| Literature DB >> 32009146 |
Jia-Li Hu1,2, He Liang3, Hong Zhang1, Ming-Zhu Yang4, Wei Sun5,6, Peng Zhang3, Li Luo1, Jian-Xiong Feng1, Huajun Bai3, Fang Liu4, Tianpeng Zhang7, Jin-Yu Yang1, Qingsong Gao6, Yongkang Long5, Xiao-Yan Ma1, Yang Chen1, Qian Zhong1, Bing Yu1, Shuang Liao1, Yongbo Wang8, Yong Zhao7, Mu-Sheng Zeng1, Nan Cao4, Jichang Wang4, Wei Chen5, Huang-Tian Yang3, Song Gao1,9.
Abstract
Family with sequence similarity (FAM46) proteins are newly identified metazoan-specific poly(A) polymerases (PAPs). Although predicted as Gld-2-like eukaryotic non-canonical PAPs, the detailed architecture of FAM46 proteins is still unclear. Exact biological functions for most of FAM46 proteins also remain largely unknown. Here, we report the first crystal structure of a FAM46 protein, FAM46B. FAM46B is composed of a prominently larger N-terminal catalytic domain as compared to known eukaryotic PAPs, and a C-terminal helical domain. FAM46B resembles prokaryotic PAP/CCA-adding enzymes in overall folding as well as certain inter-domain connections, which distinguishes FAM46B from other eukaryotic non-canonical PAPs. Biochemical analysis reveals that FAM46B is an active PAP, and prefers adenosine-rich substrate RNAs. FAM46B is uniquely and highly expressed in human pre-implantation embryos and pluripotent stem cells, but sharply down-regulated following differentiation. FAM46B is localized to both cell nucleus and cytosol, and is indispensable for the viability of human embryonic stem cells. Knock-out of FAM46B is lethal. Knock-down of FAM46B induces apoptosis and restricts protein synthesis. The identification of the bacterial-like FAM46B, as a pluripotent stem cell-specific PAP involved in the maintenance of translational efficiency, provides important clues for further functional studies of this PAP in the early embryonic development of high eukaryotes.Entities:
Mesh:
Substances:
Year: 2020 PMID: 32009146 PMCID: PMC7049688 DOI: 10.1093/nar/gkaa049
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971
Crystallographic data collection and refinement
| xtFAM46B | |
|---|---|
|
| |
| Space group |
|
| Cell dimensions | |
| | 59.6, 76.1, 135.1 |
| α, β, γ (°) | 90, 96.5, 90 |
| Wavelength (Å) | 0.97915 |
| Resolution (Å)a | 47.1–2.69 (2.79–2.69) |
| No. reflections | 33266 (3214) |
|
| 0.083 (0.439) |
|
| 14.12 (3.65) |
| Completeness (%) | 99.2 (97.6) |
| Redundancy | 3.41 (3.36) |
|
| |
|
| 0.204/0.252 |
| No. atoms | |
| Protein | 7988 |
| Ligand/ion | 39 |
| Water | 40 |
|
| |
| Protein | 63.18 |
| Ligand/ion | 100.96 |
| Water | 44.02 |
| R.m.s. deviations | |
| Bond lengths (Å) | 0.002 |
| Bond angles (°) | 0.54 |
| Ramachandran | |
| Favored (%) | 96.5 |
| Outliers (%) | 0 |
aNumbers in parentheses represent values from the highest resolution shell.
Figure 1.Overall structure of FAM46B. (A) Schematic representation showing the organization of crystallized construct based on full-length FAM46B. NCD, N-terminal catalytic domain; HD, helical domain. Borders of each domain are indicated by residue numbers. (B) Structure of FAM46B. Domains of FAM46B are indicated and colored as in A. The two featured β-hairpin is colored gray. (C) Surface representation of FAM46B with the inter-domain cleft indicated by dashed ellipse. (D–G) Interactions between NCD and HD. Side chains of involved residues are shown as ball-and-stick models in the same color as the domains they belong to.
