Saeed Farahani1, Ali R Bandani1, Houshang Alizadeh2, Seyed Hossein Goldansaz1, Steven Whyard3. 1. Plant Protection Department, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. 2. Department of Agronomy and Plant Breeding, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. 3. Department of Biological Sciences, University of Manitoba, Winnipeg, Manitoba, Canada.
Abstract
Insects face diverse biotic and abiotic stresses that can affect their survival. Many of these stressors impact cellular metabolism, often resulting in increased accumulation of reactive oxygen species (ROS). Consequently, insects will respond to these stressors by increasing antioxidant activity and increased production of heat shock proteins (HSPs). In this study, the effect of heat, cold, starvation, and parasitism by Habroacon hebetor wasps was examined in the carob moth, Ectomyelois ceratoniae, to determine which responses were common to different stresses. For all stressors, malondialdehyde levels increased, indicative of oxidative stress in the insects. The activity of two antioxidant enzymes, superoxide dismutase (SOD) and catalase (CAT), increased with each stress, suggesting that these enzymes were serving a protective role for the insects. Heat (46°C for 100 min) and cold (-15°C for 30 min) treatments caused significant mortalities to all developmental stages, but pretreatments of moderate heat (37°C for 10 min) or cold (10°C for 10 min) induced thermotolerance and reduced the mortality rates when insects were subsequently exposed to lethal temperatures. Quantitative RT-PCR confirmed that heat and cold tolerance were associated with up-regulation of two HSPs, HSP70 and HSP90. Interestingly, HSP70 transcripts increased to a greater extent with cold treatment, while HSP90 transcripts increased more in response to high temperatures. RNA interference (RNAi)-mediated knockdown of either HSP70 or HSP90 transcripts was achieved by injecting larvae with dsRNA targeting each gene's transcripts, and resulted in a loss of acquired thermotolerance in insects subjected to the heat or cold pretreatments. These observations provide convincing evidence that both HSP70 and HSP90 are important mediators of the acquired thermotolerance. Starvation and parasitism by wasps caused differential expression of the HSP genes. In response to starvation, HSP90 transcripts increased to a greater extent than HSP70, while in contrast, HSP70 transcripts increased to a greater extent than those of HSP90 during the first 48 h of wasp parasitism. These results showed the differential induction of the two HSPs' transcripts with variable stresses. As well as, heat, cold, starvation, and parasitism induce oxidative stress, and antioxidant enzymes likely play an important role in reducing oxidative damage in E. ceratoniae.
Insects face diverse biotic and abiotic stresses that can affect their survival. Many of these stressors impact cellular metabolism, often resulting in increased accumulation of reactive oxygen species (ROS). Consequently, insects will respond to these stressors by increasing antioxidant activity and increased production of heat shock proteins (HSPs). In this study, the effect of heat, cold, starvation, and parasitism by Habroacon hebetor wasps was examined in the carob moth, Ectomyelois ceratoniae, to determine which responses were common to different stresses. For all stressors, malondialdehyde levels increased, indicative of oxidative stress in the insects. The activity of two antioxidant enzymes, superoxide dismutase (SOD) and catalase (CAT), increased with each stress, suggesting that these enzymes were serving a protective role for the insects. Heat (46°C for 100 min) and cold (-15°C for 30 min) treatments caused significant mortalities to all developmental stages, but pretreatments of moderate heat (37°C for 10 min) or cold (10°C for 10 min) induced thermotolerance and reduced the mortality rates when insects were subsequently exposed to lethal temperatures. Quantitative RT-PCR confirmed that heat and cold tolerance were associated with up-regulation of two HSPs, HSP70 and HSP90. Interestingly, HSP70 transcripts increased to a greater extent with cold treatment, while HSP90 transcripts increased more in response to high temperatures. RNA interference (RNAi)-mediated knockdown of either HSP70 or HSP90 transcripts was achieved by injecting larvae with dsRNA targeting each gene's transcripts, and resulted in a loss of acquired thermotolerance in insects subjected to the heat or cold pretreatments. These observations provide convincing evidence that both HSP70 and HSP90 are important mediators of the acquired thermotolerance. Starvation and parasitism by wasps caused differential expression of the HSP genes. In response to starvation, HSP90 transcripts increased to a greater extent than HSP70, while in contrast, HSP70 transcripts increased to a greater extent than those of HSP90 during the first 48 h of wasp parasitism. These results showed the differential induction of the two HSPs' transcripts with variable stresses. As well as, heat, cold, starvation, and parasitism induce oxidative stress, and antioxidant enzymes likely play an important role in reducing oxidative damage in E. ceratoniae.
Insects face a variety of biotic (pathogens, predators, and parasitoids) and abiotic (high/low temperature, UV radiation, ultrasound waves, chemicals, etc.) external stressors [1,2]. Being aerobes, insects also must deal with endogenous sources of chemical stress, as they continuously produce reactive oxygen species (ROS), which form during the reduction of O2 [2]. ROS compounds can damage cellular lipids, proteins, and nucleic acids [2], and hence, insects, like other organisms, have developed protective responses to detoxify ROS compounds before damage occurs.The antioxidant system in most aerobes consists of both enzymes and non-enzymatic low-molecular-weight antioxidants, both of which contribute to reducing the levels of ROS during stress conditions [3]. In insects, the most important antioxidant enzymes are superoxide dismutase (SOD), peroxidase (POX), catalase (CAT) and glutathione S-transferase (GST) [2]. SOD catalyzes superoxide radicals (O-2) into oxygen (O2) and hydrogen peroxide (H2O2), and the H2O2 is then converted by both CAT and POX into oxygen and water (H2O) [2; 3]. In addition to the antioxidant enzymes, there are non-enzymatic compounds that play a role in protecting insects against ROS compounds, including lipid-soluble and water-soluble antioxidants [2]. The antioxidant system is well-regulated, controlling ROS levels during normal metabolism, but also capable of increasing enzyme activities and antioxidants during various stresses. Induction of the antioxidant system has been observed in many insects subjected to different stresses, such temperature [2; 4; 5; 6], dietary oxidants [7], pesticide exposures [8; 9], oxygen deprivation [10] and infections or parasitisms [11; 12].In addition to the antioxidant stress system, heat shock proteins can also provide a protective function to stressed cells. While they are named heat shock proteins, they have been found to be produced in response to various biotic stresses (parasites, pathogens, and parasitoids) and abiotic stresses (temperature, ultraviolet radiation, drought dehydration and anhydrobiosis, chemicals and metals [1; 13]. In insects, four major HSP families have been recognized, including the small heat shock proteins (smHSPs), Hsp60, Hsp70, and Hsp90 [14]. These proteins serve a variety of functions within cells, but are particularly important in serving as molecular chaperones, helping nascent proteins fold correctly, or helping proteins refold if they partially denature during normal cellular activities. Due to their protein chaperone functions, HSPs play important roles in regulating growth, development, and diapause, and participate in many physiological processes including oogenesis, embryo development, and signal transduction in insects [14; 15; 16; 17]. During many cellular stresses, proteins can denature, and HSPs then provide a protection function, enabling proteins to refold into their native form. Thus, HSPs act as a first line of the cellular defense by preventing irreversible denaturation of essential proteins under biotic and abiotic stress conditions [18; 6]. There are numerous studies illustrating the role of HSPs in insects (reviewed in 1). The vast majority of these studies provide evidence of increased transcription of different HSPs during heat stress, but cold stress is also a common inducer of HSP transcription [1]. Other stresses have also been observed to induce HSP gene transcription. For example, Yocum et al. [19] found that expression of the Hsp23 transcript of the nondiapausing flesh fly was induced in response to both severe heat and cold shocks (43ºC and -10ºC for 2 h). Sinclair et al. [20] reported that cold exposure induced HSP70 expression in Drosophila melanogaster. Rinehart et al. [21] showed that in the pupae of the flesh fly, Sarcophaga crassipalpis, HSP23 and HSP70 levels were significantly increased after envenomation by the endoparasitoid, Nasonia vitripennis. Wang et al. [22] observed that the expression of HSPs was significantly higher in the migratory phase of Locusta migratoria L. than the solitary phase, suggesting that crowding mediates HSP gene activation. Shim et al. [23] reported that the expression levels of smHSP and HSC70 in larvae of Plodia interpunctella increased in response to H. hebetorparasitism. Wang et al. [24] showed the HSP60, HSP70, and HSP90 expression levels increased after 24 h starvation stress in Pteromalus puparum.The ability of organisms to survive exposure to high/low temperature levels is defined as heat/cold hardiness and its induction is known as acclimation [25-26]. Acclimation is associated with the production of HSPs, antioxidant enzymes/compounds, polyols and sugars. Insects can alter their sensitivity to heat/cold stress through short-term acclimation or long-term evolutionary adaptation [27]. Short-term heat/cold acclimation can involve physiological and biochemical changes in insects, enabling them to adapt to variable environmental temperatures [28-30]. Acclimation for a few days at low temperatures generally improves cold hardiness (reviewd in:31]. Likewise, rapid cold hardening with acclimation for 2 h at 4ºC of recently-eclosed adults of five coleopteran species associated with stored grain significantly increased the survival time at various sub-zero temperature compared to those without acclimation [32]. Yocum and Denlinger [19] likewise showed that a mild heat treatment of 40°C for 2 h to the flesh fly, Sarcophaga crassipalpis, conferred thermal tolerance to a subsequent normally lethal heat treatment of 90 min at 45°C.The carob moth, Ectomyelois ceratoniae (Lep. Pyralidae), is a highly destructive polyphagous pest insect of fruit, nut crops and stored products, with feeding larvae causing considerable damage in orchards and food stores. Typically, it is controlled through the use of synthetic pesticides such as methyl bromide and phosphine [33], but with increasing concerns about the negative impacts of these chemicals on the environment, alternative methods, such as extreme temperature treatments or other inducers of oxidative stress are worthy of more consideration. As little is known of this insect’s ability to withstand temperature extremes, this study examined the effect of heat and cold stresses on the insect’s antioxidant responses and changes in expression of two HSP (HSP70 and HSP 90) genes. Other, non-chemical methods of control of Pyralid moth have been investigated, including the use of parasitoid wasps [34]. To explore whether biotic stresses might induce similar stress responses in the carob moths, we also examined whether parasitism by Habroacon hebetor induced similar or different stress responses to those seen following temperature stress. Another common stress that insects may encounter is brief periods of starvation, particularly in environments where food availability can change quickly, such as during harvest periods or food shipments. As starvation has been found to induce some common cellular stress responses in other insects [14, 20, 35], we also examined whether brief starvation elicited any of the responses observed with the other stresses, to determine whether some responses were shared across seemingly different types of stress. By understanding how this pest insect responds to different stresses, we may be able to design more effective methods of control that counter their natural protective or curative stress responses.
Materials and methods
Insect cultures
Carob moth larvae-infested pomegranate fruits were collected from an orchard in Tehran Province, Iran (Latitude: 35.282384 Longitude: 51.750282). The fruit, containing the larvae, were transferred to screened cages kept within a growth chamber (26±1°C, 70% humidity, and 16:8 h L: D). After adult moth emergence, they were collected by an aspirator and 70 adult moths (mixed sex) were transferred to egg-laying containers. The four-liters cylindrical plastic containers were lined with a fine cotton cloth as a suitable surface on which to lay their eggs. After three days, the eggs were collected and were transferred to artificial diets. The artificial larval diet was prepared based on Mediouni and Dhouibi [36] with a slight modification. Briefly, 600 g wheat bran was dry heat-sterilized for 2 h at 121°C and mixed with 250 mL autoclaved water. 120 mL corn oil was used instead of glycine, and 23 g wheat germ powder per 1000 g artificial diet was added.
RNA extraction and cDNA synthesis
Total RNA from 10 larvae was extracted using Trizol reagent (Invitrogen) and was treated with RNase-free DNase (TaKaRa, Shinga, Japan). The absence of DNA contamination was confirmed by PCR using 18S ribosomal DNA (rDNA)-based primers (Forward: 5' CCTTTAACGAGGATCTATTGG 3' and Reverse 5' ATACTTGGCAAATGCTTTCG 3'). cDNA was synthesized by reverse transcription using a cDNA synthesis kit (Takara, Shinga, Japan).
HSP gene cloning
Because the heat shock gene sequences in carob moth were unknown, primers were designed using alignments of gene sequences from other insects including Chilo suppressalis, Bombyx mori, Pieris brassicae, Spodoptera exigua, and Helicoverpa armigera. Degenerate primers were used to amplify ~550 bp gene fragments of the carob moth hsp70 and hsp90 genes, listed in Table 1.
Table 1
Primers used in the current study.
