Xue Hao1, Shimin Wang1, Yi Lu1, Wentao Yu1, Pengyue Li1, Dan Jiang1, Tong Guo1, Mengjie Li2, Jinhui Li1, Jinjin Xu1, Wenqing Wu1, Margaret S Ho3, Lei Zhang1,3. 1. State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular Cell Science, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Shanghai, China. 2. State Key Laboratory of Microbial Metabolism, School of Life Sciences and Biotechnology, The Joint International Research Laboratory of Metabolic and Developmental Sciences, Shanghai Jiao Tong University, Shanghai, China. 3. School of Life Science and Technology, ShanghaiTech University, Shanghai, China.
Abstract
Tissue homeostasis and regeneration in the Drosophila midgut is regulated by a diverse array of signaling pathways including the Hippo pathway. Hippo signaling restricts intestinal stem cell (ISC) proliferation by sequestering the transcription co-factor Yorkie (Yki) in the cytoplasm, a factor required for rapid ISC proliferation under injury-induced regeneration. Nonetheless, the mechanism of Hippo-mediated midgut homeostasis and whether canonical Hippo signaling is involved in ISC basal proliferation are less characterized. Here we identify Lola as a transcription factor acting downstream of Hippo signaling to restrict ISC proliferation in a Yki-independent manner. Not only that Lola interacts with and is stabilized by the Hippo signaling core kinase Warts (Wts), Lola rescues the enhanced ISC proliferation upon Wts depletion via suppressing Dref and SkpA expressions. Our findings reveal that Lola is a non-canonical Hippo signaling component in regulating midgut homeostasis, providing insights on the mechanism of tissue maintenance and intestinal function.
Tissue homeostasis and regeneration in the Drosophila midgut is regulated by a diverse array of signaling pathways including the Hippo pathway. Hippo signaling restricts intestinal stem cell (ISC) proliferation by sequestering the transcription co-factor Yorkie (Yki) in the cytoplasm, a factor required for rapid ISC proliferation under injury-induced regeneration. Nonetheless, the mechanism of Hippo-mediated midgut homeostasis and whether canonical Hippo signaling is involved in ISC basal proliferation are less characterized. Here we identify Lola as a transcription factor acting downstream of Hippo signaling to restrict ISC proliferation in a Yki-independent manner. Not only that Lola interacts with and is stabilized by the Hippo signaling core kinase Warts (Wts), Lola rescues the enhanced ISC proliferation upon Wts depletion via suppressing Dref and SkpA expressions. Our findings reveal that Lola is a non-canonical Hippo signaling component in regulating midgut homeostasis, providing insights on the mechanism of tissue maintenance and intestinal function.
Maintenance of tissue homeostasis, as in the intestinal epithelium, is under complex regulation so to achieve a dynamic balance in terms of the rate for cell turnover (Guo et al., 2016). Uncontrolled tissue regeneration leads to intestinal malignancies such as colorectal cancer (Terzić et al., 2010), whereas a steady and homeostatic condition is preferable to maintain the integrity of the intestinal tissue for its normal function such as food digestion and nutrient absorption (Casali and Batlle, 2009; Guo et al., 2016). The Drosophila adult midgut, functionally equivalent to the mammalian small intestine, consists of a single epithelial layer where mature cell types differentiate apical-basally from the intestinal stem cells (ISCs) scattered along the basal side (Jiang et al., 2016). ISCs undergo asymmetric divisions that give rise to a renewable ISC and a non-dividing immature enteroblast (EB), which further differentiates into either an absorptive enterocyte (EC) or a secretory enteroendocrine (ee) cell (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006). Previous studies have shown that both ISCs and EBs, commonly referred as midgut precursors, express the Snail/Slug family transcription factor escargot (Micchelli and Perrimon, 2006). Whereas ISCs are marked by the Notch (N) ligand Delta (Dl) (Ohlstein and Spradling, 2007), EBs can be labeled by a reporter of N signaling, Su(H)Gbe-lacZ (Su(H)-Z), due to the activation by neighboring ISCs (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006). Terminally differentiated ECs, labeled by the class II POU domain transcription factor Pdm1 or Brush Border Myosin (MyoIA), acquire their large size and polyploid nuclei via endoreplication (Jiang et al., 2009; Lee et al., 2009). On the other hand, ee cells with small nuclei are specifically stained by Prospero (Pros) (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Singh et al., 2012). These differential patterns in gene expression allow the identification of distinct cell types in the midgut, and provides strategic means to analyze the features and properties of adult stem cells.Midgut homeostasis is maintained via a basal level of ISC turnover to replace the cells loss during normal gut function (Antonello et al., 2015; Jiang et al., 2011). Upon stress or injury, however, ISCs