Figure 2.Structural details of FAM46B domains. (A) Overall structure of NCD with secondary elements assigned. The NTase core is specified in orange. (B) The ambient interactions of the featured β-hairpin in FAM46B NCD. (C) The local hydrophobic cluster next to the NTase core. Side chains of involved residues are shown as ball-and-stick models. (D) Overall structure of HD. (E) Hydrophobic interactions that stabilize HD.
Figure 3.FAM46B is a bacterial-like PAP. (A) Structural comparison between FAM46B and ecPAP (left) or tmCCA (right). FAM46B (magenta) is separately superimposed with ecPAP (Protein Data Bank code 3AQM, pale cyan) and tmCCA (3H39, teal). The r.m.s.d. values of aligned Cα atoms are shown. The body and tail domains of ecPAP and tmCCA are colored grey. (B) The topology diagram of the FAM46B NCD (top), as compared with those of the head domains of ecPAP (middle) and tmCCA (bottom), colored as in A. (C) The phylogenetic analysis revealing a close relationship between FAM46 proteins and bacterial PAPs. Subtypes of PAPs and CCAs are color-specified. Class I (cool colors) and II (warm colors) PAPs/CCAs are separated by a dashed line.
Figure 4.FAM46B has PAP activity. (A) Test for CCA-adding activity for human FAM46B and mouse FAM46C. 10 μM 5′-biotinylated mini-tRNA primers with different 3′ tails as indicated were individually incubated with 10 μM protein in the presence of 2 mM ATP or CTP for 50 min. tmCCA was used as a positive control. (B) Polyadenylation activity for human FAM46B and mouse FAM46C. 10 μM 5′-biotinylated A15 primer was incubated with 10 μM FAM46B or FAM46C in the presence of 4 mM Mg2+ or Mn2+ for 50 min. ATP was supplied with increasing concentrations as indicated.
Figure 5.The substrate sequence preference of FAM46B. (A) Schematic drawing showing the experimental process of HPLC-based NTP consumption assay. (B) Consumption of different NTPs by human FAM46B. Results from two independent experiments are presented. (C) In vitro polyadenylation assay showing FAM46B extends 5′-biotinylated A15 primer only in the presence of ATP. (D) ATP consumption of FAM46B in the presence of different RNA primers. (E) Polyadenylation assay showing the AMP incorporation to different RNA primers by FAM46B. (F) Position-dependent nucleotide frequency of substrates extended by FAM46B. (G) Progressive polyadenylation activity of FAM46B, shown by ATP (left panel) or protein (right panel) concentration-dependent ATP incorporation in the presence of A15 primer.
Figure 6.Critical sites of FAM46B for polyadenylation activity. (A) The NTase core of FAM46B. The consensus NTase motif is highlighted as cartoon representation in orange. The conserved key residues are shown as sticks-and-ball models. (B) ATP consumption of mutants regarding key residues shown in A. Results from two independent experiments are presented. (C) AMP incorporation of mutants regarding residues shown in A. (D) Polyadenylation activity of human FAM46B mutants regarding residues located in the interface between NCD and HD. (E) Surface electrostatic potential of xtFAM46B. Conserved negatively charged residues that may be involved in RNA binding, together with two hydrophobic residues close to the catalytic center, are specified. Corresponding residues of human FAM46B are indicated in the parentheses. (F) AMP incorporation of mutants regarding residues shown in D.
Figure 7.FAM46B is specifically expressed in human pluripotent stem cells. (A) Expression profiles of FAM46 family genes in 12 hESC (H1, H6 and H9), 25 hiPSC samples, 32 normal somatic tissues and 6 cancer cell lines. The rows represent the transcription FAM46 family genes. The RNA-seq data from ENCODE was analyzed, and the RNA expression level was shown as FPKM (fragment per kilobase per million reads). (B) The comparison of chromatin status and pluripotent transcription factor binding sites around the promoters of FAM46 family genes. The promoter of FAM46B is bound by pluripotent transcription factors OCT4, NANOG and SOX2, and marked with transcriptionally active histone marks H3K4me3 and H3K27ac. (C) The mRNA level of FAM46B is gradually decreased during embryoid formation. Fold changes relative to day 0 are plotted for Day 2–8. Error bar indicate s.d. (D) Microarray data showing the relative expression alteration of FAM46 genes together with other canonical (PAPα, PAPβ and PAPγ) and noncanonical PAPs (PAPD4/Gld-2, PAPD5, PAPD7 and mt-PAP) at various time points after induced differentiation of hESCs. Note the declining tendency of FAM46B. Fold changes relative to day 0 are plotted for Day 1−3. Error bar indicate s.d. (E) Relative mRNA levels of FAM46B at various time points after induced differentiation determined by qPCR. mRNA level of FAM46B at day 0 is set to 1. Error bar indicates s.d. (n = 3). (F) FAM46B protein levels at various time points after induced differentiation determined by Western blot. EOMES is the marker for mesendoderm differentiation.
