Mitsuharu Matsumoto1, Hiroaki Yashiro2, Hitomi Ogino1, Kazunobu Aoyama3, Tadahiro Nambu4, Sayuri Nakamura4, Mayumi Nishida1, Xiaolun Wang2, Derek M Erion2, Manami Kaneko1. 1. Department of Integrated Biology, Axcelead Drug Discovery Partners, Inc., Fujisawa, Kanagawa, Japan. 2. Gastroenterology Drug Discovery Unit, Takeda Pharmaceutical Company Limited, Cambridge, Massachusetts, United States of America. 3. Department of Drug Disposition & Analysis, Axcelead Drug Discovery Partners, Inc., Fujisawa, Kanagawa, Japan. 4. Department of Nonclinical Safety Research, Axcelead Drug Discovery Partners, Inc., Fujisawa, Kanagawa, Japan.
Abstract
Acetyl-CoA carboxylase (ACC) catalyzes the rate-limiting step in de novo lipogenesis, which is increased in the livers of patients with nonalcoholic steatohepatitis. GS-0976 (firsocostat), an inhibitor of isoforms ACC1 and ACC2, reduced hepatic steatosis and serum fibrosis biomarkers such as tissue inhibitor of metalloproteinase 1 in patients with nonalcoholic steatohepatitis in a randomized controlled trial, although the impact of this improvement on fibrosis has not fully been evaluated in preclinical models. Here, we used Western diet-fed melanocortin 4 receptor-deficient mice that have similar phenotypes to nonalcoholic steatohepatitis patients including progressively developed hepatic steatosis as well as fibrosis. We evaluated the effects of ACC1/2 inhibition on hepatic fibrosis. After the confirmation of significant hepatic fibrosis with a 13-week pre-feeding, GS-0976 (4 and 16 mg/kg/day) treatment for 9 weeks lowered malonyl-CoA and triglyceride content in the liver and improved steatosis, histologically. Furthermore, GS-0976 reduced the histological area of hepatic fibrosis, hydroxyproline content, mRNA expression level of type I collagen in the liver, and plasma tissue metalloproteinase inhibitor 1, suggesting an improvement of hepatic fibrosis. The treatment with GS-0976 was also accompanied by reductions of plasma ALT and AST levels. These data demonstrate that improvement of hepatic lipid metabolism by ACC1/2 inhibition could be a new option to suppress fibrosis progression as well as to improve hepatic steatosis in nonalcoholic steatohepatitis.
Acetyl-CoA carboxylase (ACC) catalyzes the rate-limiting step in de novo lipogenesis, which is increased in the livers of patients with nonalcoholic steatohepatitis. GS-0976 (firsocostat), an inhibitor of isoforms ACC1 and ACC2, reduced hepatic steatosis and serum fibrosis biomarkers such as tissue inhibitor of metalloproteinase 1 in patients with nonalcoholic steatohepatitis in a randomized controlled trial, although the impact of this improvement on fibrosis has not fully been evaluated in preclinical models. Here, we used Western diet-fed melanocortin 4 receptor-deficient mice that have similar phenotypes to nonalcoholic steatohepatitispatients including progressively developed hepatic steatosis as well as fibrosis. We evaluated the effects of ACC1/2 inhibition on hepatic fibrosis. After the confirmation of significant hepatic fibrosis with a 13-week pre-feeding, GS-0976 (4 and 16 mg/kg/day) treatment for 9 weeks lowered malonyl-CoA and triglyceride content in the liver and improved steatosis, histologically. Furthermore, GS-0976 reduced the histological area of hepatic fibrosis, hydroxyproline content, mRNA expression level of type I collagen in the liver, and plasma tissue metalloproteinase inhibitor 1, suggesting an improvement of hepatic fibrosis. The treatment with GS-0976 was also accompanied by reductions of plasma ALT and AST levels. These data demonstrate that improvement of hepatic lipid metabolism by ACC1/2 inhibition could be a new option to suppress fibrosis progression as well as to improve hepatic steatosis in nonalcoholic steatohepatitis.
The prevalence of nonalcoholic fatty liver disease (NAFLD) is rapidly increasing worldwide and now the most common liver disorder in the western world [1]. NAFLD is strongly associated with metabolic abnormalities such as obesity, insulin resistance, and type 2 diabetes mellitus, and it encompasses complicated and extensive liver diseases including asymptomatic steatosis and more aggressive nonalcoholic steatohepatitis (NASH) [2, 3]. NASH is characterized by steatosis, cytoskeletal damage (hepatocellular ballooning), lobular inflammation and fibrosis [4]. Because the progression of fibrosis in NASH leads to liver cirrhosis, which results in liver failure, portal hypertension, and hepatocellular carcinoma, suppressing the progression of fibrosis is critical in order to improve mortality rates [5, 6]. Despite the significant efforts in clinical development for drug to treat fibrosis and NASH, there is currently no approved drugs to treat these conditions [7, 8]. Therefore, available therapy for NASH is limited mostly to lifestyle interventions such as weight loss and vitamin E supplementation [9].The pathogenesis of NASH has been an area of intense interest in recent research and development. The multiple parallel hits theory comprises a wide spectrum of potential risk factors such as insulin resistance, oxidative stress, proinflammatory cytokines and microbiota changes [10]. Among these hypotheses, it has been consistently demonstrated that insulin resistance plays an important role in the progression of NASH, following numerous studies in animal models and patients with NAFLD [11]. In insulin-resistant states, hyperinsulinemia induces an elevation of sterol regulatory element binding protein 1 (SREBP-1) expression in hepatocytes, resulting in the transcriptional activation of all lipogenic genes including ACC which promotes de novo lipogenesis (DNL). ACC exists as two isozymes that are encoded by separate genes and display distinct cellular distributions [12-17]. Although both isoforms are expressed in various tissues, ACC1 is predominantly expressed in lipogenic tissues such as liver and adipose tissue, while ACC2 is predominantly expressed in the heart, skeletal muscle and liver. ACC1 is cytosolic while ACC2 is associated with mitochondria. In the liver, malonyl-CoA formed by ACC1 in the cytoplasm is primarily used for DNL, whereas malonyl-CoA formed by ACC2 at the mitochondrial surface allosterically suppresses carnitine palmitoyltransferase I (CPT1) and mitochondrial fatty acid oxidation [12, 15–17]. About 25% of hepatic triglycerideaccumulated in patients with NAFLD is derived from hepatic DNL and patients with NAFLD have significantly higher rates of hepatic DNL compared with lean individuals [18,19]. Based on these insights, it appears that triglyceride derived from DNL makes a major contribution to hepatic steatosis; therefore, the inhibition of DNL might be the best approach to suppress or prevent further deterioration of hepatic steatosis [19, 20].Liver-specific ACC1 knockout (KO) mice, which were independently produced for two different studies, showed a reduction of hepatic DNL compared to that of control mice only when they were fed a high-sucrose diet [21, 22]. Hepatocytes of liver specific ACC2 KO mice displayed higher fatty acid oxidation accompanied with higher CPT1 activity [23]. Furthermore, antisense oligonucleotide inhibitors of ACC2 enhanced fatty acid oxidation in primary rat hepatocytes [24]. These results suggest that dual inhibition of ACC1/2 in hepatocytes has more potential for improvement of steatosis than inhibition of either gene individually, due to both inhibition of DNL and stimulation of fatty acid oxidation [12]. Recently, GS-0976 (firsocostat), a liver-targeted potent inhibitor of both ACC1/2, has been reported to inhibit humanACC1 and ACC2 with IC50 values of 2.1 and 6.1 nM, respectively [25]. This compound has been shown to reduce DNL in cultured HepG2 cells, stimulate fatty acid oxidation in cultured C2C12 cells, and reduce hepatic DNL in normal rats [25, 26]. Long-term treatment with GS-0976 reduced hepatic steatosis and improved dyslipidemia in rats with diet-induced obesity. Furthermore, this drug improved hepatic steatosis and lowered hemoglobin A1c in Zucker diabeticrats. GS-0976 also reduced levels of a hepatic steatosis and serum fibrosis marker, tissue metalloproteinase inhibitor 1 (TIMP-1), in patients with NASH [27]. However, in the same study, GS-0976 did not significantly decrease levels of two other serum fibrosis markers, procollagen III N-terminal peptide and hyaluronic acid. It has not been verified whether inhibition of ACC1/2 would improve hepatic fibrosis in NASH.In this study, we examined effects of ACC1/2 dual inhibition by GS-0976 on fibrosis using melanocortin 4 receptor (MC4R) KO mice fed a Western diet (WD). MC4R is a seven-transmembrane G-protein-coupled receptor expressed in hypothalamic nuclei and is implicated in the regulation of appetite and body weight [28]. WD-fed MC4R KO mice are known to exhibit pathophysiological changes of NASH including hepatic steatosis, liver fibrosis and hepatocellular carcinoma following the obesity-related phenotype [29, 30]. We generated MC4R KO mice and evaluated the effects of GS-0976 on hepatic steatosis and fibrosis in WD-fed MC4R KO mice. Furthermore, because ACC inhibition has been reported to reduce hepatic steatosis but elevate plasma triglyceride concentrations in mice, rats and patients with NASH [20, 31], we also monitored its influence on plasma parameters to investigate the usefulness of ACC dual inhibition.