Primers
Primer forward
Primer reverse
PCR type
HSP70
5'-AACCACTTCGTTCAGGAGT-3'
5'-TTGTTGTCCTTGGTCATGGC-3'
RT-PCR
HSP90
5'-CAGTTCGGTGTGGGTTTCTA-3'
5'-TTGTAGAAGTCGCCGTACTCC-3'
RT-PCR
T7-HSP70
5'-TAATACGACTCACTATAG AACCACTTCGTTCAGGAGT-3'
5'-TAATACGACTCACTATAG TTGTTGTCCTTGGTCATGGC-3'
(dsRNAsynthesis)
T7-HSP90
5'-TAATACGACTCACTATAG CAGTTCGGTGTGGGTTTCTA-3'
5'-TAATACGACTCACTATAG TTGTAGAAGTCGCCGTACTCC-3'
(dsRNAsynthesis)
T7-GFP
5'-TAATACGACTCACTATAG GTGGAGAGGGTGAAGG-3'
5'-TAATACGACTCACTATAG GGGCAGATTGTGTGGAC-3'
(dsRNAsynthesis)
re- HSP70
5'-AACCACTTCGTTCAGGAGT-3'
5'-CTCCTCTGTCGCTCGGTAT-3'
RT-qPCR
re- HSP90
5'-CAGTTCGGTGTGGGTTTCTA-3'
5'-GAGGATGACAAGCCCAAGAT-3'
RT-qPCR
RL32
5'-TGGCACCACACCTTCTAC-3'
5'-CATGATCTGGGTCATCTTCT-3'
RT-qPCR
The amplification products were resolved by gel electrophoresis, bands were excised from the gel, and a Gene All Expin Gel SV kit (GeneAll) was used to isolate the DNA. The PCR products were ligated into a pTG19-T PCR Cloning Vector (Vivantis Technologies Sdn Bhd) using T4 DNA Ligase. The plasmids were used to transform E. coli DH5a cells using heat shock. Colonies with inserts were screened with blue/white X-gal selection under standard ampicillin conditions. Plasmid DNA was extracted from recombinant bacterial cells using the alkaline lysis method described by Sambrook and Russell [37], and the DNA was sequenced from multiple [5-10] different independent bacterial colonies by Bioneer (Daejeon, Korea).
Sequence alignments and analyses
The sequences of the HSP70 and HSP90 cDNA were confirmed by a homology search of other HSP70 and HSP90 sequences known within the GenBank database of the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/BLAST/). Phylogenetic trees were constructed by the neighbor-joining method with a Poisson correction model (1,000 bootstrap replications to check for repeatability of the results) using the MEGA 6.0 software [38].
Preparing dsRNA
Template DNA was amplified with the gene-specific primers that possessed the T7 RNA polymerase promoter sequence at the 5’ end (5-TAATACGACTCACTATAG-3) (Table 1). The PCR products were used for the preparation of dsRNA using the MEGA Script RNAi kit according to the manufacturer’s instructions (Ambion, TX). The dsRNA fragments, for both HSP70-dsRNA and HSP90-dsRNA, were approximately 500 bp. The concentration and quality of dsRNAs were assessed with a Nanodrop spectrophotometer.
Quantitative PCR (RT-qPCR)
RNA and cDNA was prepared from pools of 10 larvae for each stress and control treatment. RT-qPCR was employed to determine the expression of HSP70 and HSP90 in treated and non-treated carob moth using RealQ Plus 2x Master Mix Green (ampliqon) on a Rotor-Gene® Q system (QIA-Gene). Gene-specific primers (Table 1) were designed using Primer-Blast. A ribosomal protein gene, RL32, which is constitutively expressed in all tissues, was used as an internal control. The PCR amplifications were performed with the following cycling conditions: one cycle at 95°C (15 min), followed by 40 cycles of denaturation at 95°C (15 s), annealing at 55°C for the 20s, and extension at 72°C for 20 s. Quantitative analysis followed a comparative CT (ΔΔCT) method [39]. A melt curve analysis was used to assess whether a single amplicon was produced in all RT-qPCR reactions. For each treatment, three replicates of 10 individuals were analyzed.
RNA interference of HSP genes
RNAi bioassays were conducted by injecting 4 μL of the dsRNA (250 ng) solution into the hemocoel of 1-day-old fifth-instar larvae with a Hamilton microsyringe [40]. A green fluorescent protein (GFP) dsRNA (dsRNA-GFP) was used as an exogenous control (negative control). Six replicates of 80 1-day-old fifth- instar larvae were conducted for each dsRNA treatment. The survival rate after dsRNA injection was more than 90%. After 24 h, the insects were subjected to 46°C for 100 min or -15°C for 30 min to determine the effect of heat and cold temperatures on survival, respectively. Then mortality was assessed 24 h after the thermal treatment.
Temperature tolerance bioassays
High temperature
To determine the susceptibility of the insects to high and temperatures, different developmental stages of carob moth, including egg, larval, and pupal stages were held into 9 cm Petri dishes, and adults were transferred into clear plastic cylinder bottles (3 cm diameter × 8 cm height). Insects were then exposed either to 46°C for 1 hour using a temperature-controlled incubator with 47±1% humidity, or to -15°C for 30 min in laboratory fridge [40]. After determination of heat and susceptibility of all developmental stages of carob moth, fifth instar larvae were exposed to different high temperatures for 100 min or 46°C for different exposure periods (0–120min) in order to determine the lethal high temperature and the lethal time exposure, respectively. Similarly, fifth instar larvae were exposed to different low temperatures for 100 min or -15°C for different exposure periods (0–60 min) in order to determine the lethal low temperature and the lethal time exposure, respectively. After two-hour recovery periods at 25°C, mortality was recorded. Individual larvae that did not move after touching with a small fine brush were counted as dead. Egg and pupal survivals were determined by hatch and adult emergence at 25°C, respectively. The effective temperature for heat or cold tolerance induction was determined by exposing fifth-instar larvae to different high or low temperatures for 10 min and then either 46°C for 100 min or -15°C for 30 min. The effective exposure time for the heat tolerance induction was measured by exposing fifth- instar larvae to different periods at 37°C and 46°C for 100 min, while the effective exposure time for the cold tolerance induction was measured by exposing fifth- instar larvae to different periods (0, 10, 15, 20, and 30 min) at 10°C and -15°C for 30 min. After these temperature treatments, the survivability of individuals was determined after two-hour recovery at 25°C [40].
The effect of larval starvation on Heat Shock proteins (HSPs) expression and antioxidant enzymes activity
To determine the effects of starvation on HSP70 and HSP90 expressions level and antioxidant enzyme activity (SOD and catalase activities as well as malondialdehyde concentration), eighty 1-day-old fifth-instar larvae were placed into eight petri dishes (diameter of 9 cm) and were starved for 24 h and 48 h. Then, these starved larvae were used to determine SOD and Catalase activities and malondialdehyde concentration as well as HSP70 and HSP90 expressions level. Each assay was performed three times, and each assay in triplicate.
The effect of larval Parasitism on HSPs expression and antioxidant enzyme activity
In order to study the effect of parasitism on HSP70 and HSP90 expressions level as well as on the SOD and Catalase activities and malondialdehyde concentration, eighty 1-day-old fifth-instar larvae were exposed to a pair of Habroacon hebetor (Hymenoptera, Braconidae), were obtained from University of Tehran Biological Control Lab, for a 24 h period (a honey solution of 10% v/v was provided as a food source). After 24 h, parasitized larvae (paralyzed larvae) were collected and used to determine SOD and catalase activities and malondialdehyde concentration. Parasitized larvae were also used to assess the HSP70 and HSP90 expressions level (see Quantitave PCR section above). Each enzyme assay was performed three times, and each assay carried out in triplicate.
