Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil.

Toxoplasma gondii is a protozoan that has great genetic diversity and is prevalent worldwide. In 2018, an outbreak of toxoplasmosis occurred in Santa Maria, Brazil, which was considered the largest outbreak ever described in the world. This paper describes the isolation and molecular characterization of Toxoplasma gondii from the placenta of two pregnant women with acute toxoplasmosis who had live births and were receiving treatment for toxoplasmosis during the outbreak. For this, placental tissue samples from two patients underwent isolation by mice bioassay, conventional PCR and genotyping using PCR-RFLP with twelve markers. Both samples were positive in isolation in mice. The isolate was lethal to mice, suggesting high virulence. In addition, the samples were positive in conventional PCR and isolates submitted to PCR-RFLP genotyping presented an atypical genotype, which had never been described before. This research contributes to the elucidation of this great outbreak in Brazil.

Introduction

Toxoplasma gondii is a tissue cyst-forming protozoan capable of infecting warm-blooded animals, including humans, and is prevalent in most parts of the world [1]. It is one of the most studied coccidians due to its importance in animal and human health [2,3], as well as its suitability as a model in molecular studies [1].

Although T. gondii is the only species of the genus Toxoplasma [1,4], there are various genotypes [1]. The first genotyping studies of T. gondii led to the description of a clonal population structure with three main lines, designated as type I, II, and III [5, 6]. Currently, there are many known genotypes that do not belong to these three clonal lineages and are called atypical. They are generally considered more virulent [7]. They are formed by sexual reproduction between gametes of different genotypes which occur in the intestine of felids [1]. In Brazil, these atypical genotypes have been widely described [8]. There are studies showing the prevalence of T. gondii in animals and humans [9, 10, 11], and some studies have performed the isolation and genetic characterization from cases of congenital toxoplasmosis [12, 13].

T. gondii infection is generally asymptomatic in humans. However, it is potentially serious when acquired during pregnancy in immunocompetent individuals, as it carries the risk of fetal transmission [14]. When congenital toxoplasmosis occurs, the protozoan can cause lesions in the fetus that range from subclinical to neurological lesions, and even fetal death or miscarriage [15, 16]. The clinical manifestation varies according to the stage of pregnancy, infection time [17], and genotype [16]. The latter makes congenital toxoplasmosis more serious in Brazil, due to infection with more virulent genotypes [18].

In 2018, an outbreak of toxoplasmosis occurred in Santa Maria, Rio Grande do Sul, with 809 confirmed cases. Of these, 114 were pregnant women who had 3 fetal deaths, 10 abortions, and 22 live births with congenital toxoplasmosis [19]. The objective of this study was to describe the isolation and molecular characterization of T. gondii from the placenta of two pregnant women with acute toxoplasmosis who delivered alive children and were receiving treatment for toxoplasmosis.

Materials and methods

Samples and clinical history

The placental tissue samples from two patients (patient 1 and patient 2) who delivered their babies at the University Hospital of Santa Maria during the toxoplasmosis outbreak in 2018, were referred to the Laboratory of Parasitic Diseases of the Federal University of Santa Maria (UFSM) for diagnostic purposes. Part of the tissue was intended for protozoan isolation, and another part for molecular tests.

According to their clinical history, both patients were positive for acute toxoplasmosis through the detection of anti-T. gondii IgM in Enzyme-linked Immunosorbent Assay (ELISA). The diagnosis of the two pregnant women occurred in the final trimester of gestation. Both patients received treatment and had alive children. The treatment protocol included a combination of Sulfadiazine, Pyrimethamine and Folinic Acid (SPAF). Patient 1 started receiving treatment from 35 weeks of gestation, while patient 2 received treatment from the 36th week. Both patients received treatment for four weeks and thereafter gave birth.

Isolation through bioassay in mice

The placental tissues were subjected to peptic digestion individually, according to the technique described by Dubey, 1998 [20]. For digestion 50 g of placental tissue were used for peptic digestion. The digested material was resuspended in 5 mL of saline, and immediately after digestion, the mice were inoculated with 1 mL of the peptic digestion solution intraperitoneally. For each sample to be tested, four Swiss female mice were used, maintaining the fifth as a negative control. The animals were obtained from the Central Bioterium of the UFSM.

