Congenital heart disease (CHD) is one of the most common birth defects and is a major cause of childhood morbidity and mortality (1). Most patients with CHD require surgery to correct these heart defects (2). Some complex CHDs require multiple open-heart surgeries; consequently, numerous heart patches for the repair of cardiac defects are needed (2). Despite significant progress in the development of various materials to make cardiac patches, including Dacron (3), Gore-Tex (4) and autologous (5) or bovine pericardium (6), significant drawbacks exist, including increased risk of immune response (7), calcification (6), thrombosis (8,9) and the lack of growth potential (10). Moreover, these materials may become fibrous calcified tissues that cannot degrade, thereby preventing simultaneous growth within the heart and loss of function over time (11). Hence, patients typically require reoperation, which may cause delayed recovery and could result in an increased economic burden to both the family and society (11). Therefore, optimal materials for heart patches should be able to inhibit the immune response, calcification and thrombosis, and support growth of native tissue (10).With the advantages of non-toxicity, biocompatibility and degradability, natural materials such as chitosan, collagen and gelatin have been used in various tissue engineering applications (12–14). These materials have shown good scaffold properties that allow for better mechanics and a significant influence on cellular behavior (12–14). However, the compositions of these materials are relatively simple and cannot provide a complete extracellular matrix (ECM) environment (15). On the other hand, ECM harvested from decellularized tissue lacks most of the immunogenicity but retains the majority of the ECM components (16). Previous studies showed that ECM, which is biocompatible, provides physical structural support and plays an essential role in providing signaling for cell attachment, proliferation and differentiation (17–19). Thus, the ideal biological scaffold would be made by a mixture of these two types of materials, and would be able to retain mechanical properties while also providing an extracellular matrix environment (20).Previous studies found that ECM can be harvested from tissues such as cartilage, skeletal muscle, tendons, adipose tissue, vessels, lung, liver, intestine (17,21,22) and bovine ureter (23), and may be applied as biological scaffolds with beneficial results. Previous studies in which porcine heart matrix was used for construction of tissue engineered heart patches demonstrated that porcine ECM could support cardiomyocytes, improved heart function and was capable of heart defect repair (24,25). However, ECM is frequently derived from non-cardiac or heart tissue of other species. The present study hypothesized that ECM from human heart tissue may have a higher biocompatibility. Therefore, the present study combined human cardiac (cECM) with biodegradable natural chitosan-gelatin (CG) for the construction of cardiac extracellular matrix-chitosan-gelatin (cECM-CG) composite scaffold and studied its characteristics.Thrombosis is a significant limitation of current grafts (8). Accumulating evidence showed that the endothelium, which maintains vessel integrity, plays an essential role in preventing thrombosis (26). Previous studies suggested that endothelial progenitor cells (EPCs), characterized by the ability to differentiate into endothelial cells, are a potential source of endothelial repair by participating in the process of endothelialization (27–29). Moreover, CD34+ cells are considered to be EPCs (30). A previous study showed that stent surfaces coated with antibodies against CD34, exhibited high affinity for EPC and could promote rapid endothelialization, prevent stent thrombosis and reduce restenosis (31). The present study hypothesized that CD34+ EPCs seeded on the scaffold of tissue-engineered heart patches could promote the scaffold endothelialization.The present study created a cECM-CG composite scaffold seeded with CD34+ EPCs intended for tissue-engineered heart patch. The present study investigated the characteristics of this scaffold, including its endothelialization.
Materials and methods
Cardiac tissue and bone marrow samples
Human right atrial appendage and bone marrow samples were collected after written informed consent from parents of pediatric patients was obtained. All experiments were approved by the Ethics Committee at Shanghai Children's Medical Center (approval no. SCMCIRB-K2016025). All investigations were conducted according to the principles expressed in the Declaration of Helsinki. Specimens of right atrial appendage and bone marrow of sternum were collected from the patients (including 22 females and 28 males; age, 1 month-3 years old) diagnosed as ventricular septal defect (VSD) or atrial septal defect (ASD) during open-heart surgery from May 2016 to May 2018 in our hospital. Right atrial appendages were processed for cECM preparation. Bone marrow was used to isolate CD34+ EPCs.