Sample preparation
The fifth-instar (L5) larvae from control and treatments were collected and were transferred in an ice-cold saline solution (NaCl, 10 mM) and homogenized by a glass pestle. The homogenates were centrifuged at 10000 rpm for 15 min at 4°C. The supernatants were stored at ‒20°C for subsequent analyses.
Antioxidant assays
SOD activity was measured using the procedure described by Beauchamp and Fridovich [41]. Briefly 0.1 ml enzymatic extract was added into 1.5 ml 0.05 M PBS (Phosphate buffer saline, pH 7.8), 0.3 ml 0.1 mM EDTA (Ethylenediaminetetraacetic acid), 0.3 ml 0.13 M methionine, 0.3 ml 0.75 mM NBT (Nitrotetrazolium Blue chloride), 0.3 ml 0.02 mM riboflavin. Incubation was initiated with exposure to fluorescent light (4,000 lux) for 10 min, and the change in absorbance was recorded at 560 nm. Catalase activity was measured using the method of Wang et al. [10] in which 50 μL of sample and 500 μL of hydrogen peroxide (1%) were incubated at 28°C for 10 min before determining changes in optical density at 240 nm.
Malondialdehyde concentration
A method described by Bar-Or et al. [42] was used to determine the concentration of malondialdehyde (MDA) in the control and treated individuals. 100 μL of 20% trichloroacetic acid and 50 μL of the sample was mixed and centrifuged at 15,000g for 10 min at 4°C. Then, the supernatant was mixed with 100 μL of 0.8% TBA reagent and re-incubated at 100°C for 60 min before reading absorbance at 535 nm. The MDA concentration is reported as the amount of MDA produced per mg protein using a molar extinction coefficient of 1.56 × 105 M−1 cm−1.
Protein assay
Protein content was determined by the Bradford [43] and using bovine serum albumin as the standard protein.
Statistical analysis
Means were compared by the least squared difference (LSD) tests of one-way ANOVA using SPSS software. Values were considered statistically different if p< 0.05. Drawing graphs were conducted using Excel 2013.
Results
Heat shock genes identification
The HSP70 and HSP90 gene fragments from E. ceratoniae were PCR-amplified from cDNA using primers that were designed to anneal to conserved regions of other insect HSP70 and HSP90 genes. Analysis of the carob moth putative HSP70 gene fragment sequence confirmed that it was indeed similar to other insects’ HSP70 genes, showing highest identity (93%) to that of Cadra cautella (almond moth). A phylogenetic analysis of the putative HSP70 gene sequence of the carob moth and other insects likewise confirmed that the carob moth’s gene is most similar to HSP70 genes of other lepidopterans, and in particular, to moths of the family Pyralidae (Fig 1A) This cDNA sequence has been deposited in GenBank under accession number MN529255. A phylogenetic analysis of HSP90 genes from several lepidopteran insects likewise confirmed that the carob moth gene’s sequence is most similar to that of another lepidopteran species, Bicyclus anynana (squinting bush brown moth; Fig 1B). This cDNA sequence has been deposited in GenBank under accession number MN529256.
Fig 1
Phylogenetic relationship of sequences of HSP70 and HSP90 of carob moth and other insects.
(A) An unrooted neighbor-joining tree of HSP70 cDNA sequences was constructed with bootstrap support based on 10,000 replications shown at the relevant branch points. Cadra cautella (MF067297.1), Amyelois transitella (XM_013331933.1), Mamestra brassicae (AB251896.1), Helicoverpa armigera (XM_021342205.1), Chilo suppressalis (GU726137.1), Spodoptera littoralis (KC787696.1), Leptinotarsa decemlineata (KC544268.1), Drosophila eugracilis (XM_017212762.1), Nilaparvata lugens (KX976471.1), Acromyrmex echinatior (XM_011062182.1), Cephus cinctus (XM_015747637.2). (B) Neighbor-joining tree of predicted protein sequences of HSP90 from the carob moth and other lepidopteran insects. Heortia vitessoides (AWX67685.1), Exangerona prattiaria (ADM26739.1), Antheraea pernyi (APX61060.1), Parnassius bremeri (APP93215.1), Agasicles hygrophila (ALP48323.1), Bombyx mori (AEB39782.1), Omphisa fuscidentalis (ABP93404.1), Bicyclus anynana (AFM73651.1), Heliconius cydno chioneus (AFQ40718.1).
Phylogenetic relationship of sequences of HSP70 and HSP90 of carob moth and other insects.
(A) An unrooted neighbor-joining tree of HSP70 cDNA sequences was constructed with bootstrap support based on 10,000 replications shown at the relevant branch points. Cadra cautella (MF067297.1), Amyelois transitella (XM_013331933.1), Mamestra brassicae (AB251896.1), Helicoverpa armigera (XM_021342205.1), Chilo suppressalis (GU726137.1), Spodoptera littoralis (KC787696.1), Leptinotarsa decemlineata (KC544268.1), Drosophila eugracilis (XM_017212762.1), Nilaparvata lugens (KX976471.1), Acromyrmex echinatior (XM_011062182.1), Cephus cinctus (XM_015747637.2). (B) Neighbor-joining tree of predicted protein sequences of HSP90 from the carob moth and other lepidopteran insects. Heortia vitessoides (AWX67685.1), Exangerona prattiaria (ADM26739.1), Antheraea pernyi (APX61060.1), Parnassius bremeri (APP93215.1), Agasicles hygrophila (ALP48323.1), Bombyx mori (AEB39782.1), Omphisa fuscidentalis (ABP93404.1), Bicyclus anynana (AFM73651.1), Heliconius cydno chioneus (AFQ40718.1).Susceptibility of the insects to high (S1A Fig) and low (S1B Fig) temperatures was initially assessed for all developmental stages by exposing the insects to 46°C for one hour or -15°C for 30 min, respectively. Temperatures were chosen based on literature review that shows these points usually used for Pyralid moth control in the storehouses [40]. Also, these temperature and exposure lengths were selected to facilitate comparisons with similar studies. Larval mortality was recorded after two-hour recovery periods at 25°C. Egg and pupal survivals were determined by hatch and adult emergence at 25°C, respectively. Late instar larvae (i.e., fourth and fifth instars) were the most tolerant of the high-temperature treatment, with L4 and L5 survival rates of approximately 50 and 60%, respectively (S1A Fig). In contrast, eggs, L1, L2, pupa, and adults, were all equally adversely affected, suffering >96% mortality rate with this high temperature treatment. (S1A Fig).Regarding cold tolerance, L5 larvae were the most tolerant of the low-temperature treatment, with only 20% of the insects surviving the -15°C treatment (S1B Fig). Again the same trend as high temperature survivorship was observed for all other insect developmental stages i.e. >96% of eggs, L1, L2, pupa, and adults died from this cold treatment (S1B Fig). Thus, for both low temperature and high temperature treatments, late larval stages were the most tolerant.Since fifth instar larvae were the most tolerant of both heat and cold treatments, they were chosen for subsequent treatments. All L5 larvae could be killed by subjecting them to 46°C for 120 min, or to -15°C for 50 min (S2 Fig). Mortality was time-dependent with both the high or low treatments, with median lethal times (LT50) of 67.5 min (95% CI: 65.0–70.0°C) and 16.6 min (95% CI: 14.3–18.7°C) for heat and cold treatments, respectively. Further heat and cold treatments at different times and temperatures were tested, and not surprisingly, demonstrated that 100% mortality could be achieved at higher or lower temperature treatments in less time (S3 Fig).Pre-exposure of fifth instar larvae to different sublethal high and low temperatures significantly increased survival rates; the pre-exposures at 37°C or 10°C for 10 min resulted in the highest survival rates of L5 larvae following their subsequent exposure to the lethal high (46°C for 100 min) and low (-15°C for 30 min) temperature treatments, respectively (S4 Fig). Based on these results, the insects were then subjected to these two pretreatment temperatures for variable durations and observed that heat or cold tolerances could be induced within as little as 10 min pretreatment (S5 Fig). The highest survival rates were observed in insects that were pretreated to 37°C for 20 min or 10°C for 30 min, with survival rates of 56.7 ± 2.2 and 31.7±1.2, respectively.