Materials and methods
Compounds
1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-α,α,5-trimethyl-6-(2-oxazolyl)-2,4-dioxo-thieno[2,3-d]pyrimidine-3(2H)-acetic acid, GS-0976, was synthesized as reported previously [25].
Generation of MC4R knockout mice
A targeting vector for homologous recombination was constructed by insertion of an mCherry unit and a neomycin resistant unit between the transcription start site and the initiation codon of the MC4R gene with BAC clone RP23-112M22 using the Red/ET recombination kit (Gene Bridges GmbH, Land Baden-Württemberg, Germany). The resulting vector was electroporated into C57BL/6J mouse ES cells [32] and recombinant cells were selected using G418. The ES cells showing correct homologous recombination were screened by real-time PCR genotyping. The resulting ES cells were injected into ICR mousetetraploid blastocysts. Chimeric offspring were identified by coat color. Chimeric male mice with high ES cell contribution were crossed with C57BL/6J females and germ line transmission was predicted by coat color and confirmed by PCR genotyping (Fig 1). PCR primer sets for wild type (WT) (P1, 5´–GCAGTACAGCGAGTCTCAGG–3´ and P2, 5´–CTCATAGCATCCTCCGTCCG –3´; 474 bp) and KO (P3, 5´–GGATCTCCTGTCATCTCACCTTGC–3´ and P4, 5´–TAGCCAACGCTATGTCCTGATAGC–3´; 374 bp) were used for genotyping.
Fig 1
Schematic diagrams of wild-type Mc4r allele and Mc4r KO allele.
mCherry unit (mCherry and polyoma polyA signal) and neomycin resistant unit (pgk promoter, neomycin resistant gene and bgh polyA signal) were inserted by homologous recombination between the transcription start site and the initiation codon of the Mc4r gene to disrupt Mc4r transcription. WT: wild type, KO: knockout, Neo: neomycin resistant unit, pgk: mouse phosphoglycerate kinase, bgh: bovine growth hormone. The primers for PCR genotyping are shown by arrowheads (P1, P2, P3 and P4).
Schematic diagrams of wild-type Mc4r allele and Mc4r KO allele.
mCherry unit (mCherry and polyoma polyA signal) and neomycin resistant unit (pgk promoter, neomycin resistant gene and bgh polyA signal) were inserted by homologous recombination between the transcription start site and the initiation codon of the Mc4r gene to disrupt Mc4r transcription. WT: wild type, KO: knockout, Neo: neomycin resistant unit, pgk: mousephosphoglycerate kinase, bgh: bovine growth hormone. The primers for PCR genotyping are shown by arrowheads (P1, P2, P3 and P4).
Repeated dosing study in WD-fed MC4R knockout mice
Male MC4R KO mice were fed with WD (D12079B; Research Diets, New Brunswick, Canada) for 13 weeks starting at 11 weeks of age. Normal chow-fed (CE-2; CLEA Japan, Tokyo, Japan) wild type littermates of the same age were used as lean controls. Both types of mice were allowed ad libitum access to food and water. The mice were individually housed under controlled temperature, humidity and a 12-hour light-dark cycle (lights on 7:00–19:00). Blood was collected from the tail vein. Plasma alanine transaminase (ALT), aspartate aminotransferase (AST), triglyceride, total cholesterol, and glucose were measured enzymatically using a Clinical Analyzer 7180 (Hitachi High-Technologies, Tokyo, Japan). Plasma insulin concentrations were measured using an ultrasensitive mouseinsulin enzyme-linked immunosorbent assay kit (Morinaga Institute of Biological Science, Kanagawa, Japan). Plasma TIMP-1 concentrations were measured using MouseTIMP-1 Quantikine ELISA Kit (R&D Systems, Minnesota, US). Mice were randomly divided into groups based on plasma parameters, the AST/ALTratio, food intake and body weight. Six MC4R KO mice, whose plasma parameters and body weights were almost identical to the initial values of the individuals selected for repeated dosing study, were euthanized in order to evaluate hepatic triglyceride and hydroxyproline content without drug treatment. GS-0976 (4 and 16 mg/kg/day) was orally administered twice a day for 9 weeks. Body weight and food intake were monitored for 8 weeks from the beginning of treatment with GS-0976. After 8 weeks of treatment, plasma parameters were measured again. After 9 weeks of treatment, all mice were anesthetized with isoflurane (3–5%) 1 hour after the last drug administration and then the liver was harvested for histopathological and gene expression analysis in the same manner. Hepatic triglyceride, hydroxyproline and malonyl-CoA levels were also measured. All animal experiments were approved by the Institutional Animal Care and Use Committee of Shonan Research Center, Takeda Pharmaceutical Company Limited (AU-00011733, AU-00020014, AU-00010116).
Measurement of tissue malonyl-CoA content
Seven-week-old male C57BL/6J mice fed with normal chow were divided into 7 groups based on their body weights. GS-0976 was orally administered once, then liver and muscle were harvested and frozen 1 hour later. The liver was also harvested 1 hour after the last drug administration in the repeated dosing study using WD-fed MC4R KO mice. These samples were homogenized in 6% perchloric acid containing malonyl-CoA 13C3 (Sigma-Aldrich, Missouri, US) as an internal standard. After centrifugation, the supernatant was subjected to solid phase extraction using the Oasis HLB Extraction Cartridge (Waters, Massachusetts, US). The analyte was eluted with acetonitrile supplemented with dibutylammonium acetate (Tokyo Chemical Industries, Tokyo, Japan), followed by rinsing of the column with ultrapurified water. The eluate was dried down under a stream of nitrogen and the residue was reconstituted in 100 μL of ultrapure water. An aliquot of 10 μL was injected into an LC-MS/MS system. The LC-MS/MS setup consisted of a Shimadzu LC-20AD HPLC system (Shimadzu, Kyoto, Japan) and an API5000 mass spectrometer (AB Sciex, California, US). The analytical column was a CAPCELL CORE C18 (2.7 μm, 2.1 x 50 mm, Shiseido, Kanagawa, Japan) used at 40 °C. The mobile phases were composed of (A) 50 mmol/L ammonium carbonate/ammonium hydroxide (pH 9) supplemented with dibutylammonium acetate and (B) acetonitrile. The stepwise gradient program used was as follows: 0–2.5 min, B 1–30%; 2.5–3 min, B 30–95%; 3–4 min, B 95%; 4–4.01 min, B 95–1%; and 4.01–6 min, B 1%. The flow rate of the mobile phase was set at 0.5 mL/min.
Measurement of hepatic triglyceride and hydroxyproline content
For the measurement of hepatic triglyceride, samples of liver were homogenized at a concentration of 100 mg of tissue per 1 mL of saline, and then the homogenate was mixed thoroughly with a combination of hexane and 2-propanol (3:2). After centrifugation, the upper organic layer containing lipids was collected. Hexane and 2-propanol solution were added, and the upper layer was collected again. The collected upper layers were dried, and the residue was dissolved in 2-propanol. Triglyceride concentration was measured using the Triglyceride-E test (Fujifilm Wako Pure Chemical Industries, Osaka, Japan). Hepatic hydroxyproline content was measured by a commercially available total collagen kit (QuickZyme Biosciences, Zuid-Holland, Netherlands) according to the manufacturer’s instructions.
Histological analysis
Excised liver sections were fixed with 10% neutralized formalin and embedded in paraffin. Three-micrometer paraffin sections were stained with Hematoxylin and Eosin and evaluated NAFLD Activity Score by the pathologists [33]. The pathologists were blinded to the animal information including strain, compound and dose. To evaluate fibrosis, 3-millimeter paraffin sections were stained with 0.1% Sirius Red / 0.1% Fast Green FCF solution. Whole slide digital images were acquired with a Scanscope XT (Leica Microsystems, Tokyo, Japan). The regions of interest were manually drawn passing over the connective tissues around the large blood vessels in a blinded fashion and the percentage of Sirius Red-positive area in the total region of interest was evaluated using ImageScope (v12.3.2.8013, Leica Microsystems).
mRNA expression analysis by real-time PCR
Total RNA was isolated from 50–100 mg of liver tissue using the RNeasy Lipid Tissue Mini kit (Qiagen, Tokyo, Japan) followed by reverse transcription using the High Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Tokyo, Japan) according to the manufacturer’s instructions. cDNA was amplified by TaqMan Universal Master Mix II (Thermo Fisher Scientific, Tokyo, Japan) using an ABI7900 (Thermo Fisher Scientific, Tokyo, Japan) according to the manufacturer’s instructions. Commercially available primer-probe sets were used (Thermo Fisher Scientific, Tokyo, Japan). The sets were as follows: mouse collagen type1 alpha1 (Col1a1) (Mm00801666), mouse collagen type1 alpha2 (Col1a2) (Mm00483888), F4/80 (Mm00802529), transforming growth factor-β1 (TGF-β1) (Mm01178820). 36B4 (Mm00725448) was used as an endogenous control gene. Relative mRNA expression was calculated by the ΔΔCt method.