Preparation of cECM and scaffolds
Collected right atrial appendages were frozen in optimal cutting temperature compound, sectioned at 50 µm, and decellularized in 0.2% SDS solution for 12 h with constant shaking at 37°C. Subsequently, the tissues were stirred in 200 mg/l DNase I solution for 30 min at 37°C. Finally, the decellularized cardiac tissue was rinsed with deionized water until complete removal of detergents. The ECM was lyophilized, quantified and milled into fine powder (32). Then, 2% chitosan and 2% gelatin were prepared. Chitosan (cat. no. 1105508; Sigma-Aldrich; Merck) was added to 1% glacial acetic acid. The solution was shaken at 37°C for 12 h to ensure complete solubilization. Gelatin (cat. no. 1288485, Sigma-Aldrich; Merck) was dissolved in deionized water and incubated in a water bath at 50°C for 15 min. Subsequently, chitosan and gelatin were mixed at a ratio of 2:1. The cECM powder was added to the chitosan and gelatin mixture solution, and was subsequently grounded using an ultrasonicator. The concentration of the cECM was 1.6 mg/ml.The CG mixture and the cECM-CG mixture were poured into a 96-well plate (50 µl/well). Subsequently, both mixtures were frozen at −80°C overnight, lyophilized for 24 h in a vacuum freeze-drier (VirtisBenchtop 6.6, SP Industries) to form porous scaffolds. The scaffolds were washed with ethanol to remove residual glacial acetic acid. Subsequently, the scaffolds were washed gently with PBS for five times (10 min each), and were sterilized by overnight incubation at room temperature using ultraviolet light in a cell culture hood.
Analysis of cECM components
Cardiac tissues before and after decellularization were fixed in 4% paraformaldehyde at 4°C for 24 h, embedded in paraffin, and cut into 5-µm thick sections. Sections were rinsed twice with xylene for 15 min and dehydrated with a descending alcohol series (100% alcohol for 5 min; 95% alcohol for 5 min; 75% alcohol for 5 min). Tissue was then stained with hematoxylin for 10 min and eosin for 5 min at room temperature.The sections were dewaxed, rehydrated, stained in Weigert's iron hematoxylin solution for 5 min at room temperature, washed. Sections were then treated with Van Gieson's solution for 3–5 min at room temperature. Finally, the tissue was dehydrated, cleared and sealed.The sections were dewaxed, rehydrated, stained in Weigert's iron hematoxylin solution at room temperature for 10 min, rinsed and washed. Sections were then stained in Biebrich scarlet-acid fuchsin solution at room temperature for 10–15 min, washed and then differentiated in phosphomolybdic-phosphotungstic acid solution for 10–15 min. The sections were transferred directly to aniline blue solution and stained for 5–10 min at room temperature, rinsed and differentiated in 1% acetic acid solution for 2–5 min at room temperature. Finally, the sections were dehydrated, cleared and sealed. The presence of the adhesive proteins fibronectin and laminin in cECM was assessed by immunohistochemical staining. Briefly, the slides were placed in citrate antigen retrieval buffer and heated to 95°C for 20 min. After cooling to room temperature, the sections were treated with 3% hydrogen peroxide solution for 20 min at room temperature and then incubated in a humidity chamber for 30 min with 10% (w/v) normal goat serum (cat. no. 016201; Invitrogen; Thermo Fisher Scientific, Inc.). Hereafter, sections were incubated with rabbit anti-fibronectin antibody (1:250; cat. no. ab32419; Abcam) at 4°C overnight. After sections were washed with PBS, goat anti-rabbit IgG H&L (HRP) (1:1,000; cat. no. ab6721; Abcam) was added for 30 min. Sections were then rinsed in PBS, and diaminobenzidine solution (DAB) was applied. After staining, slides were dehydrated, cover-slipped. All sections were imaged under a light Olympus CX31 microscope (magnification ×20; Olympus Corporation).
