understanding using multilocus genotyping of Giardia infection for captive NHPs from 12 zoos in China. Further research on the potential spread of NHPs G. duodenalis to humans needed more data to elucidate.

Occurrence of Giardia duodenalis in different species of nonhuman primates.

(DOC) Click here for additional data file.

Variations in bg, tpi and gdh nucleotide sequences among the subtypes of Giardia duodenalis assemblage B from NHPs.

(DOCX) Click here for additional data file. 10 Oct 2019 PONE-D-19-24653 Infection prevalence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China PLOS ONE Dear Dr. Zhong, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Nov 24 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Hesham Hesham M. Al-Mekhlafi, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript Zhang et al report the molecular epidemiology of the diarrhoea-causing enteric protozoan parasite Giardia duodenalis infecting captive non-human primates in 12 zoological Gardens in China. Detection of the parasite was conducted from faecal samples by PCR methods targeting partial fragments of the gdh, bg, and tpi loci. This multilocus genotyping approach allowed the identification of novel genetic variants of the parasite. Overall, this study has certain epidemiological relevance, although there are a number of issues that need addressing (see below). Major issues 1. Detection of the parasite was based on single-copy genes. These genes are particularly suited for genotyping analyses, but their use as diagnostic tools is hampered by limited sensitivity. For this particular purpose a PCR method targeting the multiple-copy ssu rRNA locus of the parasite would yield a higher number of positive results. In practical terms this means that the infection rates reported here are very likely an underestimation of the true figures. This issue should me mentioned as a limitation of the study in the Discussion section. 2. The term ´prevalence´ is probably not appropriate in this survey, as in 7/12 zoos only24 or less faecal samples were collected. I would suggest replacing the term by infection rate or occurrence rate. Same comment for the title of the paper. 3. Abstract section, lines 42-43: please provide more information about how the nomenclature used to name MLGs were chosen. For instance, what is the meaning of SW? It seems that the nomenclature used here is quite arbitrary. Please clarify. 4. Introduction section: please provide more information regarding the current molecular epidemiological situation of G. duodenalis infections in human and non-human primates in China. Briefly describe the range of prevalence rates reported in the literature, the diversity and frequency of assemblages/sub-assemblages identified, and any relevant differences between geographical locations and, if available, between captive and free-living NHP. Mention also if there is information regarding potential zoonotic transmission events between NHP and HP (or vice versa). This information would help the interested read to have a better picture of the current status of the infection in China. 5. M&M section: the Sample collection sub-section is poorly described. Please clearly state how zoological gardens were selected, approached and invited to participate in the survey. Which were the inclusion/exclusion criteria for selecting samples? Did the investigated NHP present any clinical manifestation (e.g. diarrhoea) at the moment of sampling? Did the Authors investigate the occurrence of other enteric pathogens? Please develop. 6. M&M section: the description of the molecular methods used in the present study for the detection and genotyping of Giardia duodenalis are poorly described. Please note that enough information should be provided here to enable the interested reader to repeat the experiments without the need of checking primary sources. Please thoroughly describe primer sequences, reagent concentrations, cycling conditions, and equipment used. Indicate also the percentage of the agarose gels used during electrophoresis. 7. M&M section: regarding sequencing, please clarify whether sequencing was conducted in both directions or not. Also, did the Authors check for the presence of ambiguous positions (double peaks) during chromatogram inspection? SNPs are frequently reported at the three loci investigated in the present survey. Importantly, please confirm that only sequences without double peaks were used in the phylogenetic analyses, as the presence of ambiguous positions would bias the analysis. I was unable to check this point as provided GenBank accession numbers are not accessible yet. 8. Results section: data presented in the paper do not allow to identify the genetic diversity fount in the gdh, bg, and tpi sequences generated in the present study. I would recommend conducting multiple sequence alignment analysed with appropriate reference sequences to identify SNPs. These results can be shown as a new Figure, or summarized in a Table. 