Statistical analysis
All data in the graph are represented as the mean + SD. For evaluation of the effects of GS-0976, statistical differences between vehicle and GS-0976 treatment in MC4R KO mice were analyzed by a one-tailed Williams’ test or Shirley-Williams test. The p-values < 0.025 were considered statistically significant. To confirm the establishment of the disease state, statistical differences between lean control mice and vehicle-treated WD-fed MC4R KO mice were analyzed by Student’s t-test or Aspin-Welch test. The p-values < 0.05 were considered statistically significant.
Results
Tissue malonyl-CoA reduced by a single administration of GS-0976 in normal mice
In order to confirm target engagement of GS-0976 in vivo, tissue content of malonyl-CoA, which is a product of ACC1/2, was measured in normal C57BL/6 mice. A single oral administration of GS-0976 (0.3–100 mg/kg) significantly decreased hepatic malonyl-CoA content in a dose-dependent manner (Fig 2). In contrast, reductions of malonyl-CoA by GS-0976 were weaker in skeletal muscle. Although GS-0976 at 30 and 100 mg/kg significantly decreased malonyl-CoA in the skeletal muscle by 88 and 99%, respectively, lower dosing of GS-0976 did not decrease it, suggesting that GS-0976 is liver-specific at single doses of 10 mg/kg or less. Therefore, doses of 2 and 8 mg/kg, b.i.d. (4 and 16 mg/kg/day) were selected for the repeated dosing study to examine the anti-NASH effect of GS-0976 in MC4R KO mice.
Fig 2
Effects of a single oral administration of GS-0976 on liver and skeletal muscle malonyl-CoA content in C57BL/6 mice.
(A) Liver malonyl-CoA content. (B) Gastrocnemius skeletal muscle malonyl-CoA content. The liver and skeletal muscle were harvested 1 hour after a single oral administration of vehicle (n = 10) or GS-0976 (0.3–100 mg/kg, n = 5) from C57BL/6J mice fed with normal chow. Data are represented as the mean + SD, ##p<0.005 vs. vehicle by one-tailed Shirley-Williams test.
Effects of a single oral administration of GS-0976 on liver and skeletal muscle malonyl-CoA content in C57BL/6 mice.
(A) Liver malonyl-CoA content. (B) Gastrocnemius skeletal muscle malonyl-CoA content. The liver and skeletal muscle were harvested 1 hour after a single oral administration of vehicle (n = 10) or GS-0976 (0.3–100 mg/kg, n = 5) from C57BL/6J mice fed with normal chow. Data are represented as the mean + SD, ##p<0.005 vs. vehicle by one-tailed Shirley-Williams test.
Chronic treatment in WD-fed MC4R KO mice
The experimental protocol for the multiple dosing study in the MC4R KO mice is shown in Fig 3. The body weight of WD-fed MC4R KO mice was 1.8 times greater than that of lean control mice before treatment with GS-0976 (Fig 4A). Body weight in WD-fed MC4R KO mice treated with vehicle was further increased by 8.9% from the initial values (Fig 4C). Cumulative caloric intake of vehicle-treated MC4R KO mice was 1.5 times higher compared to control mice (Fig 4B), indicating that WD-fed MC4R KO mice had an obesity phenotype due in part to overeating as previously reported [33]. Treatment with GS-0976 (4 and 16 mg/kg/day, b.i.d.) for 9 weeks was well tolerated. At 16 mg/kg/day, weight gain was significantly suppressed at 4.5% compared with the vehicle-treated group, without an effect on food intake. Significant effects on weight gain and calorie intake were not observed with GS-0976 at 4 mg/kg/day.
Fig 3
Experimental protocol for repeated dosing study using MC4R KO mice.
Eleven-week-old male MC4R KO mice were fed with WD for 22 weeks. Drug treatments were started 13 weeks after pre-feeding. GS-0976 (4 and 16 mg/kg/day) was orally administered twice a day for 9 weeks starting at 24 weeks of age. The white triangle marks the collection of blood before and after the 8-week treatment. The black triangle marks harvesting of the liver after 9 weeks of treatment.
Fig 4
Effects of GS-0976 on body weight and cumulative calorie intake.
(A) Change of body weight for 8 weeks. (B) Cumulative calorie intake for 8 weeks. (C) Rate of body weight change from the values before the start of drug administration. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Student’s t-test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test.
Experimental protocol for repeated dosing study using MC4R KO mice.
Eleven-week-old male MC4R KO mice were fed with WD for 22 weeks. Drug treatments were started 13 weeks after pre-feeding. GS-0976 (4 and 16 mg/kg/day) was orally administered twice a day for 9 weeks starting at 24 weeks of age. The white triangle marks the collection of blood before and after the 8-week treatment. The black triangle marks harvesting of the liver after 9 weeks of treatment.
Effects of GS-0976 on body weight and cumulative calorie intake.
(A) Change of body weight for 8 weeks. (B) Cumulative calorie intake for 8 weeks. (C) Rate of body weight change from the values before the start of drug administration. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Student’s t-test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test.
Blood biochemistry
At the start of drug treatment, WD-fed MC4R KO mice displayed higher plasma ALT and AST, which are released from injured hepatocytes into circulation (Fig 5). Additionally, although the mice maintained normoglycemia, they developed hyperinsulinemia (Table 1). Plasma triglyceride concentrations in MC4R KO mice were similar with those of lean control mice, meanwhile total cholesterol concentrations were 4 times higher compared with those of control mice. These data suggest that WD-fed MC4R KO mice exhibited hepatocellular injury due to metabolic dysfunction from insulin resistance and disruption of lipid metabolism. Treatment with GS-0976 at 4 and 16 mg/kg/day lowered plasma ALT levels by 76 and 82% and AST levels by 70 and 80% compared with vehicle treatment, respectively (Fig 5). GS-0976 at 4 and 16 mg/kg/day also significantly lowered plasma total cholesterol concentrations by 32 and 36% compared with vehicle treatment, respectively. At the same time, GS-0976 at 4 and 16 mg/kg/day significantly increased plasma insulin concentrations 6- and 8-fold, and slightly but significantly increased plasma glucose concentrations 1.1- and 1.2-fold compared with the vehicle-treated group, respectively. Furthermore, both doses significantly increased plasma triglyceride concentrations compared with vehicle treatment. These data suggest that GS-0976 improved markers of hepatic injury and cholesterol metabolism, whereas this compound deteriorated glucose and triglyceride metabolism and accelerated hyperinsulinemia.
Fig 5
Effects of GS-0976 on plasma alanine aminotransferase and aspartate aminotransferase levels.
(A) Plasma alanine aminotransferase levels. (B) Plasma aspartate aminotransferase levels. Plasma was obtained before and after the 8-week treatment. The hollow column shows values pre-treatment and the shaded column shows values post-treatment for the lean control group (Control, n = 5) and MC4R KO mice treated with vehicle or GS-0976 (4 or 16 mg/kg/day) (n = 8). Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Shirley-Williams test.
Table 1
Effects of GS-0976 on plasma glucose, triglyceride, total cholesterol, and insulin concentrations.
Mice
Control
MC4R KO
Treatment
Vehicle
Vehicle
GS-0976
Dose (mg/kg/day)
4
16
(n = 5)
(n = 8)
(n = 8)
(n = 8)
Total cholesterol(mg/dL)
Pre
91 ± 4
363 ± 35
373 ± 42
371 ± 48
Post
85 ± 6**
389 ± 39
264 ± 37##
249 ± 28##
Triglyceride(mg/dL)
Pre
111 ± 10
96 ± 23
94 ± 19
106 ± 29
Post
86 ± 26
90 ± 35
170 ± 47##
152 ± 54##
Glucose(mg/dL)
Pre
146 ± 7
140 ± 6
133 ± 10
133 ± 13
Post
149 ± 9
143 ± 16
163 ± 15#
173 ± 18##
Insulin(ng/mL)
Pre
0.9 ± 0.4
12.4 ± 5.8
13.7 ± 7.7
16.2 ± 6.3
Post
0.7 ± 0.1**
9.4 ± 3.9
59.9 ±39.8##
79.3 ±22.7##
Plasma parameters were measured in lean control mice (Control, n = 5) and MC4R KO mice (n = 8) before (Pre) and after 8-week treatment (Post). Data are represented as the mean ± SD,
**p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test.
#p<0.025,
##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or one-tailed Shirley-Williams test.
Effects of GS-0976 on plasma alanine aminotransferase and aspartate aminotransferase levels.
(A) Plasma alanine aminotransferase levels. (B) Plasma aspartate aminotransferase levels. Plasma was obtained before and after the 8-week treatment. The hollow column shows values pre-treatment and the shaded column shows values post-treatment for the lean control group (Control, n = 5) and MC4R KO mice treated with vehicle or GS-0976 (4 or 16 mg/kg/day) (n = 8). Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Shirley-Williams test.Plasma parameters were measured in lean control mice (Control, n = 5) and MC4R KO mice (n = 8) before (Pre) and after 8-week treatment (Post). Data are represented as the mean ± SD,**p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test.#p<0.025,##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or one-tailed Shirley-Williams test.
