Xianrong Xie1,2,3, Zixu Zhang1,2,3,4, Zhe Zhao1,2,3,4, Yongyao Xie1,2,3,4, Heying Li1,2,3, Xingliang Ma1,2,3, Yao-Guang Liu1,2,3, Letian Chen1,2,3,4. 1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangzhou, China. 2. Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, China. 3. College of Life Sciences, South China Agricultural University, Guangzhou, China. 4. Key Laboratory of Plant Functional Genomics and Biotechnology of Guangdong Provincial Higher Education Institutions, South China Agricultural University, Guangzhou, China.
Abstract
Timely degradation of anther tapetal cells is a prerequisite for normal pollen development in flowering plants. Although several genes involved in tapetum development have been identified, the molecular basis of tapetum degeneration regulation remains poorly understood. In this study, we identified and characterized the nucleus-encoded, conserved mitochondrial aldehyde dehydrogenase OsALDH2b as a key regulator of tapetum degeneration in rice (Oryza sativa). OsALDH2b was highly expressed in anthers from meiosis to the early microspore stage. Mutation of OsALDH2b resulted in excess malonaldehyde accumulation and earlier programmed cell death in the tapetum, leading to premature tapetum degeneration and abnormal microspore development. These results demonstrate that OsALDH2b negatively regulates tapetal programmed cell death and is required for male reproductive development, providing insights into the regulation of tapetum development in plants.
Timely degradation of anther tapetal cells is a prerequisite for normal pollen development in flowering plants. Although several genes involved in tapetum development have been identified, the molecular basis of tapetum degeneration regulation remains poorly understood. In this study, we identified and characterized the nucleus-encoded, conserved mitochondrial aldehyde dehydrogenase OsALDH2b as a key regulator of tapetum degeneration in rice (Oryza sativa). OsALDH2b was highly expressed in anthers from meiosis to the early microspore stage. Mutation of OsALDH2b resulted in excess malonaldehyde accumulation and earlier programmed cell death in the tapetum, leading to premature tapetum degeneration and abnormal microspore development. These results demonstrate that OsALDH2b negatively regulates tapetal programmed cell death and is required for male reproductive development, providing insights into the regulation of tapetum development in plants.
Pollen development is essential to plant reproduction. In rice (Oryza sativa L.), which is a staple for over half the global population, abnormal anther development significantly influences rice production (Chen and Liu, 2014). Previous studies have revealed that various regulators such as transcription factors, receptor-like kinases, ATP binding cassette G (ABCG) transporters, glycoproteins, redox homoeostasis-related factors, hormones, and enzymes are involved in anther development and pollen formation in Arabidopsis and rice (Wilson and Zhang, 2009; Zhang and Yang, 2014; Zhao ; Cai and Zhang, 2018; Yu and Zhang, 2019). The tapetum, the innermost layer in anthers, directly contacts male gametophytes and plays a vital role in microspore development. Tapetum degeneration via programmed cell death (PCD) provides enzymes, sporopollenin precursors, and nutrients for pollen maturation and wall synthesis. Premature or delayed tapetal degradation causes defective pollen development (Ma, 2005). Timely tapetal degradation is strictly controlled by a set of genes including OsCP1, TDR, PTC1, MTR1, EAT1/DTD, TIP2, OsTDF1, OsTGA10, Cox11, and EDT1 (Li ; Guo and Liu, 2012; Tan ; Ji ; Luo ; Ko ; Zhang and Yang, 2014; Cai ; Chen ; Bai ). Tapetum Degeneration Retardation (TDR), a homolog of Aborted Microspores (AMS) of Arabidopsis (Sorensen ), interacts with TDR Interacting Protein2 (TIP2) and Eternal Tapetum1 (EAT1) to positively regulate tapetal PCD via two aspartic proteases (AP37 and AP25) and is required for induction of OsC1 (Li ; Niu ; Fu ). The tdr mutant exhibits delayed tapetal PCD and degeneration. However, negative regulators of tapetum degeneration are seldom reported. In addition, recent studies have established that cellular redox status and dynamic reactive oxygen species (ROS) change are essential for tapetal cell specification and punctual initiation of tapetal PCD (Yu and Zhang, 2019; Bai ), while glutaredoxin and rice Tapetum Determinant1-Like1A (OsTDL1A)–Multiple Sporocytes1 (MSP1) pathways have a conserved role in determining anther cell fate (Zhang and Yang, 2014; Yu and Zhang, 2019). Rice MADS-box transcription factor3 (OsMADS3) is a key transcriptional regulator acting with the promoter of OsMT-I-4b to scavenge ROS during late anther development (Hu ). Another ROS-scavenging protein, rice Metallothionein Type 2b (OsMT2b), interacts with Defective Tapetum Cell Death 1 (DTC1) to maintain the normal level of ROS in tapetal cells (Yi ).Reactive metabolites such as ROS and malonaldehyde (MDA) can induce DNA damage (Hu ; Zhang and Yang, 2014). Oxidative stress and cellular