9. Table 2 only shows results for 23 NHP, not 25 as indicated in the legend and the main body of the manuscript. Also, isolates described at the bg locus are indicated as B3 or BIII. Are those the same? If necessary, please standardise the nomenclature to avoid confusion in naming assemblages and sub-assemblages. Minor issues 1. Line 51: Giardia duodenalis (in full at the beginning of a sentence). Same comment for lines 53, 56, etc. Please amend. 2. Line 88: Amplicons of the expected size were… 3. Line 127: Giardia should be italicised. Reviewer #2: The study expanded to wider area in China and included a greater number of zoos compared with the author’s previous study published in 2017. However, besides reporting of new genotypes, there are no in-depth analyses or good number of positive samples available that can contribute conclusive information that related to geographic segregation, host-adaptation and impacts on transmission. 1. Line 84-86: Please further explain automatic gel electrophoresis analysis by Giardia PCR. 2. The title of table 1 do not sound right, the presentation of the data should be improved. Suggest combine location and species infection rate (S1 Table) to make it more comprehensive and include the species infection rate in the discussion. Eg. The high infection rate of ring-tailed lemur (31.25), it’s from a single or multiple zoos? 3. The prevalence of giardiasis ranged from 0 to 40%, any background information of the zoo eg. Environment, management to explain? 4. Line 108-115: The overall prevalence rate is 8.3%, again it’s ranged from 0-40% from different zoos, it’s not meaningful to compare this overall rate with single-centre/ single-location study from previous papers. 5. Since the samples were collected from different provinces, perhaps a map can be included to show where the samples were collected alongside with the phylogenetic tree. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: David Carmena Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 21 Nov 2019 Response to Reviewer: Thank you to the reviewers for their time and thoughtful comments, many of which have been incorporated into the revised manuscript. This revision was carried out according to the suggestions of the reviewers. Detailed comments are as follows. Reviewer #1: Major 1. Detection of the parasite was based on single-copy genes. These genes are particularly suited for genotyping analyses, but their use as diagnostic tools is hampered by limited sensitivity. For this particular purpose a PCR method targeting the multiple-copy ssu rRNA locus of the parasite would yield a higher number of positive results. In practical terms this means that the infection rates reported here are very likely an underestimation of the true figures. This issue should me mentioned as a limitation of the study in the Discussion section. Answer: Thanks for your comments. We added some description about the limitation of our present method in the Discussion section and highlighted it in the revised tracked-manuscript. (lines 149 -151) 2. The term ´prevalence´ is probably not appropriate in this survey, as in 7/12 zoos only24 or less faecal samples were collected. I would suggest replacing the term by infection rate or occurrence rate. Same comment for the title of the paper. Answer: Thanks for your comments. We modified the term ´prevalence´ into ´occurrence´and highlighted it in the revised manuscript. 3. Abstract section, lines 42-43: please provide more information about how the nomenclature used to name MLGs were chosen. For instance, what is the meaning of SW? It seems that the nomenclature used here is quite arbitrary. Please clarify. Answer: Thanks for your comments. The nomenclature used to name MLGs in the present study was consistent with our previous study [1] and the meaning of SW (southwest) is a number name which used in our laborary for the NHP samples. Our lab located in the southwest of China.