cECM quantification
Glycosaminoglycans (GAG) present in the cECM was measured using Glycosaminoglycans Assay kit (Chondrex, Inc). Briefly, samples before and after decellularization were weighed after lyophilization. Subsequently, lyophilized samples were digested and stained with 1, 9-dimethylmethylene blue (DMB) for 4 min at room temperature. A dilution series of chondroitin sulfate was used as standard. Absorbance was measured at 525 nm with a Synergy HT Microplate Absorbance Reader (BioTek Instruments, Inc.). The GAG content was normalized to the dry weight of the samples.DNA content was assayed using the tissue gDNA Miniprep kit (Biomiga, Inc.), and DNA concentration was determined by spectrophotometry (NanoDrop 2000c; Thermo Fisher Scientific, Inc.).
Determination of scaffold characteristics
Scanning electron microscope (SEM) was used to visualize the structure of the CG and cECM-CG scaffolds. Scaffolds were prepared by fixation with 2.5% glutaraldehyde for 2 h at room temperature, followed by dehydration with a series of ethanol rinses (30-100%). The samples were critical point dried and coated with iridium. Electron microscopy images were obtained using SEM (magnification, ×800; Quanta 2000; FEI; Thermo Fisher Scientific, Inc.).CG and cECM-CG scaffolds were created in a 96-well plate in triplicates. The dry weight (Wd) of both scaffolds was measured before they were transferred to a 24-well plate and allowed to swell in PBS. The swelled weight (Ws) was measured every 10 min for 1 h. Swelling ratios were calculated as follows: Swelling ratio = (Ws - Wd) / Wd.
Isolation and culture of CD34+ EPCs
Human bone marrow samples were collected from pediatric patients undergoing VSD or ASD surgery. Bone marrow mononuclear cells were collected using gradient centrifugation. Bone marrow was resuspended in Hank's balanced salt solution (GE Healthcare Life Sciences) and 20 µ/ml heparin (Sigma-Aldrich; Merck) and then centrifuged for 30 min at 400 g at room temperature. CD34+ EPCs were isolated from the mononuclear cells using magnetic cell sorting. Then the cells were seeded on the pre-prepared scaffolds at 37°C in CO2 incubator.
Flow cytometry analysis
To study the purity of sorted cells, freshly isolated CD34+ EPCs were collected for flow cytometry analysis. Briefly, cell suspensions were centrifuged at 300 × g for 5 min at 4°C, and cell pellets resuspended in PBS containing 1% BSA. Mouse Anti-HumanCD34 antibody (cat. no. 560710; BD Biosciences) was diluted to 1:100 in PBS. Samples were incubated for 30 min in the dark on ice, followed by two washing steps with PBS (centrifugation for 5 min at 300 × g after each washing step at 4°C). Finally, samples were subjected to flow cytometry analysis using Accuri C6 flow cytometer (BD Biosciences). Fluorescence was analyzed with CFlow Plus software (BD Biosciences).
Cell viability analysis
To investigate the viability of CD34+ EPCs cultured on the scaffolds, cell viability was analyzed 5 days after seeding using a viability assay. Cells were collected, washed with PBS, and incubated in 5 µmol/l calcein AM (labeling living cells; Thermo Fisher Scientific, Inc.) and 9 µmol/l propidium iodide (labeling dead cells; Thermo Fisher Scientific, Inc.) for 30 min at 37°C. Images of the stained samples were obtained using an optical microscope (Nikon Corporation). The number of living and dead cells was calculated based on three different fields of view (magnification, ×20).
Cell proliferation analysis
To identify the proliferative activity of CD34+ EPCs, Cells cultured on CG and cECM-CG scaffolds were stained with primary antibody Mouse anti-Ki67 IgG (1:200; cat. no. 561165; BD Biosciences, CA, USA) by overnight incubation at 4°C. Donkey anti-mouse IgG conjugated to Alexa 488 (1:500; cat. no. R37114; Invitrogen; Thermo Fisher Scientific, Inc.) was added as the secondary antibody and incubated for 1 h at room temperature. Cells were counterstained with DAPI for 15 min at room temperature. For the negative controls, cells were incubated in 5% donkey serum at room temperature (cat. no. 017-000-121; Jackson ImmunoResearch Laboratories, Inc.) instead of the primary antibody at 4°C overnight. Fluorescent images were acquired using a Nikon fluorescence microscope (magnification, ×20; Nikon Corporation).