Changes in HSP transcript levels during stress
Quantitative RT-PCR confirmed that both of the newly-identified HSP genes of the carob moth were induced by either heat or cold shock. Exposure to a moderately high temperature significantly increased the expression level of HSP70 and HSP90 by 3.0 and 3.5-fold in comparison with the controls, respectively (Fig 2). Also, pretreatment with moderately cold temperature similarly increased the expression levels of HSP70 and HSP90 by 4.0 and 2.3-fold compared to the controls, respectively (Fig 2). In response to high-temperature treatments, HSP90 transcript levels increased to a greater degree than did the transcript levels of HSP70, while at the cold temperature, HSP70 was induced more than that of HSP90.
Fig 2
Level of HSP70 and HSP90 transcripts following a moderate heat (37°C for 20 min) and cold (10°C for 30 min) treatment, relative to their respective levels at normal rearing temperature (26°C), parasitism by H. hebetor at 24 h and 48 h post parasitism, and at 24h and 48h post-starvation.
The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).
Level of HSP70 and HSP90 transcripts following a moderate heat (37°C for 20 min) and cold (10°C for 30 min) treatment, relative to their respective levels at normal rearing temperature (26°C), parasitism by H. hebetor at 24 h and 48 h post parasitism, and at 24h and 48h post-starvation.
The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).HSP90 transcript levels also increased significantly when larvae were subjected to starvation; HSP90 transcripts increased 1.6-fold and 2.1-fold in starved larvae compared to control after 24 h and 48 h starvation, respectively. In contrast, HSP70 transcripts were not significantly affected by starvation relative to the non-starved controls (Fig 2). In wasp-parasitized larvae, HSP70 transcripts increased 1.5 and 2.2-fold after 24 h and 48 h post-parasitism, respectively, relative to non-parasitized larvae (Fig 2). HSP90 transcripts were not significantly affected by the parasitism.
RNAi-mediated knockdown of HSP transcripts
Injection of dsHSP70 and dsHSP90 into fifth instar larvae suppressed the expression level of each of these targeted genes. The HSP70 mRNA level was significantly reduced by 9.5 and 4.0-fold at 24 h and 48 h post dsRNA injections compared to controls, respectively (Fig 3A). HSP90 expression level was not as strongly reduced as those of HSP70, but it was significantly reduced 1.4-fold relative to the controls 24 h post dsRNA injections (Fig 3B). This transcript reduction did not persist, as HSP90 transcript levels returned to normal by 48 h post-injection.
Fig 3
Extent of transcript knockdown following injection of L5 larvae with HSP70, HSP90, or GFP (negative control) dsRNAs.
Following dsRNA injection, insects were allowed to recover at 24 or 48 h days before being subjected to RNA extraction and qRT-PCR analysis. A) Level of HSP70 transcripts following HSP70-dsRNA injections relative to GFP-dsRNA injected controls. B) Level of HSP70 transcripts following HSP70-dsRNA injections relative to GFP-dsRNA injected controls. Transcript levels were standardized relative to rl32 transcripts levels. The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).
Extent of transcript knockdown following injection of L5 larvae with HSP70, HSP90, or GFP (negative control) dsRNAs.
Following dsRNA injection, insects were allowed to recover at 24 or 48 h days before being subjected to RNA extraction and qRT-PCR analysis. A) Level of HSP70 transcripts following HSP70-dsRNA injections relative to GFP-dsRNA injected controls. B) Level of HSP70 transcripts following HSP70-dsRNA injections relative to GFP-dsRNA injected controls. Transcript levels were standardized relative to rl32 transcripts levels. The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).To determine the role of these HSPs in heat and cold tolerance induction, L5 larvae were injected with each gene-specific dsRNA. The mortality rates significantly increased by 2.6 and 3.2-fold in dsHSP70- and dsHSP90- treated larvae in comparison with controls in heat treatments (Fig 4A). In cold treatments, injection of dsHSP70 and dsHSP90 resulted in increased mortality rates by 2.1 and 1.5-fold in comparison with the controls, respectively (Fig 4B). While increases of HSP70 and HSP90 transcript levels coincided with enhanced thermotolerance to both heat and cold stresses (Fig 2), the knockdown of HSP70 and HSP90 transcripts resulted in greater mortalities, which provides good supporting evidence that these genes’ expression are associated with improved protection from heat and cold temperature stresses (Fig 4).
Fig 4
Effect of RNAi-mediated HSP genes silencing transcript knockdown on mortality rates in carob moth larvae subjected to (A) a moderate heat (37°C for 20 min) or (B) a moderate cold (10°C for 30 min) pretreatment, followed by exposure to a higher temperature treatment. Insects were injected with dsRNA targeting HSP70, HSP90, or GFP (negative control) genes’ transcripts, allowed to recover for 24 h and then subjected to the temperature (pre)treatments. The values represent the means and standard errors for percent survival for the replicates of 80 individuals. Different letters denote significantly different values from one another (LSD).