Liver weights and hepatic triglyceride content
Liver weights and hepatic triglyceride content in vehicle-treated MC4R KO mice after 9-week treatment were 4.3- and 12-fold higher than those in lean control mice (Fig 6). The liver weights and triglyceride content in WD-fed MC4R KO mice before and after treatment was similar (liver weight before: 6.52 ± 0.82, after: 6.56 ± 0.84 g; triglyceride content before: 116 ± 11, after: 105 ± 15 mg/g tissue), suggesting that hepatic steatosis had already been established before drug treatment by pre-feeding with WD for 13 weeks. Liver weights in the GS-0976-treated groups (4 and 16 mg/kg/day) were significantly lower compared to those of vehicle-treated group by 32 and 38%, respectively. Similarly, hepatic triglyceride content was also significantly lower by 59 and 65% in GS-0976-treated groups. These data demonstrate that GS-0976 has therapeutic effects on hepatic steatosis in WD-fed MC4R KO mice.
Fig 6
Effects of GS-0976 on liver weight and liver triglyceride content.
(A) Liver weight. (B) Liver triglyceride content. The liver was harvested one hour after the last administration of the 9-week treatment. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test.
Effects of GS-0976 on liver weight and liver triglyceride content.
(A) Liver weight. (B) Liver triglyceride content. The liver was harvested one hour after the last administration of the 9-week treatment. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test.
NAFLD activity score
Histological analysis demonstrated an increase of the hepatic steatosis and weak lobular inflammation in vehicle-treated MC4R KO mice fed with WD after 9-week treatment compared with lean control mice (Fig 7, Table 2). On the other hand, ballooning degeneration was not clearly observed in vehicle-treated MC4R KO mice, suggesting that WD-fed MC4R KO mice showed severe steatosis with weak inflammation in the liver. Treatment with GS-0976 at 4 and 16 mg/kg/day lowered the steatosis score dose-dependently but did not show clear effect on inflammation score compared with vehicle treatment. As a result, GS-0976 lowered NAFLD activity score dose-dependently compared with vehicle treatment, reflecting the reduction of the steatosis score by GS-0976.
Fig 7
Effects of GS-0976 on NAFLD activity score in histological analysis.
Histological sections of the liver from vehicle group (a), GS-0976 4 mg/kg/day group (b), GS-0976 16 mg/kg/day group (c) and lean control group (d). Hematoxylin and eosin, bar = 100 μm.
Table 2
Effects of GS-0976 on steatosis, lobular inflammation, ballooning degeneration, and NAFLD activity score.
Mice
Control
MC4R KO
Treatment
Vehicle
Vehicle
GS-0976
Dose (mg/kg/day)
4
16
(n = 5)
(n = 8)
(n = 8)
(n = 8)
Steatosis
0.0 ± 0.0
3.0 ± 0.0
1.9 ± 0.4
1.3 ± 0.5
Lobular inflammation
0.0 ± 0.0
1.0 ± 0.0
0.9 ± 0.4
1.0 ± 0.0
Ballooning degeneration
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
NAFLD activity score
0.0 ± 0.0
4.0 ± 0.0
2.8 ± 0.7
2.3 ± 0.5
Individual scores for steatosis (0–3), inflammation (0–3) and ballooning (0–2) were provided and were added up to determine the NAFLD activity score as a semi-quantitative measure of disease severity. Steatosis, inflammation and hepatocyte ballooning were scored according to the previous report [33].
Effects of GS-0976 on NAFLD activity score in histological analysis.
Histological sections of the liver from vehicle group (a), GS-0976 4 mg/kg/day group (b), GS-0976 16 mg/kg/day group (c) and lean control group (d). Hematoxylin and eosin, bar = 100 μm.Individual scores for steatosis (0–3), inflammation (0–3) and ballooning (0–2) were provided and were added up to determine the NAFLD activity score as a semi-quantitative measure of disease severity. Steatosis, inflammation and hepatocyte ballooning were scored according to the previous report [33].
Hepatic gene expression related to fibrosis and inflammation
NASHpatients exhibit fibrosis and inflammation in the liver, which are hypothesized to be induced by hepatic steatosis. Therefore, we evaluated the mRNA expression of Col1a1, Col1a2, and TGF-β1 as markers of fibrosis and F4/80 as a marker of macrophage in the liver. The mRNA levels of Col1a1, Col1a2, TGF-β1, and F4/80 were significantly higher in the liver of MC4R KO mice compared with control mice (Fig 8). The mRNA levels of Col1a1 were significantly reduced by treatment with GS-0976 at 4 and 16 mg/kg/day, and the levels of the Col1a2 gene were also significantly reduced by GS-0976 at 16 mg/kg/day. In contrast, GS-0976 did not change the expression levels of F4/80 and TGFβ1 genes.
Fig 8
Effects of GS-0976 on hepatic mRNA expression.
Gene expressions of (A) collagen1 α1 (Col1a1), (B) collagen1 α2 (Col1a2), (C) Transforming growth factor β1 (TGFβ1) and (D) F4/80. The liver was harvested one hour after the last administration of the 9-week treatment. Gene expressions were measured in the liver homogenates. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test, #p<0.025, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or Shirley-Williams test.
Effects of GS-0976 on hepatic mRNA expression.
Gene expressions of (A) collagen1 α1 (Col1a1), (B) collagen1 α2 (Col1a2), (C) Transforming growth factor β1 (TGFβ1) and (D) F4/80. The liver was harvested one hour after the last administration of the 9-week treatment. Gene expressions were measured in the liver homogenates. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test, #p<0.025, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or Shirley-Williams test.
Hepatic hydroxyproline content, fibrosis area and plasma TIMP-1
We examined direct effect of GS-0976 on fibrosis by measurement of hepatic hydroxyproline content and Sirius Red-positive area for hepatic collagen deposition. Hepatic hydroxyproline content in MC4R KO mice was 4.1-fold higher than that in control mice at the end of the study (Fig 9C). Hepatic hydroxyproline content increased 1.9-fold with the 9-week WD feeding in MC4R KO mice, suggesting that fibrosis had developed before drug treatment and was exacerbated during the 9-week WD feeding (before: 1.4 ± 0.4 mg/g tissue, after: 2.6 ± 0.4 mg/g tissue). GS-0976 at 4 and 16 mg/kg/day significantly lowered hydroxyproline content compared to vehicle treatment by 28 and 35%, respectively (4 mg/kg/day: 1.9 ± 0.6, 16 mg/kg/day: 1.7 ± 0.5 mg/g tissue). Since GS-0976 did not completely decrease hydroxyproline content to pre-drug treatment levels, GS-0976 suppressed the progression of fibrosis in WD-fed MC4R KO mice. Furthermore, GS-0976 at 4 and 16 mg/kg/day also significantly decreased the Sirius Red-positive area by 40 and 39%, respectively (Fig 9A and 9B). Fibrosis in the liver is accompanied by extracellular matrix remodeling, and TIMP-1, matrix metalloproteinases inhibitor, play an important role. We measured plasma TIMP-1 concentrations after 8-week treatment. Plasma TIMP-1 concentrations in WD-fed MC4R KO mice were 3.2 times higher compared with those of lean control mice (Fig 9D). Treatment with GS-0976 at 4 and 16 mg/kg/day significantly lowered plasma TIMP-1 concentrations by 49 and 64% compared with vehicle treatment, respectively.
Fig 9
Effect of GS-0976 on fibrosis.
(A) Representative images of liver sections stained with Sirius Red from vehicle group (a), GS-0976 4 mg/kg/day group (b), and GS-0976 16 mg/kg/day group (c), bar = 400μm. (B) Fibrosis areas in Sirius Red-stained sections were quantified using Scanscope XT. (C) Hydroxyproline content was measured in the liver homogenates as an index of collagen content. (D) Plasma TIMP-1 concentrations were measured after 8-week treatment. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or Shirley-Williams test.
Effect of GS-0976 on fibrosis.
(A) Representative images of liver sections stained with Sirius Red from vehicle group (a), GS-0976 4 mg/kg/day group (b), and GS-0976 16 mg/kg/day group (c), bar = 400μm. (B) Fibrosis areas in Sirius Red-stained sections were quantified using Scanscope XT. (C) Hydroxyproline content was measured in the liver homogenates as an index of collagen content. (D) Plasma TIMP-1 concentrations were measured after 8-week treatment. Data are represented as the mean + SD, **p<0.01 vs. MC4R KO mice treated with vehicle by Aspin-Welch test. ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Williams’ test or Shirley-Williams test.
Hepatic malonyl-CoA content
Hepatic malonyl-CoA content 1 hour after the last administration at the end of study was measured to confirm the relationship between ACC inhibition and efficacy of GS-0976 in the NASH model. GS-0976 at 4 and 16 mg/kg/day lowered hepatic malonyl-CoA content by 43 and 68%, respectively, indicating that GS-0976 inhibited ACC in the liver in WD-fed MC4R KO mice (Fig 10).
Fig 10
Effects of GS-0976 on liver malonyl-CoA content in repeated dosing study.
The liver was harvested one hour after the last administration of the 9-week treatment in MC4R KO mice. Data are represented as the mean + SD, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Shirley-Williams test.
Effects of GS-0976 on liver malonyl-CoA content in repeated dosing study.
The liver was harvested one hour after the last administration of the 9-week treatment in MC4R KO mice. Data are represented as the mean + SD, ##p<0.005 vs. MC4R KO mice treated with vehicle by one-tailed Shirley-Williams test.
