Literature DB >> 31939329

Overexpression of cell-cycle related and expression-elevated protein in tumor (CREPT) in malignant cervical cancer.

Na Wen1,2, Lihua Bian1, Jing Gong1, Yuanguang Meng1.   

Abstract

Entities:  

Keywords:  CREPT; cervical carcinoma; cyclin D1; polymerase chain reaction; transcription factor 4; western blot analysis

Mesh:

Substances:

Year:  2020        PMID: 31939329      PMCID: PMC7114295          DOI: 10.1177/0300060519895089

Source DB:  PubMed          Journal:  J Int Med Res        ISSN: 0300-0605            Impact factor:   1.671


× No keyword cloud information.

Introduction

Cervical cancer is the third most common malignant carcinoma and fourth leading cause of cancer-related death among women worldwide. However, despite numerous studies, the etiology of cervical cancer remains unclear.[1] The cell-cycle-related and expression-elevated protein in tumor (CREPT) gene has recently been reported to be closely related to tumorigenesis and has become a hotspot in tumor research;[1] however, its role in the development of cervical cancer is currently unknown. CREPT is mainly involved in RNA transcription, DNA duplication, injury, and repair, and in protein translation.[1] As an oncogene, CREPT has demonstrated important roles in the occurrence, progression, invasion, and metastasis of carcinoma.[1,2] Significant overexpression of CREPT has been demonstrated in breast, colorectal, and gastric cancer,[1] and CREPT inhibition by RNA interference suppressed tumor proliferation and reduced the growth of transplanted tumors in nude mice.[3] CREPT was significantly overexpressed in cancerous tissues from patients with suprarenal epithelioma and non-small cell lung cancer, suggesting its possible application as a diagnostic biomarker and gene-therapy target in these carcinomas.[4,5] Previous studies have proposed that CREPT could combine with RNA polymerase II on the cyclin D1 gene, promoting the formation of a ring structure and subsequent gene transcription.[6,7] Cyclin D is also an important factor in the process of tumorigenesis.[8] CREPT was positively correlated with cyclin D3 in non-small cell lung cancer,[5,9] and both were highly expressed in cancerous tissues and differentially expressed between cancerous and non-cancerous tissues. Their expression levels were also significantly associated with pathologic staging, TNM stage, lymph node metastasis, and prognosis in patients with non-small cell carcinoma.[5,9] CREPT expression was significantly elevated in oral squamous cell carcinoma, and knockdown of CREPT significantly inhibited the proliferation and migration, as well as the expression of cyclin D1, in oral squamous cell carcinoma cell lines.[10] CREPT has also been shown to interact with the β-catenin/transcription factor 4 (TCF4) complex to participate in transcription activation by Wnt/β-catenin signaling.[11] In response to stimulation of Wnt, CREPT interacts with β-catenin and TCF4 to promote their combination, thereby activating transcription of Wnt target genes and promoting cell proliferation and invasion.[11] Although the role of CREPT in tumorigenesis has thus received much attention in recent years, its role in cervical cancer is still unknown. In the present study, we compared the gene and protein expression levels of CREPT, cyclin D1, and TCF4 in tissues from patients with cervical carcinoma and normal cervical tissues, to explore the possible role of CREPT in cervical carcinoma.

Materials and methods

Patients

This prospective observational study enrolled consecutive patients with cervical cancer, including cervical intraepithelial neoplasia, cervical carcinoma in situ, and invasive cervical carcinoma of the cervix, undergoing resection at the Gynecology Department of the People’s Liberation Army General Hospital from January 2016 to December 2017. The inclusion criteria were as follows: cervical carcinoma confirmed by histopathological examination; age >18 years; no anti-tumor treatment before surgery including neoadjuvant chemoradiotherapy, immunotherapy, or biological targeting therapy; and no malignant tumor except cervical cancer. Patients were excluded if they had an indefinite diagnosis of cervical cancer, or diagnosis not confirmed by histopathological examination, or if they had other malignant tumors. Patients undergoing uterus resection for uterine fibroids, benign ovarian tumors, or uterine prolapse during the same period were included as the control group. Cervical tissues were collected for all participants. The present study received approval from the Ethics Committee of the People’s Liberation Army General Hospital. All patients or their family members provided written informed consent.

Reagents

The EnVision two step immunohistochemical kit was obtained from Dako (Glostrup, Denmark); CREPT, cyclin D1, and TCF4 antibodies were obtained from GeneTex (TX, USA); and the total RNA extraction, reverse transcription, and BCA protein assay kits were obtained from Beijing ComWin Biotech Co. Ltd. (Beijing, China). The 7900 real-time quantitative polymerase chain reaction (RT-PCR) system was obtained from ABI (Foster City, CA, USA) and the RM2235 slicing instrument was obtained from Leica (Solms, Germany).