Mice were monitored daily for possible clinical signs of acute toxoplasmosis. When disease led to death, samples were collected from brain, heart, lung, and intraperitoneal fluid from all mice. The tissue was subjected to molecular analysis. Intraperitoneal fluid was also analyzed under a microscope with 40× magnification.

All procedures were approved by the Committee of Ethics in the Use of Animals of the Federal University of Santa Maria, under the protocol 7150250419.

DNA extraction

DNA extraction was performed from placental tissue samples from both patients, and from mouse tissues using Wizard Genomics DNA Purification kit (Promega), following the manufacturer’s instructions. In all cases, 20mg of tissues were used for DNA extraction.

Polymerase Chain Reaction (PCR)

The PCR amplification was performed with specific primers TOX4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and TOX5 (CGCTGCAGACACAGTGCATCTGGATT) which amplified a 529 bp fragment from the T. gondii genome. The PCR was performed as described by Homan et al. 2000 [21]. As a positive control, tachyzoite DNA from the RH strain was used, and DNAase-free water was used as a negative control. A molecular marker of 100 bp (Brand—Ludwig Biotec) was used as the molecular standard size. Amplified products were visualized in the UV transilluminator after 1.5% agarose gel was stained with SYBR Safe DNA gel stain (Invitrogen).

Analysis of restriction fragment length polymorphism (RFLP)

The genotypic characterization was performed from mouse tissues that were positive for the TOX gene (529 bp) using twelve markers (SAG 1, 5' SAG2, 3' SAG2, Alt SAG2, SAG3, BTUB, GRA6, C22-8, C29-2, L358, PK1, APICO), according to the technique described by Su et al. 2010 [22]. To do so, the extracted DNA was amplified by nested-PCR (n-PCR) technique followed by PCR-RFLP analysis. DNA target sequences were first amplified by multiplex PCR, using external primers of all markers, followed by nested-PCR using internal primers for each marker. DNA samples from standard strains, RH, ME49 and VEG were used as controls for genotypes I, II, and III, respectively.

The polymorphism of each locus was analyzed by standard RFLP bands which was used to distinguish each strain type. For this, nested-PCR products were digested with appropriate restriction enzymes for each marker, according to Su et al. 2010 [22]. The controls were also digested using the same restriction enzymes. The negative control consisted of DNAase-free water. The results obtained were compared and classified according to the genotypes present in ToxoDB (http://toxodb.org/toxo/).

Results

T. gondii was isolated from the placental tissues of two patients. Within two weeks the mice presented signs indicative which acute toxoplasmosis such as apathy, bristly hair, photophobia, ascites, and death (Table 1). In addition, it was possible to identify a large amount of tachyzoites in the intraperitoneal fluid collected from the animals.

Table 1

Mouse bioassay.

Patients	Number of inoculated mice	Number of positive mice in the bioassay	Mice life days
1	4	4	11–13
2	4	4	12–15

As expected the samples of placental tissue as well as tissue samples from mice (brain, heart, and lung) submitted to conventional PCR showed an amplified product of 529 base pairs, confirming the presence of T. gondii DNA in the placenta of the evaluated patients, and in the bioassay mice.

In the genotypic characterization by the RFLP technique, the DNA analysis of T. gondii amplified from the tissues of mice submitted to the bioassay presented an atypical genotype, not yet described in ToxoDB. This result compared to other genotypes in Table 2.

Table 2

Genotypic characterization of T. gondii isolates obtained from two patients during the Santa Maria toxoplasmosis outbreak compared to three other isolates [9,28].