Effect of RNAi-mediated HSP genes silencing transcript knockdown on mortality rates in carob moth larvae subjected to (A) a moderate heat (37°C for 20 min) or (B) a moderate cold (10°C for 30 min) pretreatment, followed by exposure to a higher temperature treatment. Insects were injected with dsRNA targeting HSP70, HSP90, or GFP (negative control) genes’ transcripts, allowed to recover for 24 h and then subjected to the temperature (pre)treatments. The values represent the means and standard errors for percent survival for the replicates of 80 individuals. Different letters denote significantly different values from one another (LSD).
Oxidative stress responses
Evidence of oxidative stress was observed in all stress treatments by measuring MDA. MDA concentrations in larvae treated with moderate low (10°C for 30 min) or moderate high temperatures (37°C for 20 min) increased 2.3 and 1.7-fold of that of controls, respectively (Fig 5A). Envenomation of carob moth fifth-instar larvae by H. hebetor led to a significant increase in MDA concentrations; the MDA concentration in parasitized larvae was 1.3-fold higher than that of control (unparasitized larvae) (Fig 5A). In response to starvation, MDA concentrations increased only slightly (1.1-fold) by 24 h, but had increased significantly (1.9-fold) by 48 h post-starvation (Fig 5A).
Fig 5
The effect of pre-exposer to moderate heat (37°C for 20 min) and cold (10°C for 30 min) temperatures, parasitism by H. hebetor at 24 h and 48 h post parasitism, and 24h and 48h post starvation on antioxidant system including SOD and CAT activity and MDA concentration in carob moth fifth instar larvae.
The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).
The effect of pre-exposer to moderate heat (37°C for 20 min) and cold (10°C for 30 min) temperatures, parasitism by H. hebetor at 24 h and 48 h post parasitism, and 24h and 48h post starvation on antioxidant system including SOD and CAT activity and MDA concentration in carob moth fifth instar larvae.
The values represent the means and standard errors for three replicates of 10 individuals. Different letters denote significantly different values from one another (LSD).SOD activity significantly increased when larvae were exposed to moderate low or high temperatures (Fig 5B). SOD activity in treated larvae increased 1.4-fold for moderate high temperature (294.51 μm.min-1.mg protein-1) and 1.3-fold for moderate low temperature (277.67 μm.min-1.mg protein-1) compared to controls. Envenomation by H. hebetor also affected SOD activity (Fig 5B), increasing 1.4-fold compared to controls (Fig 5B). Starvation also induced SOD activity of carob moth larvae, increasing 1.3 and 1.6-fold at 24h and 48h after starvation in comparison with controls, respectively (Fig 5B).Treating fifth instar carob moth larvae with moderate low or high temperatures statistically increased the CAT activity compared to controls. Exposure to 37°C for 20 min or 10°C for 30 min increased CAT activity 4.7 and 2.6-fold compared to controls, respectively (Fig 5C). Parasitism by the parasitoid wasp significantly increased CAT activity 1.7-fold 24 hours post-attack (Fig 5C). CAT activity increased in response to starvation 2.6 and 3.7-fold after 24 h and 48 h starvation, respectively(Fig 5C).
Discussion
The carob moth is a serious pest of a variety of stored foods, causing direct or indirect damage to these products. To avoid using chemical insecticides on our foods, alternative methods such as heat or cold treatments could potentially be used to control pest insects of our stored products. The temperature and duration of treatments needed to control insect pests will be dependent on the species and developmental stage of the insects to be treated. In this study, the susceptibility of all developmental stages of carob moth to high and low temperatures was investigated. Heat treatments of 46°C for 100 min or cold treatments of -15°C for 30 min caused significant mortality of most developmental stages of this pest insect. However, the late larval instars were the most tolerant to these temperatures, with more extreme temperatures or longer durations of temperature stress required to kill these more robust stages. Similar temperature treatments have been reported to be lethal to the other lepidopteran insects. Wang et al. [44] reported that exposure to 47°C or -7°C for two hours killed all larval instars of the noctuid moth Xestia c-nigrum. Likewise, exposures to 44°C for 70 min were sufficient to kill most developmental stages of the Indian meal moth (Plodia interpunctella), but like the carob moth, the late larval instars showed greater tolerance of the extreme temperatures [40]. The reasons for the greater tolerance to extreme temperatures of late instar larvae have not been fully explored, but in this current study, the production of protective molecules or increased expression of existing protective molecules were examined to help provide some insights into the adaptive systems in carob moth larvae.All four stresses examined in this study induced oxidative stress responses in the carob moth larvae. MDA levels increased following exposure to heat, cold, starvation and parasitism, indicating evidence of lipid peroxidation. The insects responded to this stress by increasing both SOD and CAT to manage the increased levels of ROS compounds. In conjunction with these curative antioxidant responses, the stress treatments also increased expression of one or both of the two HSPs examined in this study. HSPs act as molecular chaperones to stabilize the structure of proteins in cells subjected to many stresses. Increased transcription of HSP genes has been often observed in insects subjected to a diversity of stresses, including heat, cold, starvation and parasitism (reviewed in 1). In this study, pre-exposure of the carob moth larvae to sublethal hot or cold temperatures enhanced their survival at the more extreme temperatures. QRT-PCR confirmed that these moderate heat and cold pre-treatments of carob moth larvae increased the expression of both HSP70 and HSP90 genes. Increased HSP transcription rates in pretreated insects have frequently been associated with increased thermotolerance (reviewed in 1). RNAi-mediated knockdown of either HSP70 or HSP90 transcripts in the carob moth larvae greatly reduced the ability of the insects to withstand extreme temperature treatments, which provides compelling evidence that these genes’ proteins are indeed critical for enhanced thermotolerance. The utility of RNAi as a molecular biology tool to provide evidence of gene function is well-recognized in many eukaryotic species, but RNAi has not always been effective in some lepidopteran insects [45]. In the carob moth, injection of dsRNA into the hemocoel proved effective in reducing the targeted genes’ transcripts, demonstrating that this lepidopteran species is somewhat amenable to this useful molecular biology tool. It is worth noting however, knockdown of HSP90 (25% at 24 h post-injection) was considerably weaker than that of HSP70 (90% at 24 h post-injection), and the knockdown was only temporary for HSP90. Similarly weak and transient RNAi-mediated knockdowns are common in many lepidopteran species [45, 46], but in the carob moth, the knockdown was nevertheless sufficient to confirm that HSP90 plays an important role in conferring thermotolerance.Interestingly, the extent of induction differed somewhat between the two HSPs with the different temperature treatments. While both HSPs’ transcripts increased with heat and cold, exposure to high temperature caused a greater proportional increase in the expression of HSP90 relative to HSP70, whereas exposure to a low temperature caused a greater induction of HSP70 relative to HSP90. The differential increases of the two HSPs’ transcripts with variable stresses reflects differences in both their inducibility with different stresses as well as their constitutive levels of expression prior to a stress. While both HSPs are capable of acting as molecular chaperones to assist in protein folding under non-stressed conditions, they do have different roles that may reflect different induction rates with different stresses. HSP70 primarily assists in folding of newly translated proteins, while