Immunohistochemistry

Tissues were fixed in 10% formaldehyde solution. After routine dehydration and embedding, 4-µm slices were sectioned continuously, dewaxed in xylene, hydrated in graded alcohols, and then digested in 3 mol/L urea. The tissue microarrays were microwave-repaired with citric acid buffer, cooled down to room temperature. Endogenous peroxidase was blocked with 3% H2O2 solution and 10% goat serum, and the sections were then incubated continuously with primary CREPT, cyclin D1, or TCF4 antibody (Cell Signaling Technology, CA, USA) (1:1000) at 4°C overnight, followed by reheating to 37°C, and incubation with horseradish peroxidase-conjugated secondary antibody (Sigma, CA, USA) (1:10,000) under constant temperature at 37°C. Sections were stained with 3,3′-diaminobenzidine followed by hematoxylin, differentiated in 1% ethanol hydrochloride, and dehydrated in graded ethanols, followed by blocking with neutral gum. All sections were examined by two senior pathologists in a double-blind manner. Semi-quantitative scoring of the sections was based on the staining intensity (1, weak staining; 2, medium staining; 3, strong staining) and proportion of positive cells (0, <1%; 1, 1%–10%; 2, 11%–50%; 3, 51%–80%; and 4, >80%). The sum of the scorings was categorized as follows: 1, (−); 2–3, (+); 4–5, (++); and 6–7 (+++). The positivity rates were calculated for the control and cancer groups.

RT-PCR

Total RNA was extracted from frozen surgical tissues using the primers listed in Table 1. The tissue samples were stored at −80°C. Total RNA was extracted, added into the cDNA reaction system using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, CA, USA) and PCR apparatus and incubated at 37°C. SYBR Green fluorescent staining was carried out using a SYBR Green Kit (Toyobo, Tokyo, Japan) employed and 40 cycles of PCR were completed using the above kit, according to the manufacturer’s instructions. Fluorescent signals was measured and analyzed using an ABI QuantStudio 3 RT PCR apparatus (Thermo Fisher Scientific). Ct values and solubility curves were generated and analyzed using the 2−ΔΔCT method.
Table 1

Forward and reverse primers.

Gene namePrimer forwardPrimer reverse
CREPTTCCTCAGAAAGTCTTCAATCTTCCGCCAACGACAGCCTATACTTCTA
Cyclin D1TCTGTGCATTTCTGGTTGCACTGGGGTTTTACCAGTTTTATTTCTA
TCF4CGGCGGTGGAGGGGATGACGGCCGCTTCTTCCAAACTTTCC
β-actinAGCACAATGAAGATCAAGATCATACTCGTCATACTCCTGCTTGC
Forward and reverse primers.

Western blotting

Total proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. Protein expression levels were detected by BCA assay, using β-actin as a reference. Primary CREPT, cyclin D1, TCF4, and β-actin antibodies were used at a dilution of 1:1000. Protein levels were detected using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).

Statistical analysis

Statistical analysis was carried out using IBM SPSS Statistics for Windows, Version 22.0 (IBM Corp., Armonk, NY). Continuous variables are shown as mean ± standard deviation and numerical variables as percentages. Differences in clinicopathological features between the control and cancer groups were analyzed by t-tests for continuous variables and χ2 tests for numerical variables. Differences in immunohistochemistry assessment results between groups were analyzed by χ2 tests. Differences in CREPT, cyclin D1, and TCF4 mRNA and protein levels were compared using t-tests. Correlations were determined using Spearman’s analysis. P < 0.05 indicated a significant difference.

Results

Patient characteristics

Twenty consecutive patients with cervical cancer and 10 control patients with benign cervical lesions were enrolled in this study. The clinical parameters of the cancer and control patients are shown in Table 2. There were no significant differences in any of the parameters between the groups (Table 2).
Table 2.

General clinicopathologic parameters in cervical cancer and control groups.

ParameterStudy populationControl groupCancer groupP value
Age (years)56.0 ± 0.556.0 ± 0.5>0.05
Tumor diameter
 ≥4 cm1208>0.05
 <4 cm18012
Differentiation degree
 High808>0.05
 Moderate10010
 Low12012
TNM stage
 Precancerous lesion606>0.05
 Stage I808
 Stage II909
 Stage III707
Lymph node metastasis
 Yes013>0.05
 No017
General clinicopathologic parameters in cervical cancer and control groups.

Overexpression of CREPT in cervical cancer tissues based on immunohistochemistry

CREPT was mainly expressed in the nuclei and partially in the cytoplasm according to immunohistochemical analysis, as indicated by brown staining (Figure 1). The CREPT-positivity rate (score of 2–7) was significantly higher in the cervical cancer compared with the non-cancerous cervical tissues (96.7% vs. 42.1%; P = 0.003).
Figure 1.