Isolado	Markers
	Sag1	5’Sag2	3’Sag2	Sag3	Gra6	BtuB	C22-8	C29-2	L358	PK1	Alt.SAG2	Apico
a P. 1	I	I	I	I	III	III	II	III	III	I	I	I
a P. 2	I	I	I	I	III	III	II	III	III	I	I	I
b[28]	I	I	I	I	III	III	II	III	III	I	I	III
cBrI	I	I	I	III	II	I	u-1	I	I	I	I	I
c Br II	I	I	I	III	III	III	I	III	I	II	II	III
c Br III	I	III	III	III	III	III	II	III	III	III	III	III
c Br IV	I	III	III	III	III	III	II	I	III	III	III	III

Outbreak patients isolates

Isolated recently described in Rio Grande do Sul

Common isolates in Brazil

Discussion

Samples from animals have been widely used for isolation and genetic characterization of T. gondii [8]. However, in humans, this diagnosis is restricted [23], which makes it difficult to clarify the virulence of strains that infect humans and their genetic identity. In the present study conducted during the toxoplasmosis outbreak in Santa Maria, T. gondii was isolated from placental tissues of two patients with acute toxoplasmosis who received specific treatment in the third gestation trimester. This result is interesting since the success of T. gondii isolation is lower in cases of pregnant women receiving treatment [16, 24, 25]. The isolation of the protozoan species in the two patients in this study suggests that in both the cases the treatment protocol established did not prevent the protozoa from reaching the placenta, or that the congenital infection occurred even before the start of treatment.

In addition to confirming the presence of T. gondii in the placenta, the isolation in mice allows the virulence evaluation of genotypes present in the samples [26], since virulent strains usually cause acute infection with clinical signs in mice [3]. Signs which are characteristic of acute toxoplasmosis such as ascites, bristly hair, and photophobia were seen in all mice inoculated with placental samples from the patients in this study. In addition, the mice died within a maximum of 15 days, suggesting that the genotype present in the samples was quite virulent, although the amounts of inoculated tachyzoites can also interfere, since it was not estimated.

The genotype found in these samples was characterized as atypical, and is related to more severe forms of toxoplasmosis [27]. Atypical genotypes are not uncommon in Brazil, where the genetic diversity of T. gondii is large [8], but the genotype present in the samples of this research had not yet been described in ToxoDB. Recently, in Southern Brazil, Vielmo et al., 2019 [28], also described an atypical genotype very similar to that found in the current study, capable of causing a chicken outbreak on a small rural property, suggesting that these two closely related genotypes are virulent to humans and animals. Although very similar to each other, both genotypes differ from the Brazilian clonal lineages, BrI, BrII, BrIII and BrIV [9], as shown in Table 2.

In addition, it should be considered that the evaluated patients were diagnosed in the last gestational trimester and started receiving treatment after 30 weeks of gestation. This fact reaffirms the importance of diagnosis pregnant women through serology is essential for fast and efficient treatment to reduce cases of congenital toxoplasmosis [29, 30].

This study was funded by the Higher Education Personnel Improvement Coordination.

Conclusion

It was possible, by isolation and genotyping, to identify a new atypical T. gondii genotype, never described before, and with high virulence characteristics. This research contributes to elucidate the outbreak of toxoplasmosis in Santa Maria, Brazil.

Patient Bioassay 1, Patient Bioassay 2 and Mouse images from the bioassay showing some clinical signs.

(DOCX)

Click here for additional data file.

24 Oct 2019

PONE-D-19-26140

Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil

PLOS ONE

Dear Dr Minuzzi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Your manuscript was reviewed by 3 experts in the field. Novel methods or findings are not a requirement for publication in Plos One, but scientific rigor, technical merit, and full transparency are essential to meet the standard of the journal. Reviewers 1 and 2 commented on the need to include more detail on the methodology, study cohort, and data (details are included in their comments). These requests should be met before the manuscript can be considered for publication.

==============================

We would appreciate receiving your revised manuscript by Dec 08 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Leticia Reyes

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

3. As part of your revision, please complete and submit a copy of the ARRIVE Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://www.nc3rs.org.uk/arrive-guidelines. Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

Reviewer #3: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This manuscript reported isolation and genetic characterization of Toxoplasma gondii strains isolated from congenital toxoplasmosis from an outbreak occurred in Santa Maria, Brazil in 2018, from which over 800 people were exposed to the parasite. Placenta tissues from two congenital toxoplasmosis were bioassayed in mice and the parasites were isolated from both cases. Genotyping by multilocus PCR-RFLP markers revealed a new genotype. The genotype seems to be highly virulent to mice.