HSP90 is thought to assist with maintaining or refolding pre-existing proteins, particularly those with hydrophobic substrate clefts. They also have divergent roles in determining the fate of proteins, with HSP70 facilitating ubiquitination and proteasome-directed degradation, while HSP90 can inhibit ubiquitination [47]. In this study, differential induction of HSP70 and HSP90 was also seen in response to starvation and parasitism. HSP70 transcription did not increase significantly in response to starvation, whereas HSP90 was up-regulated sharply with this stress. Starvation is a stressor that affects water, ion balance, and energy availability [14]. With these imbalances, new protein synthesis may slow down, and hence, perhaps less HSP70 is required, while more HSP90 may be required to deal with the perturbations of the cellular proteins during starvation stress. Differential HSP responses have been observed in other insects subjected to starvation. Sinclair et al. [20] observed that in D. melanogaster, HSP70 was induced by cold but not by starvation, while Tian et al. [35] found that starvation in house fly (Musca domestica) larvae induced increased expression of only HSP27, while other HSPs examined were not affected.In contrast, parasitism by H. hebetor in carob moth larvae enhanced HSP70 transcription, while HSP90 transcript levels were unchanged. Similar observations were observed by Shim et al. [23], where parasitized larvae of Plodia interpunctella by H. hebetor enhanced HSP70 but not HSP90 transcript levels. The differential response of these HSPs to this particular stressor may reflect the host’s heightened immune responses, and it will be of particular interest to explore other infectious agents in this insect to determine if they also elicit differential HSP responses. However, parasitism is a particularly complex stressor, as there could be considerable interplay between host and parasite. Like each of the other stressors, parasitism also resulted in increased ROS levels and increased antioxidant enzymes levels. With this particular stress however, the changes in antioxidant activity cannot be exclusively attributed to just the host, as the parasite could also be a source of both ROS and antioxidant activity, to counter the host insect’s defenses [48].Examining insects’ responses to different stresses has provided us with excellent insights into how many stresses can induce complex defense systems, some of which are shared across species, and some of which are differentially regulated in different species or in response to different stressors. Understanding insects’ tolerances to stress may also help guide us in the development of new, environmentally safer approaches to insect control, reducing our reliance on our currently available chemical insectides. However, given the diversity of stress responses that insects have, we may find that using abiotic or biotic stress control methods may need to be adapted to each pest for the most effective control methods.
Susceptibility of different developmental stages to extreme temperatures.
Insects were subjected to (A) heat: 46°C for one hour or (B) cold: -15°C for 30 min, and the percent dead was assessed.(PDF)Click here for additional data file.Effect of exposure times on mortality of carob moth L5 larvae using (A) heat: 46°C for 120 min or (B) cold: -15°C for 30 min.(PDF)Click here for additional data file.Effect of different (A) high or (B) low temperatures on mortality of carob moth L5 larvae.(PDF)Click here for additional data file.
Induction of extreme temperature tolerance in carob moth L5 larvae.
Insects were pretreated for 10 min at various temperatures and then subjected to (A) 46°C for 100 min or (B) -15°C for 30 min.(PDF)Click here for additional data file.Induction of extreme temperature tolerance by varying duration of (A) 37°C pretreatments or (B) 10°C pretreatments and then subjected to (A) 46°C for 100 min or (B) -15°C for 30 min.(PDF)Click here for additional data file.9 Oct 2019PONE-D-19-21471Differential expression of heat shock proteins and antioxidant enzymes in response to temperature, starvation, and parasitism in the Carob moth larvae, Ectomyelois ceratoniae (Lepidoptera: Pyralidae)PLOS ONEDear Dr Bandani,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please pay close attention to the requests of the referees. Referee 2 is concerned about the lack of important citations.We would appreciate receiving your revised manuscript by Nov 23 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Marcelo Hermes-Lima, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Methods section, please provide additional location information of the collection site of Ectomyelois ceratoniae, including geographic coordinates for the data set if available."3. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.4. In your Methods section, please provide additional details regarding the Habrobracon hebetor used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials.5. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Upon resubmission, please provide the following:The name of the colleague or the details of the professional service that edited your manuscriptA copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)A clean copy of the edited manuscript (uploaded as the new *manuscript* file)[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: I Don't Know**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: In this study, Bandani and colleagues set out to investigate the expression of heat shock proteins, the activities of two antioxidant enzymes and levels of lipid peroxidation in Ectomyelois ceratoniae, exposed to heat, cold, starvation, and parasitism stresses. First, authors successfully cloned and sequenced fragment sequences of E. ceratoniaeHSP70 and HSP90 mRNA, this allowed them to design specific primers to assess the transcript levels for these proteins and to perform RNA interference experiments. Noteworthy, animals experiments began with the assessment of the animal’s tolerance to temperature stresses depending on its developmental stage; this supported the design of the following experiments. Authors should note that although L5 were the most resistant to temperature stress, this could not be the case for the other stresses (starvation and parasitism). Temperature stress induced the expression of HSPs at the mRNA levels, and RNA interference significantly affected the survivability. Interestingly, parasitism and starvation induced different HSPs. All stress protocols (heat, cold, parasitism, and starvation) elicited lipid peroxidation and increased the activities of SOD and catalase. These results were expected, since the activation of antioxidant defenses and elevated chaperone proteins are well-known components of the general stress response (https://www.ncbi.nlm.nih.gov/pubmed/15709958). The Discussion provides a reasonable interpretation of the results in the framework of previous studies. Limitations are mentioned, new hypotheses are defined, and a foundation for future studies is provided. I have no further recommendations, except for some minor numbered comments below:1. Line 39: I think the abstract could benefit from a concluding take home message at the end, instead of ending with a description of the results of starvation and parasitism experiments.2. Line 61: Consider including oxygen deprivation in the list of stresses that induce the antioxidant system of insects (see https://www.ncbi.nlm.nih.gov/pubmed/26851497/