processes (e.g. lipid peroxidation) produce aldehydes that bear reactive carbonyl groups, which can directly interact with DNA to cause lesions resulting in PCD (Voulgaridou ; Biswas and Mano, 2015). Aldehyde dehydrogenases (ALDHs) are a group of NAD(P)+-dependent enzymes that catalyse conversion of aldehydes to the corresponding acids. In mammals, ALDHs are commonly detoxifying enzymes that eliminate toxic biogenic and xenobiotic aldehydes (Yoshida ; Vasiliou ). In plants, most identified ALDHs confer tolerance to abiotic stresses, such as heat, salinity, ultraviolet radiation, and anaerobic conditions (Nakazono ; Sunkar ; Kotchoni ; Rodrigues ). Notably, rice OsALDH7 detoxifies aldehydes like MDA and thereby maintains seed viability (Shen ; Shin et al., 2009), while OsALDH2a potentially functions in submergence tolerance (Nakazono ). A maize (Zea mays) gene, Rf2a, for restoration of Texas-type cytoplasmic male sterility (CMS-T) encodes a mitochondria-localized aldehyde dehydrogenase (Cui ) and also is required for anther development (Liu ). However, the details of mitochondrial aldehyde dehydrogenase function in anther development are unclear.Rice has 22 aldehyde dehydrogenase members grouped into 11 families, including OsALDH7, OsALDH2a, and OsALDH2b (Gao and Han, 2009). In this study, we identified a rice male-sterility mutation caused by a 7-bp deletion in OsALDH2b. Furthermore, we revealed that OsALDH2b encodes a mitochondrion-targeted aldehyde dehydrogenase enzyme and is highly expressed in anthers during microsporogenesis. Our results demonstrate that OsALDH2b removes excess aldehydes generated during anther development to negatively regulate tapetum degeneration.
Materials and methods
Plant materials
All rice plants were grown under natural conditions in South China Agricultural University at Guangzhou’s paddy field. The male-sterile mutant (later named osaldh2b) was obtained from a 60Co-γ-ray-treated rice Nipponbare (O. sativa, ssp. japonica) mutant library. The F2 mapping population was generated from a cross between the mutant and an indica variety, Huanghuazhan (HHZ, O. sativa, ssp, indica). In the F2 population, male-sterile plants were selected primarily for genetic mapping. For screening recombinant individuals, F2 and F3 segregants were planted in 96-well plates and used for high-throughput DNA preparation as described previously (Wang ).
Mutant phenotype characterization
Plants were photographed with a Nikon digital camera. Flowers were photographed with a stereomicroscope (SZx10/DP72, Olympus, Japan). Pollen grains were stained with 1% I2–KI solution and photographed with a fluorescence microscope (Axio Observer Z1, Zeiss, Germany). Preparation of rice anther sections for light microscopy and electron microscopy was performed as previously described (Li ).
Map-based cloning of OsALDH2b
A set of 145 male-sterile plants segregated from 652 F2 individuals was used for primary mapping. Recombinants were then screened from F2 and F3 families for fine mapping with newly developed insertion/deletion (InDel) molecular markers (see Supplementary Table S1 at JXB online). Rice genomic DNA samples were prepared from fresh leaf tissues using 1% sodium dodecyl sulfate.
Vector construction for transgenic plants
For the functional complementation test, a 12.2 kb wild-type genomic fragment of OsALDH2b was amplified by three steps. The first fragment was amplified using OsALDH2b-F1 and OsALDH2b-R1 primers (Supplementary Table S2) and cloned into the MluI and SalI sites of the binary vector pCAMBIA1300.2. The second fragment was amplified with OsALDH2b-T5F2 and OsALDH2b-T5R2 primers and cloned, into the positive clones produced in the first step, at the SalI site using an isothermal in vitro recombination (IR) system (Jiang ). The third fragment, containing the 5′-upstream region, was amplified with pALDH2b-T5F and pALDH2b-T5R primers, and inserted into the vector constructed in step 2 at the BamHI site by the IR method. The CRISPR/Cas9 genome-targeting construct for OsALDH2b (target site: TGGGACACAAGGATTGTTGCCGG; protospacer adjacent motif italicized) was designed with the web-based CRISPR-GE toolkit (http://skl.scau.edu.cn/) (Xie ) and prepared using the CRISPR/Cas9 vector system (Ma ). All constructs were introduced into rice with Agrobacterium-mediated transformation. Positive transformants were screened with HPT primers by PCR. The target site sequences of gene knockout mutants were sequenced and decoded with CRISPR-GE/DSDecodeM (Liu ; Xie ).
RNA extraction and qRT-PCR
Total RNA was extracted from rice tissues using TRIZOL reagent (Thermo Fisher Scientific, USA), and isolated RNA was treated with DNase I. The treated RNA was then used for first-strand cDNA synthesis with oligo (dT) using the first-strand cDNA synthesis kit (Promega, USA). Two microliters of the reverse transcription product was used as the template for PCR reactions. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) of OsALDH2b and other genes related to anther development used the primers listed in Supplementary Table S2.