undergo rapid proliferation in order to replenish enough cells in a limited time for regeneration (Amcheslavsky et al., 2009; Buchon et al., 2010; Buchon et al., 2009b). These processes are regulated by a number of signaling pathways such as N (Ohlstein and Spradling, 2007), Wingless (Lin et al., 2008), JAK-STAT (Beebe et al., 2010; Jiang et al., 2009) and EGFR (Buchon et al., 2010; Jiang et al., 2011). Particularly, Hippo signaling has been shown to play pivotal roles in both Drosophila midgut homeostasis and regeneration via cell-autonomous and non-cell-autonomous mechanisms (Karpowicz et al., 2010; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010). As an evolutionarily conserved pathway, Hippo signaling controls organ size by balancing cell proliferation and death (Yin and Zhang, 2011). The pathway consists of a core kinase cascade in which Hippo (Hpo) kinase phosphorylates and activates Warts (Wts) kinase via interaction with the scaffold protein Salvador (Sav). Subsequently, Wts interacts with Mob as tumor suppressor (Mats) to trigger phosphorylation of the transcription coactivator Yorkie (Yki), blocking its translocation to form a complex with the transcription factor Scalloped (Sd) in the nucleus, thus inhibiting downstream signal transduction (Goulev et al., 2008; Harvey et al., 2003; Huang et al., 2005; Justice et al., 1995; Oh and Irvine, 2008; Pantalacci et al., 2003; Udan et al., 2003; Wu et al., 2003; Xu et al., 1995). Despite that Hippo signaling mainly transduces via triggering Wts phosphorylation (Udan et al., 2003; Wu et al., 2003), previous studies indicate that some upstream components regulate the Hippo signaling activity by controlling Wts protein levels. The atypical cadherin Fat (Ft) (Cho et al., 2006), the atypical myosin Dachs (D) together with the LIM domain protein Zyxin (Zyx) (Rauskolb et al., 2011), and the tumor suppressor gene Scribble (Scrib) (Verghese et al., 2012) function as Hippo components via regulating Wts protein stability. During midgut homeostasis, Hippo signaling restricts ISC proliferation by sequestering Yki in the cytoplasm, thereby deactivating downstream signaling. Inactivation of Hpo or Wts leads to enhanced ISC proliferation, same as yki overexpression which activates EGFR and JAK-STAT pathways (in ECs, non-cell-autonomously) or promotes expression of target genes such as bantam microRNA (in ISCs, cell-autonomously) (Houtz et al., 2017; Huang et al., 2014; Nolo et al., 2006; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010; Thompson and Cohen, 2006). In addition, the Yki-Sd complex is considered as the major mediator for injury-induced midgut regeneration, as loss of Yki in either ISCs or ECs blocks DSS- or infection-stimulated ISC proliferation, respectively (Cai et al., 2010; Karpowicz et al., 2010; Ren et al., 2010). Despite abundant evidence underlying the significance of Hippo signaling during midgut homeostasis and regeneration, neither Yki nor Sd depletion causes defects in ISC basal proliferation, raising the controversies whether the Yki-Sd complex truly executes downstream Hippo signaling during midgut homeostasis as it does in regeneration. longitudinals lacking (lola) is a transcription factor implicated in axon growth and guidance (Crowner et al., 2002; Giniger et al., 1994), ovary cell apoptosis (Bass et al., 2007), germline/neuron stem cell differentiation and maintenance (Davies et al., 2013; Silva et al., 2016; Southall et al., 2014) and wing margin development (Bass et al., 2007; Krupp et al., 2005). It also cooperates with Dl to induce the formation of metastatic tumors and regulates cell fate in Drosophila eye by antagonizing N signaling (Ferres-Marco et al., 2006; Zheng and Carthew, 2008). Despite the presence of more than 20 alternatively-spliced isoforms, the protein product of lola contains a N-terminal BTB or POZ domain and one or two C-terminal zinc finger motifs, indicating that Lola is a Cullin-3 (Cul3)-based substrate adaptor that also binds DNA (Furukawa et al., 2003; Geyer et al., 2003; Goeke et al., 2003; Horiuchi et al., 2003; Ohsako et al., 2003; Pintard et al., 2004). In the present study, we identify Lola as a transcription factor acting downstream of Hippo signaling to restrict ISC proliferation and regulate midgut homeostasis. Our results show that the Hippo signaling pathway component Wts physically interacts with Lola and regulates its stability. Whereas reduced ykiexpression does not rescue the enhanced ISC proliferation induced by Wts depletion, Lola genetically interacts with Wts and exhibits a suppression effect on the overgrowth. Wts-mediated Lola stability provides a means for Hippo signaling to regulate midgut homeostasis in a manner independent of the canonical Yki-Sd complex. Furthermore, Lola restricts ISC proliferation by suppressing downstream Dref and SkpAexpression levels. Taken together, our findings reveal that Lola is a novel signaling effector in regulating ISC basal proliferation and midgut homeostasis via its transcriptional activity and interaction with a central Hippo signaling component.