The results of this study is of interest to molecular epidemiology of T. gondii, particularly for this largest known outbreak of toxoplasmosis in history.

The manuscript is overall well written, however, editing is needed to correct grammar errors.

There is a recent paper reported isolation of T. gondii in chicken from the same state (near Porto Alegre, Rio Grande Do Sul) (Andréia Vielmo et al., Outbreak of toxoplasmosis in a flock of domestic chickens (Gallus gallus domesticus) and guinea fowl (Numida meleagris). Parasitology Research, 2019, 118, 991–997). The genotype is almost identical to the one identified in this manuscript. The authors should look into the paper and discuss the results in that context.

Specific Comments:

Line 33. It should be mice not rats.

Lines 91-93. How much placenta tissue was used for pepsin treatment, 1 gram, 2 grams, or more? What was the volume the digested tissues were finally resuspended and then 1 ml was inoculated to each mouse?

Use a table to summarize the results from mouse bioassay, including how many mice were inoculated, how many were positive with T. gondii and the days mice are euthanized.

Table 1. Was genotyping performed using DNA samples extracted directly from placentas? If so, list these samples in the table.

Lines 162-164. It can be argued that the congenital infection has already occurred before the drug treatment, not necessary of the failure of the drug treatment.

Lines 165-171. Given that the amount of parasites inoculated to mice is not known in this study, the result of high virulence could partially due to high inoculation does.

Lines 173-175. The statement “It is necessary to consider a combination of alleles and formation of an atypical genotype may have contributed to an increase in virulence (Dardé, 2008)” is way beyond the scope of this study. Remove this sentence.

Reviewer #2: The authors report isolation and molecular characterization of a strain isolated from placentas of 2 pregnant women infected during a large outbreak observed in 2018 in Rio Grande do Sul. The 2 isolates were identical with PCR-RFLP markers, suggesting a common source. This genotype seems different from the multiple ones already described in Brazil.

Although this report may be interesting as few isolates from human cases of toxoplasmosis are characterized in Brazil, it would have been more interesting if clinical data (mothers and babies) were made available to discuss the possible role of this genotype in the severity (or not) of clinical toxoplasmosis.

Apparently, the description of the large outbreak of Santa Maria is not yet published, and the paper presented here is just the contribution of the authors to the exploration of this outbreak. However, a few other information regarding isolates would be interesting. Are the 2 isolates described here the only ones available from this outbreak?

- L. 55-56: “In Brazil …. isolation and genetic characterization of T. gondii from human tissues, especially from pregnant women, are scarce.”: yes, but they do exist. Could the authors add Brazilian references, at least for congenital cases? (Carneiro et al., 2013 J. Clin. Microbiol. 51, 901–907; Ferreira et al., 2011 Exp. Parasitol. 129, 190–195; Silva et al., 2014 PloS One 9, e90237). The authors could discuss about the comparison with other strains isolated from congenital cases in Brazil.

- L.84: “the diagnosis of the two pregnant women occurred in the final trimester of gestation.”: does that mean that infection occurred in the last trimester or just that the diagnostic was made at this stage?

- L. 145: “Detection of protozoal DNA in mouse tissues also indicates the feasibility of T. gondii infection in placental tissues.”: do you mean the presence of Toxoplasma infection in placenta, not the feasibility?

- Genotype: the authors described the genotype obtained as a new genotype for Brazil, according to ToxoDB. It would be interesting to show a dendrogram indicating the place of this genotype among other genotypes described in Brazil. Or at least, add to table 1, the PCR-RFLP profiles of the main Brazilian genotypes (Br I to IV) and other genotypes found in Rio Grande do Sul state in animals.

- L.160: “This result is uncommon, since only a few researchers have been able to carry out the T. gondii isolation from pregnant women tissues,”: this is not true and reports of isolation of T. gondii form placenta are very common (see for example, Ajzenberg et al. JID 2002; Robert-Gangneux et al. 2010)

Reviewer #3: There are articles with the molecular characterization of approximately 50 T. gondii strains , it seems to me very little to publish an article with the characterization of 2 strains.

There are more recent methodologies for molecular characterization such as microsatellites and NGS.