Subcellular localization
The coding region of OsALDH2b was amplified from wild-type cDNA with the primers OsALDH2b-cF and OsALDH2b-cR (Supplementary Table S2). After digestion with HindIII and BamHI, the fragments were fused in-frame with the enhanced green fluorescent protein (eGFP) coding sequence (Heim ; Cormack ), subcloned into a pUC-18-based vector and driven by the CaMV35S promoter to produce the transient expression vector ALDH–eGFP. A mutant orange fluorescent protein (mOrange) fused with a mitochondrial transit signal peptide derived from RF1b (Wang ) was prepared as a positive control (RF1b–mOrange). These constructs were bombarded into onion epidermal cells by a helium-driven accelerator (PDS/1000; Bio-Rad, USA). Cells that exhibited eGFP and mOrange fluorescence were imaged with a laser scanning confocal microscope (LSM7 DUO, Zeiss, Germany).
Aldehyde dehydrogenase enzymatic assays
Full-length OsALDH2b cDNA (excluding the mitochondria-targeted sequence) was isolated with the primers OsALDH2b-cFD and OsALDH2b-cR (Supplementary Table S2) and cloned into the pET32a(+) vector fused with a His-tag. The resultant plasmid was transformed into E. coli strain BL21 (DE3). Once the OD600 reached approximately 0.6, transformed cells were incubated at 18 °C for 16 h with 1 mM isopropylthio-β-galactoside. The supernatant containing extracted proteins was purified with a Ni–nitrilotriacetic acid spin column. For the enzymatic assay, aldehyde was the substrate. ALDH enzymatic activity for reduction of NAD+ to NADH was evaluated by the increase of absorbance at 340 nm (Shin ).
Measurement of malonaldehyde content in the anthers
Determination of MDA levels was by the thiobarbituric acid (TBA) method (Loreto and Velikova, 2001). Anther samples at different developmental stages (each 100 mg) were homogenized in 2 ml of 0.1% trichloroacetic acid solution, and the extract was centrifuged at 12 000 g for 15 min; 0.5 ml of the supernatant was diluted to 1 ml with 0.5% TBA in 20% trichloroacetic acid. The mixture was heated at 95℃ for 30 min and then cooled on ice. Supernatant absorbance was measured at 530 nm with a Synergy Mx Multi-Mode Reader (BioTek, USA), subtracting non-specific absorbance at 600 nm.
TUNEL assay
Anther developmental stages were confirmed by observing anther cross-sections with light microscopy. Preparation of anther sections and a terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay used a Dead End Fluorometric TUNEL Kit (Promega, USA); these were performed as previously described (Li ; Luo ). Fluorescein’s green fluorescence (TUNEL signal) and propidium iodide’s red fluorescence were imaged with 488 nm (excitation) and 520 nm (detection), and 488 nm (excitation) and 610 nm (detection), respectively, under a LSM 7 DUO laser scanning confocal microscope (Zeiss, Germany).
Results
Identification and phenotype of the osaldh2b mutant
We obtained a male-sterile mutant by screening a rice mutant library (japonica cultivar Nipponbare) created with 60Co-γ-ray radiation. The mutant exhibited normal vegetative and panicle development, but failed to generate viable pollen, and never set seed (Fig. 1A–D). Analysis revealed that the sterility was caused by a loss-of-function mutation located in the OsALDH2b gene (see below); we therefore named this mutant osaldh2b. We crossed mutant plants with pollen grains from the indica variety (HHZ) to generate F1 hybrids. We examined 652 F2 individual plants that resulted from the cross, and observed that 507 plants were male fertile and 145 male sterile (χ 2=2.65 for 3:1, P>0.05) (Supplementary Table S3), indicating that the male-sterility phenotype was controlled by a recessive locus.
Fig. 1.
Phenotypic comparison between wild-type (WT) and osaldh2b. (A) WT plants (left) and osaldh2b (right) at the heading stage. Scale bar: 10 cm. (B) Comparison of seed setting between WT (left) and osaldh2b (right). Scale bar: 2 cm. (C) Spikelet (top) and pollen grains (bottom) of WT. (D) Spikelet (top) and pollen grains (bottom) of osaldh2b. Pollen grains were stained with I2–KI. Scale bar: 1 mm for spikelet and 50 μm for pollen grains.
Phenotypic comparison between wild-type (WT) and osaldh2b. (A) WT plants (left) and osaldh2b (right) at the heading stage. Scale bar: 10 cm. (B) Comparison of seed setting between WT (left) and osaldh2b (right). Scale bar: 2 cm. (C) Spikelet (top) and pollen grains (bottom) of WT. (D) Spikelet (top) and pollen grains (bottom) of osaldh2b. Pollen grains were stained with I2–KI. Scale bar: 1 mm for spikelet and 50 μm for pollen grains.