MTT assay
Cells were incubated with CellTiter96® AQueous One Solution Reagent (Promega Corporation) at 37°C for 4 h after being cultured on CG and cECM-CG scaffolds for 1, 3, 5, 7, 10 and 14 days. The absorbance at 490 nm was measured using the Biotek Synergy HT Multi-Mode Microplate Reader (BioTek Instruments, Inc.).
Cell differentiation analysis and reverse transcription-quantitative PCR (RT-qPCR)
A comparative RT-qPCR analysis was performed for the endothelial cell-associated genes CD31, von Willebrand factor (vWF) and CD144. Primer sequences are presented in Table I. Cells seeded on the CG and cECM-CG scaffolds were collected at day 21 and RNA was isolated using Quick-RNA MicroPrep (Zymo Research Corp.). Extracted RNA concentration was measured by spectrophotometry (NanoDrop 2000; Thermo Fisher Scientific, Inc.), and 400 ng RNA was used for first-strand cDNA synthesis (First-Strand cDNA Synthesis Kit; Yeasen Technologies). Subsequently, RT-qPCR was performed using SYBR (Hieff qPCR SYBR Green Master Mix, High Rox Plus; Yeasen Technologies). The amplification reactions were performed with initial denaturation at 95°C for 5 min, followed by 40 cycles of two-step PCR at 95°C for 10 sec and 60°C for 30 sec. Primer specificity was determined based on the melt curve analysis. The housekeeping gene GAPDH was chosen for normalization. Fold change expression was calculated using 2−ΔΔCq (33). n=3 for each condition.
Table I.
Primers for reverse transcription-quantitative PCR.
Gene
Primer sequence (5′→3′)
GAPDH
F: CTCATTTCCTGGTATGACAACGA
R: CTTCCTCTTGTGCTCTTGCT
CD31
F: AACAGTGTTGACATGAAGAGCC
R: TGTAAAACAGCACGTCATCCTT
vWF
F: CCGATGCAGCCTTTTCGGA
R: TCCCCAAGATACACGGAGAGG
CD144
F: AAGCGTGAGTCGCAAGAATG
R: TCTCCAGGTTTTCGCCAGTG
vWF, von Willebrand factor; F, forward; R, reverse.
Immunofluorescence staining
To further identify the differentiation of the CD34+ EPCs into endothelial cells, at day 21 cultured cells were fixed in 4% paraformaldehyde for 15 min at room temperature, permeabilized in 0.5% Triton X-100, followed by blocking with 5% donkey serum (cat. no. 017-000-121; Jackson ImmunoResearch Laboratories, Inc.) for 1 h at room temperature and overnight incubation at 4°C with the following primary antibodies: Mouse anti-CD31 (1:200; cat. no. ab24590; Abcam), rabbit anti-vWF (1:200; cat. no. ab6994; Abcam). Then, secondary antibodies of donkey anti-mouse Alexa594 (1:500; cat. no. A32744; Invitrogen; Thermo Fisher Scientific, Inc.) and donkey anti-rabbit Alexa488 (1:500; cat. no. A-21206; Invitrogen; Thermo Fisher Scientific, Inc.) were added to the samples and incubated for 1 h at room temperature. Cell nucleus was counterstained using DAPI for 15 min at room temperature. Fluorescence was observed using a fluorescence microscope (magnification, ×40; Nikon Corporation).