Isolation of T. gondii strains from biological samples such as amniotic fluid placentas and newborn blood by inoculation in mice is a routine and ancient procedure used by European reference laboratories.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Chunlei Su

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

13 Nov 2019

Reviewer #1: This manuscript reported isolation and genetic characterization of Toxoplasma gondii strains isolated from congenital toxoplasmosis from an outbreak occurred in Santa Maria, Brazil in 2018, from which over 800 people were exposed to the parasite. Placenta tissues from two congenital toxoplasmosis were bioassayed in mice and the parasites were isolated from both cases. Genotyping by multilocus PCR-RFLP markers revealed a new genotype. The genotype seems to be highly virulent to mice.

The results of this study is of interest to molecular epidemiology of T. gondii, particularly for this largest known outbreak of toxoplasmosis in history.

The manuscript is overall well written, however, editing is needed to correct grammar errors.

There is a recent paper reported isolation of T. gondii in chicken from the same state (near Porto Alegre, Rio Grande Do Sul) (Andréia Vielmo et al., Outbreak of toxoplasmosis in a flock of domestic chickens (Gallus gallus domesticus) and guinea fowl (Numida meleagris). Parasitology Research, 2019, 118, 991–997). The genotype is almost identical to the one identified in this manuscript. The authors should look into the paper and discuss the results in that context.

Reply:

Thank you for reminding us of this study. It will be added in our discussion.

Specific Comments:

Line 33. It should be mice not rats.

Reply:

Reviewed

Lines 91-93. How much placenta tissue was used for pepsin treatment, 1 gram, 2 grams, or more? What was the volume the digested tissues were finally resuspended and then 1 ml was inoculated to each mouse?

Reply:

50g of placental tissue were used for peptic digestion.

The digested material was resuspended in 5mL Saline.

Use a table to summarize the results from mouse bioassay, including how many mice were inoculated, how many were positive with T. gondii and the days mice are euthanized.

Reply:

Table 1. Mouse bioassay.

Patients Number of mice inoculated Number of positive mice in the bioassay Mice life days

P. 1 4 4 11 - 13

P. 2 4 4 12 - 15

Table 1. Was genotyping performed using DNA samples extracted directly from placentas? If so, list these samples in the table.

Reply:

The table referring to genotyping will now be table 2 as another table has been included in the manuscript. Genotyping was performed only from the tissues of positive mice in the bioassay.

Lines 162-164. It can be argued that the congenital infection has already occurred before the drug treatment, not necessary of the failure of the drug treatment.

Reply:

Will be added to the text. Line 165.

Lines 165-171. Given that the amount of parasites inoculated to mice is not known in this study, the result of high virulence could partially due to high inoculation does.

Reply:

Will be added to the text. Line 173.

Lines 173-175. The statement “It is necessary to consider a combination of alleles and formation of an atypical genotype may have contributed to an increase in virulence (Dardé, 2008)” is way beyond the scope of this study. Remove this sentence.

Reply:

The sentence will be removed.

Reviewer #2: The authors report isolation and molecular characterization of a strain isolated from placentas of 2 pregnant women infected during a large outbreak observed in 2018 in Rio Grande do Sul. The 2 isolates were identical with PCR-RFLP markers, suggesting a common source. This genotype seems different from the multiple ones already described in Brazil.

Although this report may be interesting as few isolates from human cases of toxoplasmosis are characterized in Brazil, it would have been more interesting if clinical data (mothers and babies) were made available to discuss the possible role of this genotype in the severity (or not) of clinical toxoplasmosis.

Apparently, the description of the large outbreak of Santa Maria is not yet published, and the paper presented here is just the contribution of the authors to the exploration of this outbreak. However, a few other information regarding isolates would be interesting. Are the 2 isolates described here the only ones available from this outbreak?

Reply:

This study is really just a contribution to elucidating the causes of the great outbreak that occurred in Santa Maria. We agree that clinical data from patients would make the research more interesting, but not the central objective of the research. Thus we limit ourselves to isolation in mice and genotyping.

The 2 isolates described in this study come from the samples to which we had access. Thus we selected samples sent for diagnosis in our laboratory of patients who had received treatment for toxoplasmosis and who had children born alive.