Map-based cloning and functional validation of OsALDH2b
To isolate the mutated gene conferring male sterility, we used 6652 segregants from the F2 and F3 families and a set of polymorphic markers covering the entire genome, and mapped the mutant locus to a 114-kb region on chromosome 6 (Fig. 2A). DNA sequencing analysis in this region of the mutant revealed a 7-bp deletion in the third exon of OsALDH2b (LOC_Os06g15990, annotated by RGAP7; or Os06g0270900, annotated by RAP-DB), causing a frame shift to introduce a premature stop codon at the 125th amino acid (Fig. 2B).
Fig. 2.
Molecular identification and functional validation of OsALDH2b. (A) The mutant gene was mapped within a 114-kb region on chromosome 6, using 6652 total segregants from the F2 and F3 families. The molecular markers (M1–M9) and physical positions on the chromosome are indicated. (B) Diagram showing OsALDH2b’s genomic structure within the mapped region. A 7-bp deletion (boxed) occurred in the third exon of osaldh2b. The start codon (ATG) and the stop codon (TAA) are indicated. Red arrow indicates the editing site targeted with CRISPR/Cas9. (C) Pollen phenotypes of wild-type (WT, fertile; top left), the mutant (osaldh2b, sterile; top right), the functionally complemented mutant plant with transgenic OsALDH2b (OsALDH2b-C, fertile; bottom left), and the OsALDH2b-knockout plant (OsALDH2b-KO, sterile; bottom right). Scale bars: 50 μm.
Molecular identification and functional validation of OsALDH2b. (A) The mutant gene was mapped within a 114-kb region on chromosome 6, using 6652 total segregants from the F2 and F3 families. The molecular markers (M1–M9) and physical positions on the chromosome are indicated. (B) Diagram showing OsALDH2b’s genomic structure within the mapped region. A 7-bp deletion (boxed) occurred in the third exon of osaldh2b. The start codon (ATG) and the stop codon (TAA) are indicated. Red arrow indicates the editing site targeted with CRISPR/Cas9. (C) Pollen phenotypes of wild-type (WT, fertile; top left), the mutant (osaldh2b, sterile; top right), the functionally complemented mutant plant with transgenic OsALDH2b (OsALDH2b-C, fertile; bottom left), and the OsALDH2b-knockout plant (OsALDH2b-KO, sterile; bottom right). Scale bars: 50 μm.To confirm that the male-sterile phenotype resulted from the mutation in OsALDH2b, we prepared a binary construct (OsALDH2b-C) that carried a 12.2-kb genomic DNA fragment of wild-type OsALDH2b to thoroughly test functional complementation of this fragment comprising OsALDH2b’s 4.2-kb upstream 5′-UTR/promoter sequence, the entire 5.4-kb coding region (including introns), and a 2.6-kb downstream region. We transformed this construct into calli induced from heterozygous OsALDH2b/osaldh2b plants. Of 26 OsALDH2b-C transgenic plants (T0), six plants were homozygous for the osaldh2b allele, and these exhibited normal male fertility (Fig. 2C). Next, we used CRISPR/Cas9-based genome editing to knock out OsALDH2b in wild-type plants. As expected, the OsALDH2b-knockout plants (OsALDH2b-KO) exhibited a male-sterile phenotype, similar to the osaldh2b mutant (Fig. 2C; Supplementary Fig. S1). Therefore, we concluded that OsALDH2b is required for male development in rice.
OsALDH2b and its orthologs are highly conserved in monocot and eudicot species
To gain insight into OsALDH2b’s evolutionary history, we used BLASTP with OsALDH2b’s full-length amino acid sequence to find orthologs and create a phylogenetic tree. We retrieved 13 orthologous sequences from seven monocot species and six eudicot species from the database. Comparing these proteins showed that OsALDH2b had the highest similarity to orthologs from monocot plants (Sorghum bicolor, 91%; Zea mays, 92%; Setaria italic, 91%; Brachypodium distachyon, 90%; Hordeum vulgare, 88%; Secale cereal, 88%; and Aegilops tauschii, 88%). Similarity to eudicot orthologs was lower (Arabidopsis, 81%; Solanum lycopersicum, 79%; Hevea brasiliensis, 79%; Glycine max, 78%; Populus trichocarpa, 77%; and Brassica napus, 76%) (Supplementary Fig. S2). A phylogenetic tree generated using MEGA7 (Kumar ) divided the proteins into two groups, monocots and eudicots (Fig. 3). Of the orthologs we identified, the maize protein (RF2A) is required for anther development and is a functionally characterized fertility restorer for CMS-Tmaize lines (Liu ; Cui ). These data suggest that the ALDH-like proteins are highly conserved among monocot and eudicot plants, and potentially share a conserved function in male reproductive development.
Fig. 3.
Phylogenetic analysis of ALDH orthologs in representative plants. A phylogenetic tree for ALDHs of eudicot and monocot plants was built with the neighbor-joining method (bootstrap test, 1000 replicates) with the full-length protein sequences.