Results
Yki is dispensable for Wts-mediated ISC proliferation in Drosophila midgut
Given the importance of Hippo signaling in regulating Drosophila adult midgut homeostasis, it is rather surprising that lacking the Hippo effector Yki leads to no defects in ISC basal proliferation (Karpowicz et al., 2010; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010). To first confirm if Hippo signaling regulates midgut homeostasis via the Yki-Sd canonical signaling, escargot-Gal4 (esg-Gal4) that drives gene expression in ISCs and EBs was employed in combination with a temperature-sensitive Gal4 repressor tub-Gal80 to restrict the time of expression (esg) (Micchelli and Perrimon, 2006). As shown in Figure 1A–A’, ISCs and EBs were labeled with esg-driven GFP expression (esg-GFP). Expression of wts RNAi (esg RNAi) resulted in an increase in the number of GFP+ cells in the posterior part of the midgut, indicating that reduced wtsexpression leads to an expansion of the precursor cell population (Figure 1B–B’ and Figure 1—figure supplement 1A). Consistent with previous results, reduced ykiexpression (esg RNAi) does not lead to obvious difference in the number of GFP+ cells, suggesting that Yki is not required for overall midgut homeostasis (Figure 1C–C’). Immunostaining with antibodies against phospho-Histone 3 (p-H3) that marks mitotic cells derived from ISCs indicated an obvious increase in p-H3+ cell number when downregulating wtsexpression in ISCs and EBs (esg RNAi, Figure 1E), suggesting that the expansion in the precursor cell population in Figure 1B is due to enhanced ISC proliferation. Unexpectedly, co-expression of yki and wts RNAi suppressed neither the growth of precursor cell population nor the enhanced proliferation induced by wts RNAi, suggesting that Wts mediates ISC proliferation independently of Yki (Figure 1D–E and Figure 1—figure supplement 1A–F).
Figure 1.
Yki is dispensable for Wts-mediated ISC proliferation in Drosophila midgut.
(A–D’) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 (esg) (A–A’), esg RNAi (B–B’), esg RNAi (C–C’), and esg RNAi; wts RNAi (D–D’). Midguts were dissected and immunostained with DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and blue). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A-D (n = 20, 21, 22, 16). Note a significant increase in the p-H3+ cell number when wts RNAi is expressed (***p<0.001). Co-expression of yki and wts RNAi does not suppress the increase (ns p>0.05). (F–H’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (F–F’), wts (G–G’) and wts in the presence of yki RNAi (H–H’). Midguts were dissected and immunostained with antibodies against Dl (red) 4 days after clone induction. Areas enclosed by the dashed lines indicate clone regions. White arrows indicate ISCs marked by Dl. Merged images are shown in F’, G’ and H’ (green and red). (I) Quantifications of the Dl+ cell number per clone in adult midguts from the indicated genotypes in F-H. Average of 124–152 clones from 10 midguts for each genotype were quantified. (J–M’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (J–J’), yki (K–K’), wts RNAi (L–L’), and yki in the presence of wts RNAi (M–M’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in J’, K’, L’, and M’ (green, blue, and red). (N) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in H-K. Note that yki does not restore the large clone size induced by wts RNAi expression (red). Average of 122–176 clones from 10 midguts for each genotype were quantified. Scale bars: 30 μm. Data are shown as mean ± SEM. P-values of significance (indicated with asterisks, ns no significance p>0.05, *p<0.05, **p<0.01, and ***p<0.001) are calculated by Student’s T-test. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > wts RNAi-1 (red bar), and MS1096-Gal4 > wts RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when wts RNAi is expressed (**p<0.01 and ***p<0.001). (B-E) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 (esg) (B), esg RNAi-2 (C), esg RNAi (D), and esg RNAi; wts RNAi-2 (E). ISCs and EBs are marked with esg-GFP (green). (F) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in B-E (n = 14, 13, 14, 12). Note a significant increase in the p-H3+ cell number when wts RNAi-2 is expressed (*p<0.05). (G-J) Representative images of female wings from flies of control (G), MS1096-Gal4 > wts RNAi (H), MS1096-Gal4 > yki RNAi (I), and MS1096-Gal4 > yki RNAi; wts RNAi (J). Control wing size is marked by a white dashed line for comparison (G-J). (K) Quantifications of relative wing sizes (normalized to the control wing size) from flies with the indicated genotypes in G-J (n = 16, 22, 10, 11). Wing sizes were quantified using ImageJ software by measuring the area of wings. Note a significant increase in the wing size when wts RNAi is expressed (***p<0.001). Co-expression of yki and wts RNAi rescues the increase (***p<0.001). (L-O’) Representative images of adult midguts containing GFP positive MARCM clones of control (L-L’), sd (M-M’), wts RNAi (N-N’), and sd in the presence of wts RNAi (O-O’). Midguts were dissected 4 days after clone induction and immunostained with DAPI (blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in L’, M’, N’, and O’ (green and blue). (P) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in L-O. Note that sd partially suppresses the large clone size induced by wts RNAi (*p<0.05). Average 90–110 clones from 10 midguts were quantified for each genotype. Scale bars: 30 μm in B-E, L’-O’; 500 μm in G-J. Data are shown as mean ± SEM. P-values of significance (indicated with asterisks, ns no significance p>0.05, *p<0.05, **p<0.01, and ***p<0.001) are calculated by Student’s T-test. At least 10 midguts or female wings were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 1—figure supplement 1.
Yki is dispensable for Wts-mediated ISC proliferation in Drosophila midgut (A)Relative wts mRNA levels were analyzed by real-time PCR.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > wts RNAi-1 (red bar), and MS1096-Gal4 > wts RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when wts RNAi is expressed (**p<0.01 and ***p<0.001). (B-E) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 (esg) (B), esg RNAi-2 (C), esg RNAi (D), and esg RNAi; wts RNAi-2 (E). ISCs and EBs are marked with esg-GFP (green). (F) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in B-E (n = 14, 13, 14, 12). Note a significant increase in the p-H3+ cell number when wts RNAi-2 is expressed (*p<0.05). (G-J) Representative images of female wings from flies of control (G), MS1096-Gal4 > wts RNAi (H), MS1096-Gal4 > yki RNAi (I), and MS1096-Gal4 > yki RNAi; wts RNAi (J). Control wing size is marked by a white dashed line for comparison (G-J). (K) Quantifications of relative wing sizes (normalized to the control wing size) from flies with the indicated genotypes in G-J (n = 16, 22, 10, 11). Wing sizes were quantified using ImageJ software by measuring the area of wings. Note a significant increase in the wing size when wts RNAi is expressed (***p<0.001). Co-expression of yki and wts RNAi rescues the increase (***p<0.001). (L-O’) Representative images of adult midguts containing GFP positive MARCM clones of control (L-L’), sd (M-M’), wts RNAi (N-N’), and sd in the presence of wts RNAi (O-O’). Midguts were dissected 4 days after clone induction and immunostained with DAPI (blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in L’, M’, N’, and O’ (green and blue). (P) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in L-O. Note that sd partially suppresses the large clone size induced by wts RNAi (*p<0.05). Average 90–110 clones from 10 midguts were quantified for each genotype. Scale bars: 30 μm in B-E, L’-O’; 500 μm in G-J. Data are shown as mean ± SEM. P-values of significance (indicated with asterisks, ns no significance p>0.05, *p<0.05, **p<0.01, and ***p<0.001) are calculated by Student’s T-test. At least 10 midguts or female wings were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Yki is dispensable for Wts-mediated ISC proliferation in Drosophila midgut.