In vitro tube formation assay
Tube formation assay was performed as described previously (34). Human umbilical vein endothelial cells (HUVECs; ScienCell Research Laboratories, Inc.) were serum starved overnight at 37°C in 1640 medium (cat. no. 72400120; Thermo Fisher Scientific, Inc.) without FBS. Matrigel (BD BioSciences) was thawed at 4°C overnight and added into the pre-chilled 96-well plate using cooled pipette tips. Each well was coated homogeneously with 50 µl Matrigel and incubated at 37°C with 5% CO2 for 1 h. Starved HUVECs were seeded at a density of 2×104/well and cultured with a different conditioned medium for 8 h at 37°C with 5% CO2. The conditioned medium was collected from the CD34+ EPCs cultured on the CG or cECM-CG scaffolds for 24 h in 1640 medium (cat. no. 72400120; Gibco; Thermo Fisher Scientific, Inc.) without FBS. Images were obtained using a phase-contrast light microscope (magnification, ×20; Olympus Corporation). Tube-forming capacity was quantified based on the total length of capillary-like structures and the total number of branch points. The experiment was repeated three times, with duplicate measurements of each condition in each experiment.
Statistical analysis
Statistical analyses were performed using SPSS 13.0 (SPSS Inc.) and GraphPad Prism 5.0 software (GraphPad Prism Software, Inc.). Each experiment was repeated ≥3 times. Data are presented as mean ± SEM. Student's t-test was used to analyze the data. P<0.05 was considered to indicate a statistically significant difference.
Results
Preparation and characterization of cECM and CG/cECM-CG scaffolds
To detect whether the decellularization process was complete and the main ECM components were retained, histologic and immunohistochemical analyses were performed. Histologic analysis showed that most of the cells were removed and the main cECM components were well preserved (Fig. 1A). Histology and immunohistochemistry analyses were used to evaluate the constructs of the cECM before and after decellularization (Fig. 1B-E). The components of the structural protein collagen (Fig. 1B) and elastic fiber (Fig. 1C) and the adhesive protein fibronectin (Fig. 1D) and laminin (Fig. 1E) present in the cECM were retained. DNA content analysis identified the complete decellularization process and removal of cell immunogenicity (Fig. 1F). Although the level of GAG was significantly decreased after decellularization, ~18% of the GAG could be preserved after decellularization (2.57±0.12 µg/mg before decellularization vs. 0.41±0.03 µg/mg after decellularization; Fig. 1G).
Figure 1.
Preparation and characterization of cECM and CG/cECM-CG scaffolds. Comparison of cECM composition of heart tissue before and after decellularization. (A) Hematoxylin and eosin staining was performed to confirm complete decellularization. Scale bar, 10 µm. (B) Masson staining was performed for collagen fiber evaluation, collagen fibers were stained blue. Scale bar, 50 µm. (C) Van Gieson staining was performed for elastic fiber evaluation, elastic fibers were stained yellow. Scale bar, 50 µm. Immunohistochemical staining of (D) fibronectin and (E) laminin, fibronectin and laminin were stained brown. Scale bar, 50 µm. (F) Statistical analysis of DNA content. n=3 in each group. (G) Statistical analysis of GAG content of heart tissue before and after decellularization. (H) Macrostructure of the scaffold. SEM analysis of (I) CG and (J) cECM-CG composite scaffolds. (K) Evaluation of the water absorption capacity of the scaffolds. GAG, glycosaminoglycans; cECM, cardiac extracellular matrix; CG, chitosan-gelatin; cECM-CG, cardiac extracellular matrix-chitosan-gelatin.
The gross appearance of the newly lyophilized scaffolds was white and uniform (Fig. 1H). Microstructures of the scaffolds were assessed using scanning electron microscopy; representative images are presented in (Fig. 1I and J). Both scaffolds presented uniform three-dimensional structures and similar pore sizes of 40–100 µm, which is sufficient for cell ingrowth and distribution on multiple layers (35).Water absorption ability, defined by the swelling ratio, was evaluated by comparing the dry and hydrated mass of CG and cECM-CG composite scaffolds. Both scaffolds presented a similar water uptake trend as both started swelling rapidly in the first 10 min, indicating good water absorption and retention capacity (Fig. 1K). However, the cECM-CG composite scaffold absorbed water 10 times its dry weight, whereas the CG scaffold absorbed only about 5 times its dry weight. The present results suggested that the addition of cECM may lead to increased water absorption capacity.
cECM-CG composite scaffolds promote survival and proliferation of CD34+ EPCs
Average purity of CD34+ EPCs isolated by MACS was 98% (and <99.2%) based on flow cytometry (Fig. 2A and B). Moreover, cell viability assay demonstrated the viability of CD34+ EPCs cultured on the scaffolds at day 5. Cells growing on both CG and cECM-CG composite scaffolds showed no dead cells, indicating that the scaffolds were non-toxic (Fig. 2C).