Phylogenetic analysis of ALDH orthologs in representative plants. A phylogenetic tree for ALDHs of eudicot and monocot plants was built with the neighbor-joining method (bootstrap test, 1000 replicates) with the full-length protein sequences.
OsALDH2b encodes a mitochondrial aldehyde dehydrogenase and is highly expressed in anthers
Sequence analysis showed that OsALDH2b encodes a predicted 549 amino acid mitochondrial aldehyde dehydrogenase (Supplementary Fig. S3). To verify OsALDH2b’s subcellular localization, we co-transformed OsALDH2b–eGFP and an RF1b–mOrange control into onion epidermal cells. Images demonstrated that the OsALDH2b–eGFP signal co-localized with RF1b–mOrange in mitochondria, indicating that OsALDH2b is a mitochondrion-localized protein (Fig. 4A).
Fig. 4.
Characterization of OsALDH2b. (A) Subcellular localization of OsALDH2b. p35S::OsALDH2b-eGFP and p35S::RF1b-mOrange vectors were co-bombarded into onion epidermal cells. Scale bars: 50 μm. (B) In vitro OsALDH2b enzymatic assay. (C) OsALDH2b expression pattern. The OsActin1 gene was used for normalization. Data are shown as means ± SD (n=3).
Characterization of OsALDH2b. (A) Subcellular localization of OsALDH2b. p35S::OsALDH2b-eGFP and p35S::RF1b-mOrange vectors were co-bombarded into onion epidermal cells. Scale bars: 50 μm. (B) In vitro OsALDH2b enzymatic assay. (C) OsALDH2b expression pattern. The OsActin1 gene was used for normalization. Data are shown as means ± SD (n=3).To examine whether OsALDH2b has enzymatic activity for aldehydes, we purified recombinant OsALDH2b–His to use in enzyme activity assays. Here, reduction of NAD+ to NADH was measured as the increase in absorbance values at A340. When aldehyde was used as the substrate, recombinant OsALDH2b–His exhibited significant enzymatic activity (Fig. 4B), demonstrating that the protein has aldehyde dehydrogenase activity.To investigate OsALDH2b function, we analysed its expression pattern during rice development with qRT-PCR. OsALDH2b was expressed in both vegetative and reproductive organs. During anther development, OsALDH2b was highly expressed from the meiosis I stage (S7) until the middle microspore stage (S9b), and peaked at the meiosis II/tetrad (S8) and early microspore (S9a) stages (Fig. 4C); rice anther stages (S1–S12) were assigned as previously described (Zhang ). OsALDH2b’s expression profile was consistent with transcriptome data (RiceXPro, http://ricexpro.dna.affrc.go.jp/) (Supplementary Fig. S4). These data suggest that OsALDH2b may function in anther and pollen development from meiosis to the microspore stages.
The osaldh2b mutant anthers accumulate excess malonaldehyde
Cellular redox state is a key factor for male gametogenesis (Zhang and Yang, 2014). MDA is the predominant product of oxidative stress and one of the most highly reactive of the endogenous aldehydes, which are triggered by hypoxic status during early anther development and potentially produce toxic byproducts (Voulgaridou ). To determine whether OsALDH2b acts in anther development by reducing the aldehyde accumulation, we used a TBA assay to measure MDA content in anthers of both wild-type and osaldh2b plants.In wild-type anthers, MDA content gradually increased from the microspore mother cell stage (S6) to meiosis/tetrad stages (S7/S8), and then decreased until the late microspore stage (S10) (Fig. 5). In osaldh2b anthers, however, the MDA level was much higher from the S8 to S10 stages. This result indicated that OsALDH2b acts as a detoxifying enzyme that eliminates aldehydes generated during anther and microspore development.
Fig. 5.
MDA content dynamics during anther development. MDA content of osaldh2b anthers was significantly higher than that in WT anthers at microspore stages (S9 and S10). These data are derived from three replicates; **P<0.01 by t-test.
MDA content dynamics during anther development. MDA content of osaldh2b anthers was significantly higher than that in WT anthers at microspore stages (S9 and S10). These data are derived from three replicates; **P<0.01 by t-test.
The osaldh2b mutant exhibits premature tapetal programmed cell death
MDA is a highly reactive aldehyde that reacts strongly with DNA and proteins (Voulgaridou ). To examine whether MDA accumulation affects DNA fragmentation in osaldh2b anthers, we performed a TUNEL assay on anthers across developmental stages. Wild-type anthers showed strong TUNEL-positive signals in tapetal cells at the tetrad stage (S8b) (Fig. 6A–E, top). However, in osaldh2b tapetal cells, we detected TUNEL-positive signals in earlier stages, particularly in the metaphase I stage (S8a) (Fig. 6A–E, bottom). These results demonstrate that PCD-induced tapetal DNA fragmentation occurred at an earlier time point in the osaldh2b mutant, suggesting that excess MDA accumulation in the mutant’s developing anthers may accelerate PCD in tapetum cells.
Fig. 6.