https://www.ncbi.nlm.nih.gov/pubmed/26408245 ).3. Line 106-107: Did you mean 18S ribosomal DNA (rDNA)-based primers? Target RNA would not give you information about DNA contamination.4. Line 124: It would be useful to briefly mention the methods used for sequencing HSPs fragments.5. Line 161: Please briefly describe how mortality/survivability was assessed, especially for eggs. Was it based on coloration? Movement? Please clarify.6. Line 201: Consider renaming this section, since MDA is not an antioxidant.7. Line 203: Did the authors use any protease inhibitor during the homogenization for enzyme assays? The use of single protease inhibitors (i.e. phenylmethylsulfonyl fluoride) or commercial cocktails is a common procedure during tissue homogenization prior to the measurement of enzyme activities. This procedure is applied to maintain and preserve protein functionality after tissue homogenization.8. Line 215: Did authors use any antioxidant (e.g., BHT) to avoid lipid peroxidation during the analytical phase of the assay?9. Line 221: Conventionally, author should mention p value considered to indicate significant differences.10. Line 234: Italicize Bicyclus anynana11. Line 276: I think “suboptimal” is not the best term here. Sublethal?12. Figure 5: I was a little confused in the 25-degree pre-treatment for 10 minutes. How was this performed if animals were maintained at “25 +/- 1 °C”? If animals were maintained at 26°C how a ten-minute pre-treatment could take place?13. Figures 5 and 6: If available, plot data for larvae not subjected to any pre-treatment in figures 5 and 6 for comparative purposes.14. Figures: Considering that there are ten figures, I would suggest authors to place most of the survivability data in supplemental material. Do not get me wrong, these results are fundamental for the further experiments and it is a huge positive point of this study (not all studies justify their experimental design (dosage, time of exposure, developmental stage, etc) based on actual data. But I think some of the data might be move to supplemental material (keeping the description in the main text) to make the manuscript more objective.15. Figure 7: The meaning of the different columns fills was not defined, include legends for the column patterns in the figure and/or explain them in the legend.16. Figures: For clarity, consider placing panel labels (A, B, etc) on the upper-left position, not centered.Reviewer #2: The goal of this MS is to understand the role of AOEs and HSPs in the Carob moth as it relates to temperature (low and high), starvation, and parasitism. The authors use a robust strategy that involves gene expression, biochemistry, survivorship and loss of function experiments. I think the results are interesting and worthy of publication.My main concern with the MS has to do with background work and literature. The authors consistently cite new literature, in multiple cases papers that are less than five years old when older examples (10 to 15 yrs old) provide better background information and data. Specifically, the entire literate on heat treatments use in commodities handling is ignored; a growing area of research as the authors know. They also ignore, probably indirectly, a lot of the classic insect HSP and AOE work by Lee, Denlinger, and others. I was surprised and glad to see references to Sinclair’s HSP work but most of the author’s background comes from recent studies that are not very thorough. Additionally, the literature on temperature pre-treatments is also quite vast. It includes work on low temperature pretreatments like rapid cold hardening (also of Lee and Denlinger), rapid heat hardening, and hormesis. I mention this not to point out a flaw, but to suggest to the authors that the literature not being presented in here, might provide answers and mechanistic explanations that would strengthen their MS.My second main concern has to do with the tone of the MS. This is an insect MS written for an insect audience but sent to a general broad journal. The authors never explain the reason for their treatments. Why starvation? Why are those temperatures chosen? Why the lengths of treatment? And the parasitism? Does biological control of Ectomyelois involve parasitoids? The authors need to explain a lot about the reason behind their treatments and the biology of the moth in a non-entomology journal. I am an entomologist and work in a similar area, and I do not understand the point of starvation, in this context. Without explanations as to why certain treatments were chosen, the MS reads like a bunch of random experiments pasted together and I suspect that is not the case and that the treatments were chosen rather carefully. If this is a paper about “aoes and hsps in response to common non-pesticide control tactics for Carob moth” then fine, but please do tell us.I have more specific comments below:Line 53, the appropriate reference about insect antioxidant systems is not paper from 2015. I believe there are multiple papers in the 1990s (archives of insect biochemistry had an entire antioxidant issue in 1997, I believe), and dozens of other papers between then and 2015.Line 57, what is the reference for all this insect non-enzymatic antioxidant explanation?Line 60, the authors mention the different stresses that antioxidant/hsps have been involved with in insects. They exclude radiation (UV, gamma, X-ray), dehydration, anoxia, freezing, and wasp venom; which is relevant to their own point.Line 64, HSP are involved in various cellular stressors. It would be a good idea to list them and provide references for each.Line 65, the accepted short hand for small HSPs is smHSPs not sHSPs.Line 162, it is here that the authors should explain the reason behind these temperatures and exposure times.Line 177, since the authors do not reference any literature in rapid cold or rapid heat hardening, they should explain why they are not using standard temperatures and times to induce their rapid hardening protection. It would also be a good idea to cite some of that literature as background.Line 190, the replication strategy is not clear. It reads, “performed three times, and each assay in triplicate.” But it also says 80 larvae in 8 petri dishes. Does that mean 9 sets of 80 larvae total per treatment (3 times with 3 each)?Line 253, unless I missed it, I cannot find when mortality was counted. That information should also be here in the results. Was it at 24, 48, or xx hrs?Line 344, responses is misspelled.Line 360, it should be Fig 10B not 6B, right?Line 394, “the insects responded accordingly by increasing both SOD and CAT…” They did, however lipid peroxidation damage was detected anyway. Is this really a protective release or a curative one? The authors make it sound like the insects are protecting against oxidative damage, but ox damage already happened. The statement needs revision.Line 410, Basically Carob moth is good for RNAi. Is it? The hsp70 knockdown was good but the 90 out was a weak knockdown that barely lasted a day. It was not very persistent. This is a clear difference that should be addressed in the MS. I would argue that RNAi needs to be evaluated in this species and perhaps that big JIP 2011 paper has some ideas that could help in this system.Line 417, hsps “both shared and different mechanisms”. This conclusion type statement is problematic. Hsps 70 and 90 work very differently. They are activated very differently because they rely on different molecules (ATP vs Ca). Their roles are different and while hsp70 is universally present in most stress, 90 is not due to the way it works and not some unknown mechanism. This statement needs revision.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.12 Dec 2019Please see attached "Response to Reviewers" document.Submitted filename: Response to Reviewers.docxClick here for additional data file.8 Jan 2020Differential expression of heat shock proteins and antioxidant enzymes in response to temperature, starvation, and parasitism in the Carob moth larvae, Ectomyelois ceratoniae (Lepidoptera: Pyralidae).PONE-D-19-21471R1Dear Dr. Bandani,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Marcelo Hermes-Lima, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)Reviewer #2: The MS has been dramatically improved in a way that adds scientific soundness and provides the appropriate background information where required. The authors did a commendable job of addressing the concerns.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No13 Jan 2020PONE-D-19-21471R1Differential expression of heat shock proteins and antioxidant enzymes in response to temperature, starvation, and parasitism in the Carob moth larvae, Ectomyelois ceratoniae (Lepidoptera: Pyralidae)Dear Dr. Bandani:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Marcelo Hermes-LimaAcademic EditorPLOS ONE
Authors: D Bar-Or; L T Rael; E P Lau; N K Rao; G W Thomas; J V Winkler; R L Yukl; R G Kingston; C G Curtis Journal: Biochem Biophys Res Commun Date: 2001-06-15 Impact factor: 3.575