(lines 212-213) 4. Introduction section: please provide more information regarding the current molecular epidemiological situation of G. duodenalis infections in human and non-human primates in China. Briefly describe the range of prevalence rates reported in the literature, the diversity and frequency of assemblages/sub-assemblages identified, and any relevant differences between geographical locations and, if available, between captive and free-living NHP. Mention also if there is information regarding potential zoonotic transmission events between NHP and HP (or vice versa). This information would help the interested read to have a better picture of the current status of the infection in China. Answer: Thanks for your comments. We added some description about the epidemiological situation of G. duodenalis infections in non-human primates, potential zoonotic transmission events between NHP and HP. All the changes were highlighted in the revised manuscript (line 59-71). 5. M&M section: the Sample collection sub-section is poorly described. Please clearly state how zoological gardens were selected, approached and invited to participate in the survey. Which were the inclusion/exclusion criteria for selecting samples? Did the investigated NHP present any clinical manifestation (e.g. diarrhoea) at the moment of sampling? Did the Authors investigate the occurrence of other enteric pathogens? Please develop. Answer: Thanks for your comments. In this study, we initially selected zoos in each of the nine geographical regions (Central China, North China, East China, South China, West China, Northwestern China, Northeastern China, Southwest China, Southeastern China) of China, but only get 12 zoos permission to collect samples. The 12 zoos were distributed in seven different geographical divisions [Central China: Hunan province (Changsha Zoo); North China: Beijing (Beijing Zoo); East China: Jiangsu province ( Suzhou Zoo, Yangzhou Zoo and Nanjing Zoo); Southern China: Guangdong province (Guangzhou Zoo); Northwestern China: Shaanxi (Shaanxi Rare and Wildlife Zoo); Northeastern China: Liaoning province (Dalian Zoo); Southwest China: Sichuan province (Chengdu Zoo), Chongqing (Chongqing Zoo), Guizhou province (Guiyang Forest Wildlife Zoo), Yunnan province (Kunming Zoo)]. We added a map to better illustrate the location of the zoos in the revised manuscript (Fig 1) ( lines 94 -95). All animals sampled in this study were collected by visiting once. At the time of faecal collections, there were no reported cases of diarrhoea in the zoos. In present study, we only focus on the occurrence of G. duodenalis infections in non-human primates. We added relevant description and highlighted it in the revised manuscript( lines 85-89). 6. M&M section: the description of the molecular methods used in the present study for the detection and genotyping of Giardia duodenalis are poorly described. Please note that enough information should be provided here to enable the interested reader to repeat the experiments without the need of checking primary sources. Please thoroughly describe primer sequences, reagent concentrations, cycling conditions, and equipment used. Indicate also the percentage of the agarose gels used during electrophoresis. Answer: Thanks for your comments. We added relevant description and Table 1 (including primer sequences, annealing temperatures and the fragment lengths of the genes used in this study) to give the details for readers. All the changes were highlighted in the revised manuscript (line103-107 and line123-125 ). 7. M&M section: regarding sequencing, please clarify whether sequencing was conducted in both directions or not. Also, did the Authors check for the presence of ambiguous positions (double peaks) during chromatogram inspection? SNPs are frequently reported at the three loci investigated in the present survey. Importantly, please confirm that only sequences without double peaks were used in the phylogenetic analyses, as the presence of ambiguous positions would bias the analysis. I was unable to check this point as provided GenBank accession numbers are not accessible yet. Answer: Thanks for your comments. The PCR products were sequenced in both directions and the information was involved in our revised manuscript (line 110-111). Sequences with ambiguous positions (double peaks) were not included in this study. 8. Results section: data presented in the paper do not allow to identify the genetic diversity fount in the gdh, bg, and tpi sequences generated in the present study. I would recommend conducting multiple sequence alignment analysed with appropriate reference sequences to identify SNPs. These results can be shown as a new Figure, or summarized in a Table. Answer: Thanks for your comments. We added a table about SNPs as a supplementary (S2 Table) and relevant description in the revised manuscript (line 188-193). 