Tapetal nuclear DNA fragmentation in WT and osaldh2b anthers. The anthers in WT (top) and osaldh2b (bottom) from the microspore mother cell stage through the middle microspore stage were compared for nuclear DNA fragmentation (indicating PCD) using the TUNEL assay (A–E). Nuclei were stained with propidium iodide (red fluorescence); yellow signals indicate TUNEL-positive nucleus staining. MMC, microspore mother cell; T, tapetum; Msp, microspore. Scale bars: 50 µm.
Tapetal nuclear DNA fragmentation in WT and osaldh2b anthers. The anthers in WT (top) and osaldh2b (bottom) from the microspore mother cell stage through the middle microspore stage were compared for nuclear DNA fragmentation (indicating PCD) using the TUNEL assay (A–E). Nuclei were stained with propidium iodide (red fluorescence); yellow signals indicate TUNEL-positive nucleus staining. MMC, microspore mother cell; T, tapetum; Msp, microspore. Scale bars: 50 µm.
The osaldh2b mutant exhibits abnormal tapetal degeneration and microspore development
To further investigate the role of OsALDH2b during male reproductive development, we analysed semi-thin sections of wild-type and mutant anthers. We observed no obvious differences between cells in wild-type and osaldh2b at early developmental stages (microspore mother cell stage to the early microspore stage) (Fig. 7A–D). In both wild-type and osaldh2b anthers, microsporocytes and somatic layers (including the epidermis, endothecium, middle layer, and tapetum) exhibited characteristic structures (Fig. 7A). Microsporocytes in both wild-type and osaldh2b had progressed through normal meiosis (S7), during which the tapetum had become vacuolated (Fig. 7B); subsequently, tetrads of haploid microspores had formed (S8) (Fig. 7C). At the early microspore stage (S9a) in both genotypes, free microspores had been released from tetrads, the middle layer appeared thin, and the tapetum looked condensed, less vacuolated, and deeply stained (Fig. 7D).
Fig. 7.
Transverse section analysis reveals anther development in WT and osaldh2b. (A–D) No obvious differences were observed between WT (top) and osaldh2b (bottom) anthers from S6 to S9a. (E) Compared with WT anthers, osaldh2b anthers displayed thinner tapetum and irregular microspores in the locule at S9b. (F) The osaldh2b tapetum was less condensed and weakly stained, and microspores were collapsed with uneven cytoplasm at S10. (G) The osaldh2b anther wall layers, including epidermis and endothecium, appeared disordered, enlarged, and broken, and exhibited severely abnormal microspores at S11. (H) The osaldh2b anthers at S12 exhibited collapsed pollen grains with no or less cellular content accumulation. E, epidermis; En, endothecium; ML, middle layer; Mp, mature pollen; Ms, microsporocyte; Msp, microspores; T, tapetum; Tds, tetrads. Scale bars: 20 μm.
Transverse section analysis reveals anther development in WT and osaldh2b. (A–D) No obvious differences were observed between WT (top) and osaldh2b (bottom) anthers from S6 to S9a. (E) Compared with WT anthers, osaldh2b anthers displayed thinner tapetum and irregular microspores in the locule at S9b. (F) The osaldh2b tapetum was less condensed and weakly stained, and microspores were collapsed with uneven cytoplasm at S10. (G) The osaldh2b anther wall layers, including epidermis and endothecium, appeared disordered, enlarged, and broken, and exhibited severely abnormal microspores at S11. (H) The osaldh2b anthers at S12 exhibited collapsed pollen grains with no or less cellular content accumulation. E, epidermis; En, endothecium; ML, middle layer; Mp, mature pollen; Ms, microsporocyte; Msp, microspores; T, tapetum; Tds, tetrads. Scale bars: 20 μm.We detected morphological differences between osaldh2b and wild-type anthers starting from the middle microspore stage (S9b): the wild-type tapetum was evident and microspores were round and vacuolated (Fig. 7E, top). The osaldh2b tapetum, however, appeared thinner, and microspores appeared irregularly shaped (Fig. 7E, bottom). At the late microspore stage (S10), wild-type tapetum had become hill-shaped, appeared highly condensed and deeply stained, and formed microspores containing a single, large central vacuole (Fig. 7F, top). By contrast, osaldh2b tapetum was less condensed and weakly stained; microspores appeared collapsed and exhibited uneven cytoplasm associated with abnormal vacuolization (Fig. 7F, bottom). At the bicellular pollen stage (S11), wild-type anthers exhibited typical falcate-shaped pollen grains and completely degenerated tapetal cells (Fig. 7G, top). At this stage, osaldh2b anther wall layers, including the epidermis and endothecium, appeared disordered, enlarged, and broken; mutant plants had produced severely aberrant microspores (Fig. 7G, bottom). At the mature pollen stage (S12), in contrast to wild-type, osaldh2b pollen grains were irregularly shaped and had accumulated no or less storage materials, and the