- L. 55-56: “In Brazil …. isolation and genetic characterization of T. gondii from human tissues, especially from pregnant women, are scarce.”: yes, but they do exist. Could the authors add Brazilian references, at least for congenital cases? (Carneiro et al., 2013 J. Clin. Microbiol. 51, 901–907; Ferreira et al., 2011 Exp. Parasitol. 129, 190–195; Silva et al., 2014 PloS One 9, e90237). The authors could discuss about the comparison with other strains isolated from congenital cases in Brazil.

Reply:

Thank you for the indication of the studies. They will be added to the manuscript.

- L.84: “the diagnosis of the two pregnant women occurred in the final trimester of gestation.”: does that mean that infection occurred in the last trimester or just that the diagnostic was made at this stage?

Reply:

We cannot say when the infection occurred. Only that the diagnosis was made at this stage.

- L. 145: “Detection of protozoal DNA in mouse tissues also indicates the feasibility of T. gondii infection in placental tissues.”: do you mean the presence of Toxoplasma infection in placenta, not the feasibility?

Reply:

Exactly. We refer to the presence of Toxoplasma in the placenta. This sentence will be corrected in the manuscript.

- Genotype: the authors described the genotype obtained as a new genotype for Brazil, according to ToxoDB. It would be interesting to show a dendrogram indicating the place of this genotype among other genotypes described in Brazil. Or at least, add to table 1, the PCR-RFLP profiles of the main Brazilian genotypes (Br I to IV) and other genotypes found in Rio Grande do Sul state in animals.

Reply:

A table with this data will be added to the discussion of the manuscript.

Table 3: Genotypic characterization of T. gondii isolates obtained from two patients during the Santa Maria toxoplasmosis outbreak compared to three other isolates [9,28].

Isolado Markers

Sag1 5’Sag2 3’Sag2 Sag3 Gra6 BtuB C22-8 C29-2 L358 PK1 Alt.SAG2 Apico

a P. 1 I I I I III III II III III I I I

a P. 2 I I I I III III II III III I I I

b Vielmo et al. I I I I III III II III III I I III

c BrI I I I III II I u-1 I I I I I

c Br IV I III III III III III II I III III III III

This is the Table 3 legend.

a Outbreak patients isolates

b Isolated recently described in Rio Grande do Sul

c Common isolates in Brazil

- L.160: “This result is uncommon, since only a few researchers have been able to carry out the T. gondii isolation from pregnant women tissues,”: this is not true and reports of isolation of T. gondii form placenta are very common (see for example, Ajzenberg et al. JID 2002; Robert-Gangneux et al. 2010)

Reply:

This sentence will be corrected in the manuscript.

Reviewer #3: There are articles with the molecular characterization of approximately 50 T. gondii strains , it seems to me very little to publish an article with the characterization of 2 strains.

There are more recent methodologies for molecular characterization such as microsatellites and NGS.

Isolation of T. gondii strains from biological samples such as amniotic fluid placentas and newborn blood by inoculation in mice is a routine and ancient procedure used by European reference laboratories.

Reply:

We understand that if the number of isolates surveyed were larger, the study would be more interesting. However, we are limited to the number of samples that have arrived at our diagnostic laboratory. Unfortunately we could not include more isolates in our search.

Regarding the technique used, we chose RFLP because it is a reliable technique widely used by researchers in the field. Besides being the technique available in our laboratory.

We know our research has limitations, but we are dealing with samples from what appears to be the largest outbreak of toxoplasmosis ever described in the world. This makes us think that although we have had access to few isolates, the results of isolation and genotyping are interesting and cannot be ruled out. With this we intend to make a small contribution to the elucidation of the factors that contributed to the occurrence of this outbreak.

Submitted filename: Reply to reviewers.docx

Click here for additional data file.

13 Dec 2019

PONE-D-19-26140R1

Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil

PLOS ONE

Dear Dr Minuzzi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jan 27 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Leticia Reyes

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: (No Response)

Reviewer #2: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Line 186. Suggest revise to “ … capable of causing a chicken outbreak on a small rural property, suggesting these two closely related genotypes are virulent to humans and animals.”