Figure 8.Characterization of FAM46B in hESCs. (A) Subcellular localization of endogenously expressed FAM46B protein in hESCs shown by immunofluorescent staining. Scale bar, 5 μM. (B) Cytosolic (C)/nuclear (N) fractionation experiment showing the subcellular localization of endogenous flag-tagged FAM46B in hESCs. (C) Knock-down of FAM46B did not significantly alter the expression level of OCT4, NANOG and SOX2. Error bar indicates s.d. (n = 3). (D) Knock-down of FAM46B inhibits cell viability in MTT assay. (E) Flow-cytometry assay showing knock-down of FAM46B leads to hESC apoptosis. Significance was calculated with two-sided Student's t-test (n = 3). **P < 0.01, ***P < 0.001. (F) mRNA half-life of selected genes in response to conditional knock-out of FAM46B in hESCs. Inhibition of cellular transcription by adding ActD was set to time point 0 and indicated by an arrow. (G) Model showing that FAM46B promotes translation in pluripotent cells.
| Gene | Primer sequence (5′-3′) | AT (°C) | PS (bp) |
|---|---|---|---|
|
| F-CCTGCCTACTAGACTTCCTGC | 60 | 149 |
| R-CTTGCCGCTCTTGTTGGACA | |||
|
| F-AGTGAGAGGCAACCTGGAGA | 60 | 81 |
| R-ACACTCGGACCACATCCTTC | |||
|
| F-CATGAGTGTGGATCCAGCTTG | 60 | 191 |
| R-CCTGAATAAGCAGATCCATGG | |||
|
| F-GGGAAATGGGAGGGGTGCAAAAGAGG | 60 | 151 |
| R-TTGCGTGAGTGTGGATGGGATTGTG | |||
|
| F-ATTACCCCGGGAGACTGAAC | 60 | 130 |
| R-GGCTGTTGCTTGGACTTCTC | |||
|
| F-ACCAGGCCATGGATGAAG | 60 | 67 |
| R-CTTAATTGCTGGGGAATTGG | |||
|
| F-GGAAGCCCAAGAACCTGAAT | 60 | 98 |
| R-GTTGCTGGAGTTGCTGGAA | |||
|
| F-ACCCAGTTCATAGCGGTGAC | 60 | 165 |
| R-CCATTGGGAGTACCCAGGTT | |||
|
| F-AGCCACATCGCTCAGACAC | 60 | 66 |
| R-GCCCAATACGACCAAATCC |
F, forward; R, reverse; AT, annealing temperature; PS, product size.
| Gene | Primer sequence (5′-3′) | AT (°C) | PS (bp) |
|---|---|---|---|
|
| F-CCCTTAGGCAGGTTGGCTTT | 60 | 90 |
| R-CACTGCAACTGAGGGGATGT | |||
|
| F-TGCAGAAGCACCCTTCACAA | 60 | 148 |
| R-AGCCAGTTATAGCACAACCCC | |||
|
| F-TGACATCGGATGCCCTCAAA | 60 | 249 |
| R-AAGCCAAATGGCATACCACAC | |||
|
| F-TGCAAGGTGGTGTGTGATGA | 60 | 70 |
| R- CAGCCTCTTGGGTCTCGAAG | |||
|
| F-GAAGATTCGAGGCTCCCTGG | 60 | 128 |
| R-CTGGAGCATCTCCACCCTTG |
F, forward; R, reverse; AT, annealing temperature; PS, product size.