anthers had shriveled (Fig. 7H).We used transmission electron microscopy to study the developmental abnormalities at the microspore stages in more detail. At the early microspore stage (S9a), wild-type tapetal cytoplasm was highly condensed, nuclei were intact, and cells exhibited a prominent nucleolus (Fig. 8A, top). Strikingly, we observed no nucleolus in osaldh2b tapetum nuclei at this stage (Fig. 8A, bottom). At the middle microspore stage (S9b), the wild-type tapetum had collapsed and nuclei were lobed. Enlarged U-shaped orbicules were evident on the inner tapetal surface. The exine in wild-type microspores was well established with distinct nexine, tectum, and bacula layers (Fig. 8B, top). By contrast, at this stage in osaldh2b tapetal cells, nuclei appeared completely degenerated, orbicules were smaller, and electron-dense sporopollenin reduced. Moreover, the exine of osaldh2b microspores was much thinner compared with those in WT. The osaldh2b microspores contained few organelles in cytoplasm observed in electron-transparent channels (Fig. 8B, bottom). At the late microspore stage (S10) in wild-type, we observed further degenerated tapetum and vacuolated microspores with abundant cytoplasm (Fig. 8C, top). At this stage, osaldh2b tapetum exhibited cavities, with low-electron-density orbicules on its surface, indicating that its tapetum had completely and prematurely degraded. In addition, microspore exine was much thinner (Fig. 8C, bottom). We further investigated the expression of eight genes related to male reproductive development. The qRT-PCR results (Supplementary Fig. S5) showed that the mutation of OsALDH2b disrupted the expression of genes involved in tapetum degeneration (TDR, UDT1, OsGAMYB, RTS) and pollen wall formation (WDA1, CYP704B2, CYP703A3, OsC6).
Fig. 8.
Transmission electron micrographs of WT and osaldh2b anthers. Tapetum and microspores in WT (top) and osaldh2b (bottom) anthers from S9a to S10 are shown. (A) In WT tapetum at S9a, nuclei appeared intact with a visible nucleolus (arrowed); the nucleolus had disappeared in the osaldh2b tapetum at this stage. (B) At S9b, nuclei in osaldh2b tapetal cells were completely degenerated, and mutant orbicules were smaller with reduced electron-dense sporopollenin, and the exine (including tectum, bacula, and nexine) of osaldh2b microspores was thinner than in WT. (C) At S10, the osaldh2b tapetum had become a cavity, with low-electron-density orbicules on its surface, indicating complete and premature tapetum degradation; the exine of osaldh2b microspores appeared thinner, with barren cytoplasm compared to WT. Ba, bacula; Ex, exine; Msp, microspores; Ne, nexine; Nu, nucleus; Or, orbicule; T, tapetum; Te, tectum. Scale bars: 1 µm.
Transmission electron micrographs of WT and osaldh2b anthers. Tapetum and microspores in WT (top) and osaldh2b (bottom) anthers from S9a to S10 are shown. (A) In WT tapetum at S9a, nuclei appeared intact with a visible nucleolus (arrowed); the nucleolus had disappeared in the osaldh2b tapetum at this stage. (B) At S9b, nuclei in osaldh2b tapetal cells were completely degenerated, and mutant orbicules were smaller with reduced electron-dense sporopollenin, and the exine (including tectum, bacula, and nexine) of osaldh2b microspores was thinner than in WT. (C) At S10, the osaldh2b tapetum had become a cavity, with low-electron-density orbicules on its surface, indicating complete and premature tapetum degradation; the exine of osaldh2b microspores appeared thinner, with barren cytoplasm compared to WT. Ba, bacula; Ex, exine; Msp, microspores; Ne, nexine; Nu, nucleus; Or, orbicule; T, tapetum; Te, tectum. Scale bars: 1 µm.Together, these results suggested that defective mutation in OsALDH2b leads to excessive aldehyde accumulation, which causes early tapetal PCD, premature cellular degeneration, and aborted microspore development, resulting in male sterility (Fig. 9).
Fig. 9.
Model of OsALDH2b’s role in pollen development. Tapetal cells undergo high hypoxic stress at early developmental stages, triggering accumulation of reactive aldehydes (MDA). In wild-type rice, OsALDH2b converts aldehydes into acetates, which are incorporated into the TCA cycle, resulting in MDA homeostasis. Defective OsALDH2b causes excess aldehyde accumulation, which leads to premature tapetal PCD and cellular degradation, and pollen abortion. ACS, acetyl coenzyme A synthetase. TCA, tricarboxylic acid.
Model of OsALDH2b’s role in pollen development. Tapetal cells undergo high hypoxic stress at early developmental stages, triggering accumulation of reactive aldehydes (MDA). In wild-type rice, OsALDH2b converts aldehydes into acetates, which are incorporated into the TCA cycle, resulting in MDA homeostasis. Defective OsALDH2b causes excess aldehyde accumulation, which leads to premature tapetal PCD and cellular degradation, and pollen abortion. ACS, acetyl coenzyme A synthetase. TCA, tricarboxylic acid.