9. Table 2 only shows results for 23 NHP, not 25 as indicated in the legend and the main body of the manuscript. Also, isolates described at the bg locus are indicated as B3 or BIII. Are those the same? If necessary, please standardise the nomenclature to avoid confusion in naming assemblages and sub-assemblages. Answer: Thanks for your comments. There were indeed 25 G. duodenalis-positive samples, including two chimpanzee (DLZOO1/DLZOO8) and two golden monkey (GYZOO26/GYZOO28). B3 and BIII are two different subtypes, from two references and named differently[2, 3]. Minor 1. Line 51: Giardia duodenalis (in full at the beginning of a sentence). Same comment for lines 53, 56, etc. Please amend. Answer: Thanks for your comments. We corrected the mistake and highlighted it in the revised manuscript. 2. Line 88: Amplicons of the expected size were… Answer: Thanks for your comments. Amplicons of the expected size of three genes (bg, tpi, gdh) were 530, 530 and 511. We added Table 1 which included this information in the revised manuscript. 3. Line 127: Giardia should be italicised. Answer: Thanks for your comments. We corrected the mistake and highlighted it in the revised manuscript. Reviewer #2: ========= 1. Line 84-86: Please further explain automatic gel electrophoresis analysis by Giardia PCR. Answer: Thanks for your comments. This was our statement error, we corrected the mistake and highlighted it in the revised manuscript.( lines 107 -108). 2. The title of table 1 do not sound right, the presentation of the data should be improved. Suggest combine location and species infection rate (S1 Table) to make it more comprehensive and include the species infection rate in the discussion. Eg. The high infection rate of ring-tailed lemur (31.25), it’s from a single or multiple zoos? Answer: Thanks for your comments. We added the positive NHPs species (n) in table 1 (now it is table 2) and relevant discussion about infection rates of NHPs. We use Table 2 to show the difference infention rate in twelve Zoo, while S1 Table is main to show the results for 32 NHPs species infection, it’s convenient for readers to get more useful information for the 12 Zoos and 32 different NHP species infection. All the changes were highlighted.( lines 154-169). 3. The prevalence of giardiasis ranged from 0 to 40%, any background information of the zoo eg. Environment, management to explain? Answer: Thanks for your comments. We add the more information about the information of the 12 zoos (line 85-89). 4. Line 108-115: The overall prevalence rate is 8.3%, again it’s ranged from 0-40% from different zoos, it’s not meaning to compare this overall rate with single-centre/ single-location study from previous papers. Answer: Thanks for your comments. We delect the content about comparing with single zoo, we rewrite this parts of the content about the details of occurrence rates of G. duodenalis infection (single vs single, overall rate vs overall rate) ( lines 127-147). 5. Since the samples were collected from different provinces, perhaps a map can be included to show where the samples were collected alongside with the phylogenetic tree. Answer: Thanks for your comments. We added a map (Fig 1) and related contents which were highlighted in the revised manuscrip ( lines 86, and 94-95). References 1.Zhong Z, Tian Y, Li W, Huang X, Deng L, Cao S, et al. Multilocus genotyping of Giardia duodenalis in captive non-human primates in Sichuan and Guizhou provinces, Southwestern China. PLoS One. 2017;12(9):e0184913. doi: 10.1371/journal.pone.0184913. PMID: 28910395. 2.Coronato Nunes B, Pavan MG, Jaeger LH, Monteiro KJ, Xavier SC, Monteiro FA, et al. Spatial and Molecular Epidemiology of Giardia intestinalis Deep in the Amazon, Brazil. PLoS One. 2016;11(7):e0158805. Epub 2016/07/09. doi: 10.1371/journal.pone.0158805.PMID: 27392098.Wegayehu, T. 3.Karim, M. R. Li, J. Adamu, H. Erko, B. Zhang, L. Tilahun, G, et al. Multilocus genotyping of Giardia duodenalis isolates from children in Oromia Special Zone, central Ethiopia. BMC Microbiol. 2016. 16(1).doi: 10.1186/s12866-016-0706-7. PMID: 27209324. Submitted filename: Response to Reviewers.docx Click here for additional data file. 7 Jan 2020 PONE-D-19-24653R1 Occurrence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China PLOS ONE Dear Dr. Zhong, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Feb 21 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Hesham Hesham M. Al-Mekhlafi, PhD Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Lines 78-91: In my initial appraisal, I requested information about how zoological gardens were selected, approached, and invited to participate in the study. I also requested information regarding the inclusion/exclusion criteria for selecting samples, and the presence/absence of other parasitic, viral, and bacterial infections. None of these have been addressed in the revised version of the manuscript. Amend. Lines 149-151: please note that this statement does not fully clarify the initial issue. Please clearly state here that PCR protocols based on single-copy genes (e.g. gdh, bg, and tpi) had considerable lower diagnostic sensitivities than those based on multiple-copy genes (e.g. ssu). In practical terms, this means that infection rates reported in the present study are an underestimation of the true ones. Amend. Sequence analyses: please clearly state in the text that sequences with ambiguous positions (double peaks) were not included in the phylogenetic analyses. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: David Carmena [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 13 Jan 2020 Response to Reviewer: Thank you to the reviewers for their time and thoughtful comments, many of which have been incorporated into the revised manuscript. This revision was carried out according to the suggestions of the reviewers. Detailed comments are as follows. Reviewer #1: Major 1.Lines 78-91: In my initial appraisal, I requested information about how zoological gardens were selected, approached, and invited to participate in the study. I also requested information regarding the inclusion/exclusion criteria for selecting samples, and the presence/absence of other parasitic, viral, and bacterial infections. None of these have been addressed in the revised version of the manuscript. Amend. Answer: Thanks for your comments. Some related description are add in both Intrduction and Sample collection section, and highlighted them in the revised tracked-manuscript. (line 74-81, line 90-92 and line 95-98) To date, most Chinese studies evaluating G. duodenalis infection in NHPs have focused on a single zoo or localized area. In this project, ongoing epidemiological surveys on intestinal zoonotic parasites of G. duodenalis, expanded previous studies to large-scale investigation of zoos and NHP species in China. As our last replied in the MS R1 version, in this study we only get 12 zoos permission to collect samples. The 12 zoos were distributed in seven different geographical divisions [Central China: Hunan province (Changsha Zoo); North China: Beijing (Beijing Zoo); East China: Jiangsu province ( Suzhou Zoo, Yangzhou Zoo and Nanjing Zoo); Southern China: Guangdong province (Guangzhou Zoo); Northwestern China: Shaanxi (Shaanxi Rare and Wildlife Zoo); Northeastern China: Liaoning province (Dalian Zoo); Southwest China: Sichuan province (Chengdu Zoo), Chongqing (Chongqing Zoo), Guizhou province (Guiyang Forest Wildlife Zoo), Yunnan province (Kunming Zoo)]. Our present project evaluated 302 NHP fecal samples (including 32 primate species) from 12 zoos distributed across eight Chinese provinces and two municipalities (Chongqing and Beijing), to better understand G. duodenalis infection in captive NHPs throughout China. In this project, we only focus on the occurrence of G. duodenalis infections in non-human primates, the presence/absence of other parasitic, viral, and bacterial infections is unknown. The 12 zoos have adequate facilities to accommodate the different species of primates in indoor enclosure, different species live on separated places. The 12 zoos are distributed throughout China (Fig 1), and the feed managements are all according to the Standard Rule of Chinese Association of Zoological Gardens. 2.Lines 149-151: please note that this statement does not fully clarify the initial issue. Please clearly state here that PCR protocols based on single-copy genes (e.g. gdh, bg, and tpi) had considerable lower diagnostic sensitivities than those based on multiple-copy genes (e.g. ssu). In practical terms, this means that infection rates reported in the present study are an underestimation of the true ones. Amend. Answer: Thanks for your comments. We added relevant description and highlighted it in the revised manuscript. (lines 162-164, lines 166-167) 3.Sequence analyses: please clearly state in the text that sequences with ambiguous positions (double peaks) were not included in the phylogenetic analyses. Answer: Thanks for your comments. We added relevant description and highlighted it in the revised manuscript. (lines 127-128) Submitted filename: Response to Reviewers.docx Click here for additional data file. 22 Jan 2020 Occurrence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China PONE-D-19-24653R2 Dear Dr. Zhong, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Hesham Hesham M. Al-Mekhlafi, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 24 Jan 2020 PONE-D-19-24653R2 Occurrence and multilocus genotyping of Giardia duodenalis in captive non-human primates from 12 zoos in China Dear Dr. Zhong: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Hesham M. Al-Mekhlafi Academic Editor PLOS ONE
  30 in total