Figure 2.
Scaffold composited with cECM improves cell survival and promotes proliferation of CD34+ EPCs. (A) The population of the sorted cells. (B) The purity of CD34+ EPCs after magnetic cell sorting isolation. (C) Cell viability assay analyzed the viability of CD34+ EPCs seeded on the scaffolds at day 5 by fluorescence microscopy. Living cells were stained green by calcein-AM. Dead cells were stained red by propidium iodide. Scale bar, 20 µm. (D) Representative images of cell proliferation assessed by Ki67 immunofluorescence staining at day 10. Positive cells were stained green. Scale bar, 100 µm. (E) Proliferation was analyzed by MTT assay on days 1, 3, 5, 7, 10 and 14. n=3 in each group. (F) Percentage of Ki67 positive cells using immunofluorescence staining was calculated by counting the positive cells in three different and randomly chosen view fields. **P<0.01 vs. CG. cECM, cardiac extracellular matrix; CG, chitosan-gelatin; cECM-CG, cardiac extracellular matrix-chitosan-gelatin; EPC, endothelial progenitor cells.
Cells growing on the cECM-CG composite scaffold showed a significant increase in Ki67 expression level compared with those growing on the CG scaffold (Fig. 2D and F), which suggested that the cECM-CG composite scaffold could promote proliferation of CD34+ EPCs and had a better biocompatibility. Cell proliferation was also investigated by MTT assay on days 1, 3, 5, 7, 10 and 14. The proliferation of the CD34+ EPCs growing on the cECM-CG composite scaffold increased from day 1–14, reaching the maximal level on day 10. At all the time points, cECM-CG group exhibited a higher proliferation rate compared with the CG group (Fig. 2E). Therefore, the present results indicated that the cECM-CG scaffold promoted proliferation of bone marrow-derived CD34+ EPCs.
cECM-CG composite scaffolds promote differentiation of CD34+ EPCs
To investigate the differentiation capacity of CD34+ EPCs seeded on the scaffolds, cells were cultured on CG and cECM-CG composite scaffolds. After culturing for 21 days, RT-qPCR was performed. The present results indicated that the mRNA expression levels of CD31 (1.9±0.2-fold; P<0.05), vWF (3.0±0.3-fold; P<0.01) and CD144 (9.8±0.1-fold; P<0.001) of the CD34+ EPCs cultured on cECM-CG composite scaffold was significantly higher compared with cells cultured on CG scaffold (Fig. 3A). The differentiation of CD34+ EPCs cultured on the scaffolds was further investigated by immunofluorescence staining (Fig. 3D and E). At day 21, CD34+ EPCs cultured on cECM-CG scaffold showed a strong positive staining for endothelial marker CD31 and vWF compared with cells on CG scaffold. Differentiation rate of CD34+ EPCs cultured on the cECM-CG scaffold was significantly higher compared with the CG scaffold (Fig. 3B and C). The present results suggested that CD34+ EPCs can differentiate into endothelial cells and that the scaffold composited with cECM could promote this differentiation process.
Figure 3.