Discussion
The tapetum is arguably the most important layer of anther tissue during male meiosis and microsporogenesis, providing enzymes, signals, and nutrients for pollen development via PCD-based cellular degeneration (Zhang ; Guo and Liu, 2012). Many components and factors participate in the process of tapetum development, such as transcription factors, receptor-like kinases, and transporters. The bHLH transcription factors TDR, EAT1/DTD, and TIP2 function as crucial positive regulators to promote tapetal PCD (Li ; Ji ; Niu ; Fu ). Mutation of their genes leads to vacuolated and prematurely degraded tapetum. In this study, we identified a rice male sterility mutant, osaldh2b; its wild-type gene encodes a conserved mitochondrial aldehyde dehydrogenase, OsALDH2b (Figs 1–4). Cytological analysis showed that osaldh2b exhibited more rapid, prominent degradation of tapetal cell nuclei and formation of abnormal tapetal secretory structures at microspore stages (Figs 7–8). Consistent with the nucleus degradation, tapetum DNA fragmentation (indicating PCD) occurred earlier in the osaldh2b mutant, at the prophase I stage (Fig. 6). Therefore we infer that OsALDH2b plays an important role in anther development and pollen formation by negatively regulating tapetal PCD. Additionally, expression analysis of some marker genes related to anther development indicates that the defective OsALDH2b caused disorder of the regulatory networks for anther development (Supplementary Fig. S5). The expression of TDR is increased from meiosis to microspore stages in osaldh2b. As the function of TDR is to promote the initiation of tapetal PCD (Li ), the up-regulated change of TDR expression is consistent with the earlier occurrence of tapetal PCD in osaldh2b anthers. Furthermore, the expression of GAMYB, which is involved in the down-regulation of TDR expression in anthers (Aya ; Liu ), is decreased in the mutant. According to the expression analysis, it seems that TDR may act downstream of OsALDH2b in regulating tapetal PCD, but this needs further investigation.Dynamic redox status is an emerging factor affecting tapetum specification and timing degradation. Two Cys-rich metallothioneins, OsMT2b and OsMT-I-4b, have been identified as ROS scavengers. DTC1 interacts with OsMT2b and inhibits the ROS scavenging activity of OsMT2b to ensure timely production of ROS for proper initiation of tapetal PCD during early stage anther development (Yi ). On the contrary, OsMADS3 promotes the expression of MT-I-4b to eliminate the excess ROS during later stage anther development (Hu ). Previous studies have indicated that lipid peroxidation increases upon hypoxia in plants (Blokhina and Fagerstedt, 2010; Gupta ), resulting in production of reactive aldehydes including MDA; these are highly reactive with cellular compounds and nucleic acids (Voulgaridou ; Heymann ). ALDHs are major enzymes for selective elimination of aldehydes in animals and plants. In plants, the ALDH family includes mitochondrial ALDH (mtALDH) and cytosolic ALDH (ctALDH) subgroups based on their cellular location (Kirch ; Gao and Han, 2009; Zhou ). The rice genome harbors two mtALDHs, OsALDH2a and OsALDH2b (Gao and Han, 2009). Here we report that OsALDH2b functions to regulate the proper levels of aldehydes during redox stress in the developing tapetum. When OsALDH2b is dysfunctional, excess aldehydes accumulate in the tapetal cells (Fig. 5). Although the significant change of MDA accumulation slightly lags behind the observed early occurrence of tapetal PCD signal in osaldh2b (Figs 5, 6), we propose that the MDA accumulation might serve as a signal to initiate the premature tapetal PCD in this mutant.Although OsALDH2b is constitutively expressed in vegetative organs, especially in leaf, the osaldh2b mutant does not show vegetative defects. We reason that there might be functional divergence of mtALDH orthologs as described in maize (Liu and Schnable, 2002). Two mtALDHs, RF2A and RF2B, have differential accumulation and distinct enzymatic activities with their substrates; RF2A, but not RF2B, accumulates to high levels in tapetal cells and is involved in male fertility (Cui ; Liu ). Based on previous phylogenetic analysis of plant ALDHs, OsALDH2b is more similar to maizeRF2A and OsALDH2a is more similar to RF2B (Tsuji ). A possible role of OsALDH2a may be to eliminate acetaldehyde in vegetative tissues, so as to increase submergence tolerance (Nakazono ). Altogether, we conclude that mtALDHs have undergone functional specialization during evolution to accommodate endogenous or exogenous stresses in different developmental organs.
Supplementary data
Supplementary data are available at JXB online.Fig. S1. CRISPR/Cas9 OsALDH2b knockout.Fig. S2. Sequence alignment of ALDH plant orthologs.Fig. S3. OsALDH2b amino acid sequence.Fig. S4. OsALDH2b expression profile based on RiceXPro.Fig. S5. Expression analysis of eight genes related to anther development.Table S1. Molecular markers used for fine mapping.Table S2. Primers used for vector construction and expression analysis.Table S3. Genetic analysis of osaldh2b.Click here for additional data file.