Reviewer #2: The authors replied to most of the reviewers’comments. The limitations of the study remain to be highlighted, notably the absence of clinical data regarding these 2 cases.

Abstract: “In addition, the samples were positive in conventional PCR and, when submitted to PCR-RFLP genotyping, presented an atypical genotype,…”: this sentence is ambiguous, since PCR-RFLP was not performed directly on placenta DNA extract but on the strain isolated in mice.

L. 104: “In all cases, 20mg of tissues were used for DNA extraction”. For placenta, was it 20mg of tissues or 20 mg of the pellet obtained after peptic digestion?

L. 191: “both genotypes differ from the Brazilian clonal lineages, BrI, BrII, BrIII and BrIV [9], as shown in table 2”: only Br1 and BrIV are presented in table 2. BrII and III should be added to table 2. Comparaison with other strains isolated from congenital cases in Brazil was not discussed.

Ref 19: not accessible, the link does not work.

The text contains many errors in English that need to be corrected.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

9 Jan 2020

Reply to reviewers

Reviewer #1:

Line 186. Suggest revise to “ … capable of causing a chicken outbreak on a small rural property, suggesting these two closely related genotypes are virulent to humans and animals.”

Reply:

Thank you for the consideration. The sentence has been changed in the manuscript.

Reviewer #2:

Abstract: “In addition, the samples were positive in conventional PCR and, when submitted to PCR-RFLP genotyping, presented an atypical genotype,…”: this sentence is ambiguous, since PCR-RFLP was not performed directly on placenta DNA extract but on the strain isolated in mice.

Reply:

Thank you for the consideration. The sentence has been amended in the abstract to improve understanding.

L. 104: “In all cases, 20mg of tissues were used for DNA extraction”. For placenta, was it 20mg of tissues or 20 mg of the pellet obtained after peptic digestion?

Reply:

For extraction of placental DNA, 20mg were used directly from the placental tissue.

L. 191: “both genotypes differ from the Brazilian clonal lineages, BrI, BrII, BrIII and BrIV [9], as shown in table 2”: only Br1 and BrIV are presented in table 2. BrII and III should be added to table 2.

Reply:

BrII and III strains were added to the table.

Ref 19: not accessible, the link does not work.

Reply: The link has been changed.

The text contains many errors in English that need to be corrected.

Reply:

The text has been subjected to a new English revision. We hope we have managed to improve the language.

Submitted filename: Reply to reviewers.docx

Click here for additional data file.

14 Jan 2020

PONE-D-19-26140R2

Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil

PLOS ONE

Dear Dr Minuzzi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Feb 28 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Leticia Reyes

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

We are pleased to conditionally accept your manuscript after the following editorial corrections have been made in the body of the manuscript:

Page 4, lines 72-73 please replace "who who delivery babies their at the University Hospital" with "who delivered their babies at the University Hospital"

Page 6, line 135 please replace "T. gondii wes isolate" with T. gondii was isolated"

Page 8, line 165 please replace "Santa Maria, was isolated T. gondii from placental tissues" with "Santa Maria, T. gondii was isolated from placental tissues"

Page 9, line 175 please replace "art characteristic" with "are characteristic"

Page 9, line 185 "the corrent" should be "the current"

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

14 Jan 2020

Response to Reviewers

Page 4, lines 72-73 please replace "who who delivery babies their at the University Hospital" with "who delivered their babies at the University Hospital"

Page 6, line 135 please replace "T. gondii wes isolate" with T. gondii was isolated"

Page 8, line 165 please replace "Santa Maria, was isolated T. gondii from placental tissues" with "Santa Maria, T. gondii was isolated from placental tissues"

Page 9, line 175 please replace "art characteristic" with "are characteristic"

Page 9, line 185 "the corrent" should be "the current"

Response:

Thank you very much for the considerations. All of them were made in the manuscript.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

16 Jan 2020

Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil

PONE-D-19-26140R3

Dear Dr. Minuzzi,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Leticia Reyes

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

23 Jan 2020

PONE-D-19-26140R3

Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil

Dear Dr. Minuzzi:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Leticia Reyes

Academic Editor

PLOS ONE