In vitro differentiation of CD34+ EPCs into endothelial cells cultured on CG and cECM-CG composite scaffolds. (A) Reverse transcription-quantitative PCR results showed that the CD34+ EPCs seeded on cECM-CG scaffold upregulated the gene expression levels of EC markers including CD31, vWF and CD144 on day 21, compared with cells seeded on CG scaffold. Percentages of (B) CD31-positive and (C) vWF-positive cells were calculated at day 21 in three different and randomly chosen view fields. CD34+ EPCs on cECM-CG scaffold showed a higher differentiation rate compared with CG. The experiment was repeated three times. Representative images of immunofluorescence staining of the expression levels of (D) CD31 and (E) vWF. Scale bar, 50 µm. *P<0.05, **P<0.01, ***P<0.001 vs. CG. cECM, cardiac extracellular matrix; CG, chitosan-gelatin; cECM-CG, cardiac extracellular matrix-chitosan-gelatin; EPC, endothelial progenitor cells; vWF, von Willebrand factor.
cECM-CG composite scaffold-based conditioned medium increases tube formation of HUVECs
In addition to the direct differentiation of CD34+ EPCs into endothelial cells, the present study investigated whether the cECM-CG composite scaffold-based conditioned medium could enhance endothelialization. The present results indicated that cECM-CG composite scaffold-based conditioned medium caused an increase in tube formation of HUVECs (Fig. 4A and B). Cells treated with a conditioned medium harvested from CD34+ cells cultured on cECM-CG composite scaffold showed an increasing number of branch points (Fig. 4C). Furthermore, the tube length of the cECM-CG composite scaffold group showed a significant increase compared with the CG scaffold group (Fig. 4D). The present results indicated that the cECM-CG composite scaffold seeded with CD34+ EPCs could promote tube formation of the HUVECs.
Figure 4.
cECM-CG composite scaffold-based conditioned medium increases tube formation of HUVECs. (A and B) Representative images of the tube formation capacity of HUVECs induced by conditioned medium from CD34+ cells cultured on (A) CG and (B) cECM-CG scaffolds. Scale bar, 100 µm. Quantitative analysis of the (C) branch points and (D) tube length of both groups. *P<0.05 vs. CG. CG, chitosan-gelatin; cECM-CG, cardiac extracellular matrix-chitosan-gelatin; EPC, endothelial progenitor cells; vWF, von Willebrand factor; HUVECs, human umbilical vein endothelial cells.
Discussion
The present study constructed a three-dimensional scaffold for tissue-engineered heart patch using human cECM, chitosan and gelatin. In addition, the present study investigated the characteristics and the endothelialization potential of the scaffold seeded with CD34+ EPCs.ECM, previously described as containing various groups of molecules forming a microenvironment and providing structural and biological support for cells, has been reported to be associated with tissue remodeling and mechanical function (3). The composition of the ECM consists of a mixture of various molecules which form a three-dimensional matrix (16). In previous studies, some ECM components such as collagen and elastin, were used for the construction of cardiac grafts to repair heart defects (36,37). Other studies used natural materials, such as chitosan and gelatin, for cardiac tissue engineering (14,38). However, due to their relatively simple composition, natural materials cannot fully mimic the composition and complex structure of the ECM (15). Previous studies have attempted to use decellularized ECM from different tissues, such as porcine-derived cECM and intestinal submucosal or adipose-derived ECM, as a scaffold for tissue engineering (18,24,39,40). Removal of cells expressing surface antigens leads to a significant reduction of immunogenicity (41). However, most of the ECM materials are derived from non-cardiac tissues or other species. Although ECM components are similar in many tissues, each tissue has its own distinct combination of molecules and has tissue-specific ECM architecture (42). Therefore, to the best of our knowledge, the most suitable tissue is human-derived heart tissue to develop a tissue-engineered heart patch for clinical use.In the present study, specimens of discarded human right atrial appendage were collected during heart surgery of pediatric patients with CHD. These tissue samples can be obtained regularly in hospitals and conveniently cryopreserved. Following mixing the human cardiac-derived ECM with chitosan and gelatin, the mixture was lyophilized and was used to develop a cECM-CG composite scaffold for use as a tissue-engineered heart patch. The present results indicated that the scaffold was a three-dimensional porous scaffold that could promote cell survival and proliferation of CD34+ EPCs. More importantly, the present results suggested that the cECM-CG composite scaffold could promote the differentiation of