Review 1.  Giardia taxonomy, phylogeny and epidemiology: Facts and open questions.

Authors:  Judit Plutzer; Jerry Ongerth; Panagiotis Karanis
Journal:  Int J Hyg Environ Health       Date:  2010-07-08       Impact factor: 5.840

2.  Occurrence of human-pathogenic Enterocytozoon bieneusi, Giardia duodenalis and Cryptosporidium genotypes in laboratory macaques in Guangxi, China.

Authors:  Jianbin Ye; Lihua Xiao; Jian Li; Weiyi Huang; Said E Amer; Yaqiong Guo; Dawn Roellig; Yaoyu Feng
Journal:  Parasitol Int       Date:  2013-10-22       Impact factor: 2.230

3.  Molecular detection and prevalence of Giardia duodenalis and Cryptosporidium spp. among long-tailed macaques (Macaca fascicularis) in Thailand.

Authors:  Wanat Sricharern; Tawin Inpankaew; Sarawan Keawmongkol; Juthamas Supanam; Roger W Stich; Sathaporn Jittapalapong
Journal:  Infect Genet Evol       Date:  2016-02-16       Impact factor: 3.342

Review 4.  Zoonotic potential of Giardia.

Authors:  Una Ryan; Simone M Cacciò
Journal:  Int J Parasitol       Date:  2013-07-13       Impact factor: 3.981

5.  Black and gold howler monkeys (Alouatta caraya) as sentinels of ecosystem health: patterns of zoonotic protozoa infection relative to degree of human-primate contact.

Authors:  Martin M Kowalewski; Johanna S Salzer; Joseph C Deutsch; Mariana Raño; Mark S Kuhlenschmidt; Thomas R Gillespie
Journal:  Am J Primatol       Date:  2011-01       Impact factor: 2.371

Review 6.  An up-date on Giardia and giardiasis.

Authors:  Elin Einarsson; Showgy Ma'ayeh; Staffan G Svärd
Journal:  Curr Opin Microbiol       Date:  2016-08-06       Impact factor: 7.934

7.  Genetic diversity of Giardia duodenalis: multilocus genotyping reveals zoonotic potential between clinical and environmental sources in a metropolitan region of Brazil.

Authors:  Mauricio Durigan; Aluana Gonçalves Abreu; Maria Imaculada Zucchi; Regina Maura Bueno Franco; Anete Pereira de Souza
Journal:  PLoS One       Date:  2014-12-23       Impact factor: 3.240

8.  Genotypes and public health potential of Enterocytozoon bieneusi and Giardia duodenalis in crab-eating macaques.

Authors:  Li Chen; Jianguo Zhao; Na Li; Yaqiong Guo; Yuanyuan Feng; Yaoyu Feng; Lihua Xiao
Journal:  Parasit Vectors       Date:  2019-05-22       Impact factor: 3.876

9.  Cryptosporidium spp., Giardia intestinalis, and Enterocytozoon bieneusi in Captive Non-Human Primates in Qinling Mountains.

Authors:  Shuai-Zhi Du; Guang-Hui Zhao; Jun-Feng Shao; Yan-Qin Fang; Ge-Ru Tian; Long-Xian Zhang; Rong-Jun Wang; Hai-Yan Wang; Meng Qi; San-Ke Yu
Journal:  Korean J Parasitol       Date:  2015-08-25       Impact factor: 1.341

10.  Beaver Fever: Whole-Genome Characterization of Waterborne Outbreak and Sporadic Isolates To Study the Zoonotic Transmission of Giardiasis.

Authors:  Ruth Miller; Clement K-M Tsui; Miguel Uyaguari-Diaz; Patrick Tang; Cedric Chauve; William Hsiao; Judith Isaac-Renton; Natalie Prystajecky
Journal:  mSphere       Date:  2018-04-25       Impact factor: 4.389

View more
  2 in total

1.  Prevalence and multilocus genotyping of Giardia duodenalis in zoo animals in three cities in China.

Authors:  Yang Zou; Xiao-Dong Li; Yu-Meng Meng; Xiao-Long Wang; Hao-Ning Wang; Xing-Quan Zhu
Journal:  Parasitol Res       Date:  2022-06-08       Impact factor: 2.383

2.  Intestinal Protists in Captive Non-human Primates and Their Handlers in Six European Zoological Gardens. Molecular Evidence of Zoonotic Transmission.

Authors:  Pamela C Köster; Eva Martínez-Nevado; Andrea González; María T Abelló-Poveda; Hugo Fernández-Bellon; Manuel de la Riva-Fraga; Bertille Marquet; Jean-Pascal Guéry; Tobias Knauf-Witzens; Annika Weigold; Alejandro Dashti; Begoña Bailo; Elena Imaña; Aly S Muadica; David González-Barrio; Francisco Ponce-Gordo; Rafael Calero-Bernal; David Carmena
Journal:  Front Vet Sci       Date:  2022-01-04
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.