CREPT expression in cervical carcinoma and normal cervical tissues. (a) CREPT was strongly expressed in the nuclei and partially expressed in the cytoplasm in cervical carcinoma tissues. Examples of CREPT expression in (b) control and (c) cervical cancer tissues. Examples of weak (d), moderate (e), and strong (f) CREPT expression in cervical carcinoma tissues. Magnification ×200.

CREPT expression in cervical carcinoma and normal cervical tissues. (a) CREPT was strongly expressed in the nuclei and partially expressed in the cytoplasm in cervical carcinoma tissues. Examples of CREPT expression in (b) control and (c) cervical cancer tissues. Examples of weak (d), moderate (e), and strong (f) CREPT expression in cervical carcinoma tissues. Magnification ×200.

CREPT, cyclin D1, and TCF4 mRNA levels in cervical cancer and non-cancerous tissues

The solubility curves for CREPT, cyclin D1, TCF4, and β-actin were all single-peaked, with peak values of 75.8, 81.5, 81.2, and 84.0°C, respectively, indicating good specificities of the primers and constant amplification efficiency. According to PCR analysis, the relative mRNA levels of CREPT, cyclin D1, and TCF4 in cervical cancer tissues (0.2846 ± 0.0780, 0.4013 ±0.0533, and 0.3822 ± 0.0533, respectively) were all significantly higher than levels in normal cervical tissues (0.0446 ± 0.0520, 0.1027 ± 0.0836, and 0.1322 ± 0.0641, respectively) (all P < 0.01). CREPT and TCF mRNA levels in cervical cancer tissues were positively correlated according to Spearman’s correlation analysis (r = 0.520, P < 0.001), and CREPT mRNA levels were also positively correlated with cyclin D1 (r = 0.544, P < 0.001).

CREPT, cyclin D1, and TCF4 protein levels in cervical cancer and normal cervical tissues

According to western blot analysis, CREPT, TCF4, and cyclin D1 protein levels in cervical cancer tissues (0.3820 ± 0.0280, 0.4213 ±0.0523, and 0.2622 ± 0.0413, respectively) were all significantly higher than in normal cervical tissues (0.0326 ± 0.0720, 0.2027 ±0.0416, and 0.1752 ± 0.0841, respectively) (all P < 0.05) (Figure 2). Furthermore, CREPT and TCF protein level in cervical tissues were positively correlated according to Spearman’s correlation analysis (r = 0.490, P < 0.001), and CREPT and cyclin D1 protein levels were also positively correlated (r = 0.364, P < 0.001).
Figure 2.

Elevated protein expression levels of CREPT, cyclin D1, and TCF4 in cervical carcinoma and control tissues detected by western blot analysis. Representative western blots of CREPT, cyclin D1, and TCF protein expression in (a) eight controls and (b) eight cervical carcinoma patients.

Elevated protein expression levels of CREPT, cyclin D1, and TCF4 in cervical carcinoma and control tissues detected by western blot analysis. Representative western blots of CREPT, cyclin D1, and TCF protein expression in (a) eight controls and (b) eight cervical carcinoma patients.

Discussion

CREPT is a relatively newly discovered tumorigenesis-related protein; however, its role in cervical cancer has not yet been investigated. We therefore analyzed the expression of CREPT in cervical cancer compared with normal cervical tissues. CREPT mRNA and protein levels were both significantly higher in cervical cancer compared with normal cervical tissues, as demonstrated by immunohistochemistry, western blot, and PCR, indicating that CREPT may play an important role in cervical cancer. This is consistent with previous findings in other tumors, in which CREPT was significantly associated with tumor occurrence, progression, and prognosis.[1-5] Furthermore, expression levels of cyclin D1 and TCF4 were also significantly higher in cervical cancer tissues. Cyclin D1 might be a downstream gene regulated by CREPT,[6,7] while TCF4, as a transcription factor involved in the Wnt signaling pathway, can be activated by CREPT.[7] Correlation analysis also indicated a positive correlation between CREPT and cyclin D1, as well as TCF4, suggesting that CREPT may be involved in cervical cancer through its downstream elements cyclin D1 and TCF4. However, further studies are needed to elucidate the exact functions of these proteins in cervical cancer. This study had some limitations. First, the sample size was relatively small. Second, we did not analyze the relationship between CREPT and clinical outcome in patients with cervical cancer. Finally, the underlying molecular mechanisms of CREPT in cervical cancer remain unclear. Further studies are therefore needed to clarify these issues. In conclusion, we conducted an observational study to investigate the expression of CREPT in cervical cancer, and showed that both its mRNA and protein levels were significantly elevated in cervical cancer tissues and were positively correlated with both cyclin D1 and TCF4. CREPT may thus also play an important role in cervical cancer through its downstream elements cyclin D1 and TCF4.
  9 in total