CD34+ EPCs, thus inducing the endothelialization of the scaffold. Decellularization of tissues involves a combination of physical, ionic, chemical and enzymatic processes (43). Importantly the decellularization agents should be tailored to different tissues. A previous study showed that the use of 1% SDS, an ionic agent, damaged the ECM components and negatively influenced their mechanical property (44). The present study decreased the concentration of SDS to 0.2%. The present results indicated that the main components of the ECM, such as the structural proteins collagen and elastic fiber and the adhesive proteins fibronectin and laminin, were well maintained, while most of the cells and DNA were removed after decellularization. The present results suggested that the proteins in the cECM, which mimicked the natural ECM structure and environment, were well preserved and the potential immunogenicity was mostly removed. Moreover, a scaffold should have a large surface area and be highly porous to ensure cell adhesion and transport of nutrients and metabolic wastes (45). The present cECM-CG composite scaffold was porous with a uniform pore size of 40–100 µm. The present scaffold had a strong water absorption capacity which may indicate high cell adhesion and proliferation, as well as exchange of substances between cells and the extracellular environment. Therefore, the present results suggested the cECM-CG composite scaffold could not only mimic the ECM environment but also indicated advantageous physical properties of porosity and efficient water absorption. Although human derived heart tissues may be the most suitable tissue for the engineering of a heart patch for clinical use, the heart tissues derived from humans were not sufficient to be used for the construction of the scaffold after decellularization. Therefore, the present study could not achieve scaffold for patient-specific use.Thrombosis is a significant limitation of current grafts, and accumulating evidence shows that endothelial cells play an essential role in preventing thrombosis by maintaining endothelium integrity (46). CD34+ cells were shown to be endothelial progenitor cells with the capability to differentiate into endothelial cells, thus participating in endothelialization (30). Previous studies have shown that seeding of CD34+ cells on grafts enhances endothelialization of the grafts (47). A previous study using a EPC CD34+ capture stent coated with CD34 antibodies used for congenital heart disease surgery demonstrated that the stent could capture EPCs, thereby inhibiting thrombosis by promoting endothelial formation (48). In the present study, human bone marrow-derived CD34+ EPCs were selected and seeded on CG and cECM-CG scaffolds. The present results suggested that CD34+ EPCs cultured on cECM-CG composite scaffold showed increased mRNA expression levels of endothelial cell markers CD31, vWF and CD144 at day 21. CD144 is often used as a marker to identify endothelial cells (49). Although freshly isolated bone marrow-derived CD34+ endothelial progenitor cells can also express a small amount of CD144, CD34+ endothelial progenitor cells acquire higher expression of CD144 when differentiating into endothelial cells. As shown in our previous study, the expression ratio of CD144 in freshly isolated bone marrow-derived CD34+ endothelial progenitor cells was only 1% (49). In present immunofluorescence staining and tube formation assay suggested that the cECM-CG composite scaffold promoted the differentiation of CD34+ EPCs and enhanced tube formation. The present results indicated that the combination of CD34+ EPCs and cECM-CG composite scaffold could facilitate endothelialization of the scaffold. The achievement of endothelialization of grafts is thought to be critically important for the prevention of graft thrombosis (50). Future studies should include testing of the characteristics of the present scaffold in vivo, which could lead to further improvements of the material.In conclusion, the present results suggested that the constructed cECM-CG composite scaffold provided advantageous properties and promoted cell survival and proliferation. Furthermore, seeding of CD34+ EPCs enhanced endothelialization of the scaffold. The present results indicated that the cECM-CG composite scaffold may potentially be used in heart tissue engineering research.
Authors: Deirdre E J Anderson; Katie P Truong; Matthew W Hagen; Evelyn K F Yim; Monica T Hinds Journal: Acta Biomater Date: 2019-01-10 Impact factor: 8.947
Authors: Jorge A Roacho-Pérez; Elsa N Garza-Treviño; Nidia K Moncada-Saucedo; Pablo A Carriquiry-Chequer; Laura E Valencia-Gómez; Elizabeth Renee Matthews; Víctor Gómez-Flores; Mario Simental-Mendía; Paulina Delgado-Gonzalez; Juan Luis Delgado-Gallegos; Gerardo R Padilla-Rivas; Jose Francisco Islas Journal: Life (Basel) Date: 2022-07-25