Discussion
Our study demonstrated that WD-fed MC4R KO mice had many characteristics in common with NASHpatients, such as hepatic steatosis, increased Sirius Red-positive area, hepatic hydroxyproline content, fibrosis-related gene expression in the liver and plasma liver enzyme levels as reported previously [29, 30]. In this model, GS-0976, a liver-targeted inhibitor of both ACC1/2, significantly improved severe steatosis, suppressed the progression of fibrosis, and reduced plasma liver enzyme levels.It is known that ACC1/2 dual inhibition reduces hepatic triglyceride content both in normal rodents [20, 24] and in rats with diet-induced obesity [25]. Furthermore, MK-4074, another potent liver targeted inhibitor of ACC1/2, reduced DNL with both single doses and 7-day treatments in healthy subjects; it improved hepatic steatosis with 4 weeks of treatment [20]. Our data also showed that GS-0976 at 4 and 16 mg/kg/day robustly lowered hepatic triglyceride content and improved steatosis histologically in WD-fed MC4R KO mice (Figs 6B and 7). Since GS-0976 at these doses suppressed liver malonyl-CoA content (Fig 10), indicating that it improved hepatic steatosis through the suppression of DNL via ACC1/2 inhibition. Since hepatic DNL in patients with NAFLD is higher compared with that of healthy volunteers [18, 19, 34], the inhibition of DNL by GS-0976 might substantially contribute to a reduction in hepatic lipids. Another potential reason for the massive reduction of hepatic triglyceride content due to GS-0976 is the enhancement of fatty acid oxidation in the liver by ACC2 inhibition. Suppression of ACC2 with antisense oligonucleotides increased fatty acid oxidation in hepatocytes, and ACC1/2 dual inhibition by the same method further increased fatty acid oxidation compared with inhibition of ACC2 alone [24]. Dual inhibition of ACC1/2 could improve hepatic steatosis in patients with NASH through both suppression of DNL and increased fatty acid oxidation.Fibrosis progression in patients with NASH increases the risks of liver-related morbidity and mortality because cirrhosis develops from the progression of fibrosis and can increase the risk of hepatocellular carcinoma. Improving fibrosis or suppressing its progression would be a desired outcome for intervention [35]. In our study, histological fibrosis area, hydroxyproline content, and collagen mRNA expression in the liver were increased in WD-fed MC4R KO mice, and GS-0976 suppressed these fibrosis parameters. Furthermore, GS-0976 decreased plasma TIMP-1 in WD-fed MC4R KO mice (Fig 9D). Recent clinical study has shown that GS-0976 reduced serum TIMP-1 in patients with NAFLD [27, 36], suggesting translation of the anti-fibrosis effect from liver-targeted ACC1/2 dual inhibition in NASHpatients. Although GS-0976 suppressed the hepatic mRNA expression of Col1a1 and Col1a2, it showed no effect on the mRNA expression of TGFβ1 which is one of the most important factors in stimulating type I collagen gene transcription [37, 38]. It was reported that eicosapentaenoic acid showed no effect on mRNA expression of TGFβ1 but suppressed active TGFβ1 protein content in the liver [30]. TGFβ is constitutively synthesized and secreted in a biologically latent form (latent TGFβ), and latent TGFβ is activated through proteolytic cleavage of latency-associated peptide region by serine proteases such as matrix metalloproteinases, plasminogen activators, and αvβ6 integrin cleavage [38, 39]. Therefore, GS-0976 does not affect TGFβ mRNA, but might affect the levels of active TGFβ. In our study, there were the lack of dose-dependent response to GS-0976 in Sirius red-positive area and small differences between two doses in some parameters, although we determined doses of GS-0976 based on the influence on PD marker in single dosing study (Fig 2). GS-0976 also showed a dose-dependent inhibitory effect on PD markers in the repeated study (Fig 10). This might be because the histological evaluation is usually evaluated using a single section. Furthermore, it was also possible that low dose was enough to show efficacy on steatosis and fibrosis in this model.In our model, fibrosis is thought to be indirectly induced through the accumulation of increased fat in the liver. Saturated free fatty acids such as palmitate and stearate, final products of DNL, and their metabolites contribute to lipotoxicity, hepatocyte injury and lipoapoptosis, leading to fibrosis [40]. Oxidative stress is an important factor for inducing fibrosis in NASH. In hepatocytes, oxidative stress is induced by hepatic microsomal lipid peroxidation due to excessive fatty acid delivery and electron leakage from the mitochondrial electron transport system [41, 42]. Inhibition of excess lipogenesis by GS-0976 may contribute to reduction of oxidative stress, resulting in the prevention of fibrosis. Evaluation of oxidative stress in MC4R KO mice treated with GS-0976 is an area of future research. Inflammation is another factor promoting fibrosis in NASH. Gene expressions of F4/80, monocyte chemoattractant protein 1 (MCP-1) and tumor necrosis factor α (TNFα), not but IL-6 were upregulated in WD-fed MC4R KO mice compared with control mice and upregulations of MCP-1 and TNF α mRNA were inhibited by GS-0976 (Fig 8, S1 Fig). However, histological analysis revealed that the level of inflammatory cell infiltration in GS-0976-treated MC4R KO mice was not different from that in vehicle-treated MC4R KO mice (Table 2). This is probably because that the effect of GS-0976 could not be detected due to weak inflammation observed in the model rather than poor efficacy of GS-0976 against inflammation, because lobular inflammation score was low (1.0 ± 0.0) in vehicle-treated MC4R KO mice. The increase in mRNA expression of cytokines might not reach the level that causes infiltration of inflammatory cells.ACC1 homozygous knockout mice do not survive as embryos [43], while ACC2 homozygous knockout mice are healthy and fertile [44], suggesting that ACC inhibition, especially with ACC1, might induce unexpected side effects if the inhibition takes place in the whole body. However, GS-0976 did not cause any abnormal findings except for some increases in blood biochemistry parameters in our study. GS-0976 is liver specific because it was designed to be a substrate of hepatic organic anion-transporting polypeptide, resulting in liver-directed biodistribution and ensuring inhibition of ACC in the liver [26]. GS-0976 caused a significant reduction of malonyl-CoA in the liver, at a dose 10-fold lower than that effective in skeletal muscle in rats [25]. This high specificity to the liver could be contributing to low adverse effects. These insights lead us to expect that liver-targeted GS-0976 could be a safer therapeutic agent for NASH than conventional ACC1 and ACC2 inhibitors without organ specificity.On the other hand, GS-0976 significantly increased plasma triglyceride concentrations in our study (Table 1). Consistent with these results, liver specific double knockout of ACC1/2 also demonstrated increased plasma triglyceride concentrations in mice fed with normal chow or WD [20]. Recently, it was reported that both GS-0976 and MK-4074 increased plasma triglyceride levels in patients with nonalcoholic fatty liver disease, consistent with our pre-clinical data [20, 31]. It was demonstrated that suppression of DNL decreased polyunsaturated fatty acid (PUFA) content as well as saturated fatty acid content in the liver, and reduction of PUFA content increased the expressions of both SREBP-1c and its downstream target glycerol-3-phosphate acyltransferase 1, leading to increased secretion of triglyceride as very low density lipoprotein from the liver [20]. Therefore, plasma triglyceride elevation might be an on-target effect by ACC inhibition. However, others have reported that GS-0976 reduced plasma triglyceride levels in obeserats fed with a high-sucrose diet and that GS-0976 did not affect serum triglyceride in NASHpatients [25, 36]. In addition to plasma triglyceride, plasma glucose and insulin levels were also increased by GS-0976 in our study (Table 1). The exact mechanism is unclear, but an increase in gluconeogenesis may contribute to these phenomena. GS-0976 improve fatty liver but may increase acetyl-CoA content in the liver by inhibition of ACC1/2. In hepatocytes, it has been reported that gluconeogenesis from lactic acid is increased by acetate, which is a substrate for acetyl-CoA, therefore gluconeogenesis could be promoted by increasing acetyl-CoA [45, 46]. Furthermore, increased hepatic acetyl-CoA by GS-0976 may have promoted gluconeogenesis and caused increase in plasma glucose and compensatory plasma insulin. On the other hand, GS-0976 lowered plasma insulin concentrations and exhibited no effects on plasma glucose concentrations in rats with a high-fat diet-induced obesity [25]. Furthermore, GS-0976 did not increase plasma glucose, insulin levels or induce insulin resistance in NASHpatients [25, 36]. These differences may be due to the severity of insulin resistance. Further investigation is needed to clarify the mechanisms of elevation of plasma triglyceride, glucose and insulin levels by GS-0976 in WD-fed MC4R KO mice and further understanding will be elucidated as additional clinical trial results are disclosed.Although the MC4R KO mice used in this study were independently created in our laboratory, the phenotype is similar with that of the WD-fed MC4R KO mice and reflects multiple aspects of pathophysiology of NASHpatients such as liver injury, steatosis, and fibrosis [29]. NASH develops from metabolic disorders such as insulin resistance and obesity [47, 48]. In WD-fed MC4R KO mice, obesity and systemic insulin resistance are likely induced by the combination of hyperphagia induced by MC4Rdeficiency and dietary lipids and fructose [49, 50]. Furthermore, it was reported that the activation of lipogenesis, which is the physiological action of insulin in the liver, remains in animal models fed high fat diets [51] and in NAFLDpatients [52] despite systemic insulin resistance. Hyperinsulinemia in WD-fed MC4R KO mice might further accelerate the development of steatosis. This animal model is considered a suitable NASH model based on obesity and insulin resistance. In contrast to WD-fed MC4R KO mice, diet-induced