1.  RPRD1B promotes tumor growth by accelerating the cell cycle in endometrial cancer.

Authors:  Yuan Wang; Haifeng Qiu; Weixu Hu; Shaoru Li; Jinjin Yu
Journal:  Oncol Rep       Date:  2014-01-21       Impact factor: 3.906

2.  CREPT accelerates tumorigenesis by regulating the transcription of cell-cycle-related genes.

Authors:  Dongdong Lu; Yinyuan Wu; Yinyin Wang; Fangli Ren; Dianjun Wang; Fuqin Su; Yanquan Zhang; Xi Yang; Guihua Jin; Xinbao Hao; Dacheng He; Yonggong Zhai; David M Irwin; Jim Hu; Joseph J Y Sung; Jun Yu; Baoqing Jia; Zhijie Chang
Journal:  Cancer Cell       Date:  2012-01-17       Impact factor: 31.743

3.  CREPT expression correlates with poor prognosis in patients with retroperitoneal leiomyosarcoma.

Authors:  Yaoguang She; Jiao Liang; Lin Chen; Ying Qiu; Na Liu; Xudong Zhao; Xiaohui Huang; Yinyin Wang; Fangli Ren; Zhijie Chang; Peiyu Li
Journal:  Int J Clin Exp Pathol       Date:  2014-09-15

4.  p15RS attenuates Wnt/{beta}-catenin signaling by disrupting {beta}-catenin·TCF4 Interaction.

Authors:  Yinyuan Wu; Yanquan Zhang; Haiwei Zhang; Xi Yang; Yinyin Wang; Fangli Ren; Huitu Liu; Yonggong Zhai; Baoqing Jia; Jun Yu; Zhijie Chang
Journal:  J Biol Chem       Date:  2010-08-25       Impact factor: 5.157

5.  Characterization of a monoclonal antibody against CREPT, a novel protein highly expressed in tumors.

Authors:  Fangli Ren; Ruoke Wang; Yanquan Zhang; Chunxiao Liu; Yinyin Wang; Jim Hu; Linqi Zhang; Zhijie Chang
Journal:  Monoclon Antib Immunodiagn Immunother       Date:  2014-12

Review 6.  Nuclear cyclin D1: an oncogenic driver in human cancer.

Authors:  Jong Kyong Kim; J Alan Diehl
Journal:  J Cell Physiol       Date:  2009-08       Impact factor: 6.384

7.  Knocking-down of CREPT prohibits the progression of oral squamous cell carcinoma and suppresses cyclin D1 and c-Myc expression.

Authors:  Juntao Ma; Yipeng Ren; Lei Zhang; Xiangpan Kong; Tong Wang; Yueyi Shi; Rongfa Bu
Journal:  PLoS One       Date:  2017-04-03       Impact factor: 3.240

8.  Expression of CREPT is associated with poor prognosis of patients with renal cell carcinoma.

Authors:  Huaqi Yin; Qingfei Cao; Haiyue Zhao; Shenheng Wang; Weinan Chen; Xiaowei Zhang; Zhijie Chang; Tao Xu; Xiongjun Ye
Journal:  Oncol Lett       Date:  2019-09-09       Impact factor: 2.967

9.  Cell cycle-related and expression-elevated protein in tumor overexpression is associated with proliferation behaviors and poor prognosis in non-small-cell lung cancer.

Authors:  Weimiao Li; Guoxu Zheng; Jinghua Xia; Guang Yang; Jianyong Sun; Xuejiao Wang; Miaomiao Wen; Ying Sun; Zhipei Zhang; Faguang Jin
Journal:  Cancer Sci       Date:  2018-03-05       Impact factor: 6.716

  9 in total
  3 in total

1.  An Important Role for RPRD1B in the Heat Shock Response.

Authors:  Simona Cugusi; Prashanth Kumar Bajpe; Richard Mitter; Harshil Patel; Aengus Stewart; Jesper Q Svejstrup
Journal:  Mol Cell Biol       Date:  2022-09-19       Impact factor: 5.069

Review 2.  Current understanding of CREPT and p15RS, carboxy-terminal domain (CTD)-interacting proteins, in human cancers.

Authors:  Mengdi Li; Danhui Ma; Zhijie Chang
Journal:  Oncogene       Date:  2020-11-25       Impact factor: 9.867

3.  Purification and Analysis of the CREPT Antibody from Mouse Ascites.

Authors:  Zhihao Xie; Jun Li; Xinbao Hao; Lu Xu
Journal:  Appl Bionics Biomech       Date:  2022-09-05       Impact factor: 1.664

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.