and chemically induced models using normal mice do not fully reflect humanNASH pathology. Even though a high fat-diet supplemented with fructose or sucrose elicit obesity, insulin resistance, steatosis and steatohepatitis, fibrosis was not observed or mild in nature [50]. Combining WD with MC4R KO mice, which induces substantial obesity and insulin resistance compared to the high fat diet-fed normal mice, is an attractive NASH model with significant fibrosis. Nutrient-deficient diets which are low or devoid of methionine and/or choline are applied to induce severe liver fibrosis. Chemically induced liver damage models are also used for studying mechanisms of hepatic fibrosis progression. However, both nutrient-deficient models and chemically induced models do not fully reflect humanNASH pathology, because these models show weight loss [40, 53]. From these reasons, WD-fed MC4R KO mice could be a better pre-clinical model to study the pharmacology of potential NASH therapies compared to nutrient- and chemical-induced models.In conclusion, we demonstrated that ACC1/2 liver-targeted dual inhibition not only improved hepatic steatosis but also suppressed fibrosis progression in WD-fed MC4R KO mice with severe hepatic steatosis and fibrosis. However, our results also suggested potential risks of GS-0976 as we observed abnormalities in glucose and lipid metabolism. Liver-targeted ACC1/2 inhibitors would be promising drugs for NASHpatientsalthough attention must be paid to systemic effects on glucose and lipid metabolism in clinical use.(PPTX)Click here for additional data file.(PPTX)Click here for additional data file.21 Aug 2019PONE-D-19-19866Acetyl-CoA carboxylase 1 and 2 inhibition ameliorates steatosis and hepatic fibrosis in a MC4R knockout murine model of nonalcoholic steatohepatitisPLOS ONEDear Matsumoto,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Oct 05 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Nobuyuki Takahashi, Ph.D.Academic EditorPLOS ONEJournal requirements;When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf1. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: No**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: NoReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: In this study, Matsumoto et al. examined the effect of the ACC1/2 inhibitor ND-630 on the progression of NASH using a murine model of NASH with similar phenotypes to humanNASHpatients. The authors showed that ND-630 treatment effectively ameliorated hepatic steatosis along with liver fibrosis in the NASH model. Considering an unmet medical need for the treatment of NASH, this study provides significant information on the therapeutic strategy of NASH targeting de novo lipogenesis in the liver. However, additional experiments and discussion are required to understand the overall effects of ND-630 on the NASH model. Specific comments are described below.1. First of all, the authors should validate their MC4R KO mice fed WD as a NASH model, because these mice were independently created in this study. Histological evaluation should be carefully performed using the NAFLD activity score. Did they histologically analyze the mice when ND-630 treatment started at 24-weeks of age?2. The effect of ND-630 on hepatic inflammation should be examined in detail. Did the treatment affect the number of macrophages and expression of proinflammatory cytokines in the liver?3. It is also important to know the effect of ND-630 on the fibrogenic process. The data on Timp-1 (discussed in page 26) should be provided. Since ND-630 treatment markedly suppressed Col1a1 mRNA expression, without affecting mRNA expression of Col1a2 and Tgfb1, how do the authors discuss the underlying mechanisms?4. It is interesting that ND-630 treatment remarkably increased serum insulin concentrations, whereas it suppressed hepatic steatosis. Can the authors provide the plausible reason? Did the authors examine the effect of ND-630 on serum insulin concentrations in wild-type mice fed WD?5. Did ND-630 treatment influence on lipid accumulation and inflammation in other organs, such as adipose tissue and skeletal muscle?6. It would be intriguing if quality of lipid was analyzed in the liver of ND-630-treated mice.Reviewer #2: In this work, Matsumoto et al. report that treatment with two oral doses of the small molecule inhibitor of acetyl-CoA carboxylases 1 and 2 ND-613, given for 9 weeks, attenuates some biochemical and histological markers of liver damage in Western diet-fed melanocortin 4 receptor-deficient mice, a postulated model for NAFLD. They employed C57BL/6J mice fed chow as controls for their experiments. Based on previous findings in Zucker diabeticrats treated with the same inhibitor, in which it was observed that the blockade of ACC1/2 decreased hepatic steatosis and a number or markers of hepatic inflammation and fibrosis, Matsumoto et al. hypothesize that similar effects of ACC1/2 inhibition would be observed in a mouseNAFLD model. Although the present manuscript offers evidence, albeit limited, that add to the postulate that ACC1/2 play a role in improving the biochemical and biological phenotype of NAFLD, this work raises the following critical issues:- A major problem of the present work is the lack of appropriate control groups for the dietary and drug treatments in addition to the lean mice fed chow. There is no control for the mice subjected to the Western diet, and also a proper control group of wild type mice treated with the ACC1/2 inhibitor. Without data from those two additional groups the reported observations could be attributed to differences in diets, or off-target and toxic effects of the ACC 1/2 inhibitor.- Although there is no optimal experimental model for NAFLD, the authors don’t explain the rationale for employing the melanocortin 4 receptor-deficient mice as a more suitable model than the more commonly used diet-based or chemical NAFLD models. Alterations in the mechanisms of appetite and control of food intake promoted by a dysfunctional melanocortin 4 receptor pathway could be potentially responsible for some of the hormonal and metabolic changes described in this work.- Treatment with ND-613 causes a severe hyperinsulinemia in melanocortin 4 receptor-deficient, a relevant finding that was not properly discussed in the manuscript. Also important, the lack of dose-dependent response to the ACC inhibitor in some determinations (liver weight, hepatic triglyceride, hydroxyproline content, etc.) was not addressed in the discussion.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.23 Dec 2019We attached colored word file of "Response to reviewers". Because it is better to find modifications from original manuscript, I would appreciate if you see that file.Response to Reviewer #1 commentsReviewer #1 Comments for the AuthorIn this study, Matsumoto et al. examined the effect of the ACC1/2 inhibitor ND-630 on the progression of NASH using a murine model of NASH with similar phenotypes to humanNASHpatients. The authors showed that ND-630 treatment effectively ameliorated hepatic steatosis along with liver fibrosis in the NASH model. Considering an unmet medical need for the treatment of NASH, this study provides significant information on the therapeutic strategy of NASH targeting de novo lipogenesis in the liver. However, additional experiments and discussion are required to understand the overall effects of ND-630 on the NASH model. Specific comments are described below.Authors’ responseWe appreciate your time and effort in reviewing this manuscript and for the useful suggestions that improved the quality of our manuscript. We have responded to the best of our abilities for each of your comments. Line numbers described in this file correspond with those in file of "Revised manuscripts (marked-up copy)".In this revised version, we changed the description of compound name from ND-630 to GS-0976 because GS-0976 is more widely used than the previous name ND-630.Comment 1: First of all, the authors should validate their MC4R KO mice fed WD as a NASH model, because these mice were independently created in this study. Histological evaluation should be carefully performed using the NAFLD activity score. Did they histologically analyze the mice when ND-630 treatment started at 24-weeks of age?Response: We appreciate this useful comment. We performed histological evaluation for the NAFLD activity score using liver samples at 33-weeks of age. Unfortunately, pre-treated samples at 24-weeks of age were not been fixed for histological evaluation. Histological images and the NAFLD activity score were added in figure 7 and table 2. These results suggest that WD-fed MC4R KO mice show severe steatosis with weak inflammation in the liver at 33-weeks of age. On the other hand, ballooning degeneration was not clearly detected. It may be difficult to detect ballooning in the small animal NASH model, rather than in this model. It is reported that ballooning is difficult to distinguish from microvesicular steatosis in small animal NASH models, and correct evaluation is difficult (Hepatology. 2019; 69(5):2241-2257). Furthermore, hepatocyte ballooning was not detected in methionine and choline deficient diet-fed mice model which is often used as a mouseNASH model (Hepatology. 2019; 69(5): 2241-2257). We added these results of histological analysis in line 370 to line 380 in marked-up copy as follows.“NAFLD Activity ScoreHistological analysis demonstrated an increase of the hepatic steatosis and weak lobular inflammation in vehicle-treated MC4R KO mice fed with WD after 9-week treatment compared with lean control mice (Fig 7, Table 2). On the other hand, ballooning degeneration was not clearly observed in vehicle-treated MC4R KO mice, suggesting that WD-fed MC4R KO mice showed severe steatosis with weak inflammation in the liver. Treatment with GS-0976 at 4 and 16 mg/kg/day lowered the steatosis score dose-dependently but did not show clear effect on inflammation score compared with vehicle treatment. As a result, GS-0976 lowered NAFLD activity score dose-dependently compared with vehicle treatment, reflecting the reduction of the steatosis score by GS-0976.”Comment 2: The effect of ND-630 on hepatic inflammation should be examined in detail. Did the treatment affect the number of macrophages and expression of proinflammatory cytokines in the liver?Response: We conducted two additional experiments to investigate the effects of GS-0976 on hepatic inflammation in more detail according to reviewer’s valuable comment. Gene expression analysis of other inflammation-related markers in addition to F4/80 exhibited that gene expressions of monocyte chemoattractant protein 1 (MCP-1) and tumor necrosis factor α (TNFα), not but IL-6 were upregulated in WD-fed MC4R KO mice compared with control mice and these upregulations were inhibited by GS-0976 as shown in supplemental figure 1. However, histological analysis revealed that the level of inflammatory cell infiltration in GS-0976-treated MC4R KO mice did not change in vehicle-treated MC4R KO mice shown in figure 7 and table 2. This is thought to be because inflammation is not strongly induced in this model rather than the lack of efficacy of GS-0976. Lobular inflammation in the NAS activity score was low (1.0 ± 0.0) in vehicle treated MC4R KO mice. Probably, in this model which were fed with WD for 33 weeks, the increase in mRNA expression of cytokines does not reach the level that causes infiltration of inflammatory cells. Continued long-term high-fat diet loading causes inflammatory cell infiltration and GS-0976 may have an inhibitory effect on the increase in inflammation.We added these contents about inflammation and mechanism of anti-fibrotic effects to lines 556 to line 576 in marked-up copy.“In our model, fibrosis is thought to be indirectly induced through the accumulation of increased fat in the liver. Saturated free fatty acids such as palmitate and stearate, final products of DNL, and their metabolites contribute to lipotoxicity, hepatocyte injury and lipoapoptosis, leading to fibrosis [40]. Oxidative stress is an important factor for inducing fibrosis in NASH. In hepatocytes, oxidative stress is induced by hepatic microsomal lipid peroxidation due to excessive fatty acid delivery and electron leakage from the mitochondrial electron transport system [41, 42]. Inhibition of excess lipogenesis by GS-0976 may contribute to reduction of oxidative stress, resulting in the prevention of fibrosis. Evaluation of oxidative stress in MC4R KO mice treated with GS-0976 is an area of future research. Inflammation is another factor promoting fibrosis in NASH. Gene expressions of F4/80, monocyte chemoattractant protein 1 (MCP-1) and tumor necrosis factor α (TNFα), not but IL-6 were upregulated in WD-fed MC4R KO mice compared with control mice and upregulations of MCP-1 and TNF α mRNA were inhibited by GS-0976 (Fig 8, Supplemental figure 1). However, histological analysis revealed that the level of inflammatory cell infiltration in GS-0976-treated MC4R KO mice was not different from that in vehicle-treated MC4R KO mice (Table 2). This is probably because that the effect of GS-0976 could not be detected due to weak inflammation observed in the model rather than poor efficacy of GS-0976 against inflammation, because lobular inflammation score was low (1.0 ± 0.0) in vehicle-treated MC4R KO mice. The increase in mRNA expression of cytokines might not reach the level that causes infiltration of inflammatory cells.”Comment 3: It is also important to know the effect of ND-630 on the fibrogenic process. The data on Timp-1 (discussed in page 26) should be provided. Since ND-630 treatment markedly suppressed Col1a1 mRNA expression, without affecting mRNA expression of Col1a2 and Tgfb1, how do the authors discuss the underlying mechanisms?Response: We measured plasma TIMP-1 levels after 8-week treatment and added the result in figure 9D, and also added the follows in line 429 to line 435.“Fibrosis in the liver is accompanied by extracellular matrix remodeling, and TIMP-1, matrix metalloproteinases inhibitor, plays an important role. We measured plasma TIMP-1 concentrations after 8-weeks of treatment. Plasma TIMP-1 concentrations in WD-fed MC4R KO mice were 3.2 times higher compared with those of lean control mice (Fig 9D). Treatment with GS-0976 at 4 and 16 mg/kg/day significantly lowered plasma TIMP1 concentrations by 49 and 64% compared with vehicle treatment, respectively.”As pointed out by the reviewer, GS-0976 showed no effect on the mRNA expression of TGFβ1 which is one of the most important factors to stimulate type I collagen gene transcription. We added some sentences to make this reason clearer to understand. The followings show that original manuscript in line 473 to line 477--> revised manuscript (“clean copy”, not “marked-up copy”) in line 481 to line 485 as follows:“TGFβ precursor is activated through proteolytic cleavage of the latency-associated peptide region by serine proteases such as matrix metalloproteinases, plasminogen activators, and αvβ3 integrin cleavage [46].” --> “TGFβ is constitutively synthesized and secreted in a biologically latent form (latent TGFβ), and latent TGFβ is activated through proteolytic cleavage of latency-associated peptide region by serine proteases such as matrix metalloproteinases, plasminogen activators, and αvβ6 integrin cleavage [38, 39]. Therefore, GS-0976 does not affect TGFβ mRNA, but might affect the levels of active TGFβ.”GS-0976 significantly suppressed the hepatic mRNA levels of Col1a1 from low dose but significantly suppressed Col1a2 mRNA at only high dose. On the other hand, Sirius red-positive area in histological analysis and hepatic hydroxyproline content were significantly reduced by treatment with low dose of GS-0976. Type I procollagen is a heterotrimer formed from two pro-alpha1(I) chains produced by COL1A1 gene and one pro-alpha2(I) chain produced by the COL1A2 gene. Therefore, suppression of collagen content might be occurred only by suppression of COL1A1 gene expression.Comment 4: It is interesting that ND-630 treatment remarkably increased serum insulin concentrations, whereas it suppressed hepatic steatosis. Can the authors provide the plausible reason? Did the authors examine the effect of ND-630 on serum insulin concentrations in wild-type mice fed WD?Response: We are also interested why GS-0976 increased plasma insulin followed by the elevation of plasma glucose. We added following hypothesis about plausible mechanism of these phenomenon. The followings show that original manuscript in line 502 to line 507--> revised manuscript (“clean copy”, not “marked-up copy”) in line 541 to line 555 as follows:“Still, ND-630 did not increase plasma glucose, insulin levels or induce insulin resistance in NASHpatients, and did not increase plasma glucose levels in obeserats fed a high-sucrose diet [25, 42]. As the cause of the differences between these results is unknown, further investigation is needed to clarify the mechanisms of elevation of plasma TG, glucose and insulin levels by ND-630 in WD-fed MC4R KO mice.”-->“The exact mechanism is unclear, but an increase in gluconeogenesis may contribute to these phenomena. GS-0976 improve fatty liver but may increase acetyl-CoA content in the liver by inhibition of ACC1/2. In hepatocytes, it has been reported that gluconeogenesis from lactic acid is increased by acetate, which is a substrate for acetyl-CoA, therefore gluconeogenesis could be promoted by increasing acetyl-CoA [45, 46]. Furthermore, increased hepatic acetyl-CoA by GS-0976 may have promoted gluconeogenesis and caused increase in plasma glucose and compensatory plasma insulin. On the other hand, GS-0976 lowered plasma insulin concentrations and exhibited no effects on plasma glucose concentrations in rats with a high-fat diet-induced obesity [25]. Furthermore, GS-0976 did not increase plasma glucose, insulin levels or induce insulin resistance in NASHpatients [25, 36]. These differences may be due to the severity of insulin resistance. Further investigation is needed to clarify the mechanisms of elevation of plasma triglyceride, glucose and insulin levels by GS-0976 in WD-fed MC4R KO mice and further understanding will be elucidated as additional clinical trial results are disclosed”We do not have data about effects of GS-0976 on serum insulin concentrations in wild-type mice fed with WD. It was reported that GS-0976 induced lower plasma insulin and unchanged fasting plasma glucose in diet-induced obeserats which show more moderate peripheral insulin resistance compared to the MC4R KO mice fed with WD (Proc Natl Acad Sci U S A. 2016;113(13): E1796-805). Therefore, it is thought that GS-0976 may not induce elevation of serum insulin concentrations in wild-type mice fed with WD.Comment 5: Did ND-630 treatment influence on lipid accumulation and inflammation in other organs, such as adipose tissue and skeletal muscle?Response: We did not examine influence of GS-0976 on lipid accumulation and inflammation in other organs, such as adipose tissue and skeletal muscle. However, for the following reasons, GS-0976 probably has no direct effects on lipid accumulation and inflammation in adipose tissue and skeletal muscle. GS-0976 is taken by organic anion transporting polypeptides (OATPs) and preferentially partitioned into the liver (Hepatology. 2018;68, Suppl. 1734). On the other hand, OATPs are not abundantly expressed in the adipose tissue (Physiol Rev. 2015;95(1): 83-123). Furthermore, it is thought that GS-0976 at the doses selected in this study (2 and 8 mg/kg) do not affect in skeletal muscle because GS-0976 at 10 mg/kg selectively decreased malonyl-CoA content in the liver but not in skeletal muscle of normal mice as shown in figure 2. It was also reported that GS-0976accumulated 50 times in liver compared to skeletal muscle one hour after GS-0976 at 3 and 10 mg/kg were given in the rats fed with a high-fat diet (Proc Natl Acad Sci U S A. 2016;113(13): E1796-805).We modified the sentence to make it easier to understand. The followings show that original manuscript in line 423--> revised manuscript (“clean copy”, not “marked-up copy”) in line 518 to line 521 as follows, “ND-630 is a liver-specific inhibitor” -->GS-0976 is liver specific because it was designed to be a substrate of hepatic organic anion-transporting polypeptide, resulting in liver-directed biodistribution and ensuring inhibition of ACC in the liver [26].”Comment 6: It would be intriguing if quality of lipid was analyzed in the liver of ND-630-treated mice.Response: We appreciate the reviewer's comments. Although it is interesting for us to measure quality of lipid in the liver of GS-0976-treated mice, it is technically difficult for us at present. Another de novo lipogenesis-related enzyme, fatty acid elongase 6 (Elovl6) which is responsible for converting C16 saturated and monounsaturated fatty acids (FAs) into C18 species contributes to obesity-induced insulin resistance by modifying hepatic C16/C18-related FA composition (Nat Med. 2007;13(10):1193-202.). Therefore, there is a possibility that GS-0976 also changes the lipid composition. We consider that their measurement as a potential next step of our study and outside the scope of the current manuscript.We attached colored word file of "Response to reviewers". Because it is better to find modifications from original manuscript, I would appreciate if you see that file.Response to Reviewer #2 commentsReviewer #2 Comments for the AuthorIn this work, Matsumoto et al. report that treatment with two oral doses of the small molecule inhibitor of acetyl-CoA carboxylases 1 and 2 ND-613, given for 9 weeks, attenuates some biochemical and histological markers of liver damage in Western diet-fed melanocortin 4 receptor-deficient mice, a postulated model for NAFLD. They employed C57BL/6J mice fed chow as controls for their experiments. Based on previous findings in Zucker diabeticrats treated with the same inhibitor, in which it was observed that the blockade of ACC1/2 decreased hepatic steatosis and a number or markers of hepatic inflammation and fibrosis, Matsumoto et al. hypothesize that similar effects of ACC1/2 inhibition would be observed in a mouseNAFLD model. Although the present manuscript offers evidence, albeit limited, that add to the postulate that ACC1/2 play a role in improving the biochemical and biological phenotype of NAFLD, this work raises the following critical issues:Authors’ responseWe appreciate your time and effort in reviewing this manuscript and for very useful suggestions that improved the quality of our manuscript. We have responded to your comments point by point as follows. Line numbers described in this file correspond with those in file of " Revised manuscripts (marked-up copy)".In this revised version, we changed the description of compound name from ND-630 to GS-0976 because GS-0976 is more widely used than the previous name ND-630.Comment 1: A major problem of the present work is the lack of appropriate control groups for the dietary and drug treatments in addition to the lean mice fed chow. There is no control for the mice subjected to the Western diet, and also a proper control group of wild type mice treated with the ACC1/2 inhibitor. Without data from those two additional groups the reported observations could be attributed to differences in diets, or off-target and toxic effects of the ACC 1/2 inhibitor.Response: We appreciate your valuable comments. The present study demonstrated ACC1/2 inhibitor reduced steatosis and fibrosis in WD-fed MC4R KO mice. But as you pointed out, there are no groups with WD and drug treatments in normal mice. With regard to effect of diet, it was reported that Sirius Red-positive area of C57BL/6J mice fed with WD for 24 weeks were only 0.42% (Am J Pathol. 2008;173(4):993-1001), suggesting that WD alone does not cause fibrosis and loading WD in MC4R KO mice is important for the fibrosis observed in this study. Therefore, in order to reduce animal numbers a normal mouse fed with WD group in the study to evaluate the anti-fibrotic effect of GS-0976 was not included. Regarding the toxic effects of GS-0976, it had no effect on food intake and plasma liver enzymes, a liver injury marker, it was rather reduced them compared to vehicle treatment in our study using WD-fed MC4R KO mice. These results are supported by two toxicity studies using rat (Proc Natl Acad Sci U S A. 2016;113(13):E1796-805). Single oral dosing of GS-0976 at 100, 300, or 1,000 mg/kg showed no statistically significant influences on body weight, and showed no adverse effects on hematology, coagulation, or clinical chemistry parameters. Repeat oral dosing of GS-0976 at 60 mg/kg/day for 28 days showed no clinical signs and no changes in body weight, food consumption, hematology, coagulation, or clinical chemistry parameters. More importantly, adverse effects related to GS-0976 were not observed in clinical studies (Gastroenterology. 2018;155(5):1463-1473, Clin Gastroenterol Hepatol. 2018;16(12): 1983-1991). These insights suggest that efficacy of GS-0976 in our study is not depend on toxic effects.Comment 2: Although there is no optimal experimental model for NAFLD, the authors don’t explain the rationale for employing the melanocortin 4 receptor-deficient mice as a more suitable model than the more commonly used diet-based or chemical NAFLD models. Alterations in the mechanisms of appetite and control of food intake promoted by a dysfunctional melanocortin 4 receptor pathway could be potentially responsible for some of the hormonal and metabolic changes described in this work.Response: We appreciate and agree with your valuable comments. We added the following sentence about superiority of MC4R KO mice fed with WD compared to other models such as diet-based or chemical NAFLD models in line 624 to line 648.“In contrast to WD-fed MC4R KO mice, diet-induced and chemically induced models using normal mice do not fully reflect humanNASH pathology. Even though a high fat-diet supplemented with fructose or sucrose elicit obesity, insulin resistance, steatosis and steatohepatitis, fibrosis was not observed or mild in nature [50]. Combining WD with MC4R KO mice, which induces substantial obesity and insulin resistance compared to the high fat diet-fed normal mice, is considered to be an attractive NASH model with significant fibrosis. Nutrient-deficient diets which are low or devoid of methionine and/or choline are applied to induce severe liver fibrosis. Chemically induced liver damage models are also used for studying mechanisms of hepatic fibrosis progression. However, both nutrient-deficient models and chemically induced models do not fully reflect humanNASH pathology, because these models show weight loss [40, 51]. From these reasons, WD-fed MC4R KO mice could be a better pre-clinical model to study the pharmacology of potential NASH therapies compared to nutrient- and chemical-induced models.”Comment 3: Treatment with ND-613 causes a severe hyperinsulinemia in melanocortin 4 receptor-deficient, a relevant finding that was not properly discussed in the manuscript. Also important, the lack of dose-dependent response to the ACC inhibitor in some determinations (liver weight, hepatic triglyceride, hydroxyproline content, etc.) was not addressed in the discussion.Response: We added following hypothesis about plausible mechanism of these phenomenon. The followings show that original manuscript in line 502 to line 507--> revised manuscript (“clean copy”, not “marked-up copy”) in line 541 to line 555 as follows: Furthermore, in addition to adding Table 2, the format of Table 1 is aligned with Table 2.“Still, ND-630 did not increase plasma glucose, insulin levels or induce insulin resistance in NASHpatients, and did not increase plasma glucose levels in obeserats fed a high-sucrose diet [25, 42]. As the cause of the differences between these results is unknown, further investigation is needed to clarify the mechanisms of elevation of plasma TG, glucose and insulin levels by ND-630 in WD-fed MC4R KO mice.” -->“The exact mechanism is unclear, but an increase in gluconeogenesis may contribute to these phenomena. GS-0976 improve fatty liver but may increase acetyl-CoA content in the liver by inhibition of ACC1/2. In hepatocytes, it has been reported that gluconeogenesis from lactic acid is increased by acetate, which is a substrate for acetyl-CoA, therefore gluconeogenesis could be promoted by increasing acetyl-CoA [45, 46]. Furthermore, increased hepatic acetyl-CoA by GS-0976 may have promoted gluconeogenesis and caused increase in plasma glucose and compensatory plasma insulin. On the other hand, GS-0976 lowered plasma insulin concentrations and exhibited no effects on plasma glucose concentrations in rats with a high-fat diet-induced obesity [25]. Furthermore, GS-0976 did not increase plasma glucose, insulin levels or induce insulin resistance in NASHpatients [25, 36]. These differences may be due to the severity of insulin resistance. Further investigation is needed to clarify the mechanisms of elevation of plasma triglyceride, glucose and insulin levels by GS-0976 in WD-fed MC4R KO mice and further understanding will be elucidated as additional clinical trial results are disclosed”We added following explanation about lack of dose-dependent response to GS-0976 in line 548 to line 555.”In our study, there were the lack of dose-dependent response to GS-0976 in Sirius-red positive area and small differences between two doses in some parameters, although we determined doses of GS-0976 based on the influence on PD marker in single dosing study (Fig 2). GS-0976 also showed a dose-dependent inhibitory effect on PD markers in the repeated study (Fig 10). This might be because the histological evaluation was performed in one section. Furthermore, it was also possible that low dose was enough to show efficacy on steatosis and fibrosis in this model.”Submitted filename: Response to reviewers.docxClick here for additional data file.10 Jan 2020Acetyl-CoA carboxylase 1 and 2 inhibition ameliorates steatosis and hepatic fibrosis in a MC4R knockout murine model of nonalcoholic steatohepatitisPONE-D-19-19866R1Dear Dr. Matsumoto,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Nobuyuki Takahashi, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments:I read your revised manuscript, because only one of the reviewers who reviewed your previous manuscript evaluated the revised manuscript. As a result, I have decided your revised manuscript is acceptable,Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No17 Jan 2020PONE-D-19-19866R1Acetyl-CoA carboxylase 1 and 2 inhibition ameliorates steatosis and hepatic fibrosis in a MC4R knockout murine model of nonalcoholic steatohepatitisDear Dr. Matsumoto:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Nobuyuki TakahashiAcademic EditorPLOS ONE