(A–D’) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 (esg) (A–A’), esg RNAi (B–B’), esg RNAi (C–C’), and esg RNAi; wts RNAi (D–D’). Midguts were dissected and immunostained with DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and blue). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A-D (n = 20, 21, 22, 16). Note a significant increase in the p-H3+ cell number when wts RNAi is expressed (***p<0.001). Co-expression of yki and wts RNAi does not suppress the increase (ns p>0.05). (F–H’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (F–F’), wts (G–G’) and wts in the presence of yki RNAi (H–H’). Midguts were dissected and immunostained with antibodies against Dl (red) 4 days after clone induction. Areas enclosed by the dashed lines indicate clone regions. White arrows indicate ISCs marked by Dl. Merged images are shown in F’, G’ and H’ (green and red). (I) Quantifications of the Dl+ cell number per clone in adult midguts from the indicated genotypes in F-H. Average of 124–152 clones from 10 midguts for each genotype were quantified. (J–M’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (J–J’), yki (K–K’), wts RNAi (L–L’), and yki in the presence of wts RNAi (M–M’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in J’, K’, L’, and M’ (green, blue, and red). (N) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in H-K. Note that yki does not restore the large clone size induced by wts RNAi expression (red). Average of 122–176 clones from 10 midguts for each genotype were quantified. Scale bars: 30 μm. Data are shown as mean ± SEM. P-values of significance (indicated with asterisks, ns no significance p>0.05, *p<0.05, **p<0.01, and ***p<0.001) are calculated by Student’s T-test. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Yki is dispensable for Wts-mediated ISC proliferation in Drosophila midgut (A)Relative wts mRNA levels were analyzed by real-time PCR.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > wts RNAi-1 (red bar), and MS1096-Gal4 > wts RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when wts RNAi is expressed (**p<0.01 and ***p<0.001). (B-E) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 (esg) (B), esg RNAi-2 (C), esg RNAi (D), and esg RNAi; wts RNAi-2 (E). ISCs and EBs are marked with esg-GFP (green). (F) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in B-E (n = 14, 13, 14, 12). Note a significant increase in the p-H3+ cell number when wts RNAi-2 is expressed (*p<0.05). (G-J) Representative images of female wings from flies of control (G), MS1096-Gal4 > wts RNAi (H), MS1096-Gal4 > yki RNAi (I), and MS1096-Gal4 > yki RNAi; wts RNAi (J). Control wing size is marked by a white dashed line for comparison (G-J). (K) Quantifications of relative wing sizes (normalized to the control wing size) from flies with the indicated genotypes in G-J (n = 16, 22, 10, 11). Wing sizes were quantified using ImageJ software by measuring the area of wings. Note a significant increase in the wing size when wts RNAi is expressed (***p<0.001). Co-expression of yki and wts RNAi rescues the increase (***p<0.001). (L-O’) Representative images of adult midguts containing GFP positive MARCM clones of control (L-L’), sd (M-M’), wts RNAi (N-N’), and sd in the presence of wts RNAi (O-O’). Midguts were dissected 4 days after clone induction and immunostained with DAPI (blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in L’, M’, N’, and O’ (green and blue). (P) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in L-O. Note that sd partially suppresses the large clone size induced by wts RNAi (*p<0.05). Average 90–110 clones from 10 midguts were quantified for each genotype. Scale bars: 30 μm in B-E, L’-O’; 500 μm in G-J. Data are shown as mean ± SEM. P-values of significance (indicated with asterisks, ns no significance p>0.05, *p<0.05, **p<0.01, and ***p<0.001) are calculated by Student’s T-test. At least 10 midguts or female wings were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.Next, GFP+ clones of wts mutant allele wts were generated using the mosaic analysis with a repressible cell marker (MARCM) system (Lee and Luo, 2001). Interestingly, the number of Dl-labeled ISCs was increased in wts clones, indicating that ISCs are over proliferative (Figure 1F–G’ and I). Consistent to our wts RNAi results, simultaneous expression of yki RNAi in these clones did not restore the elevated Dl+ cell number (Figure 1H–I), suggesting that the reduced ykiexpression does not block wts-induced ISC proliferation. These results are inconsistent with previous findings that Yki works downstream of Wts and regulates the output of canonical Hippo signaling, raising concerns whether different mechanisms exist between gut and other tissues, or the yki RNAi line is not efficient enough in downregulating ykiexpression.To address the inconsistency, we first sought to determine if Wts and Yki work in a tissue-specific manner. Using Drosophila wing as a model, expression of wts RNAi by MS1096-Gal4 resulted in larger wing size, a phenotype rescued by yki RNAi co-expression. These results suggest that Yki functions together with Wts in controlling the wing size, a mechanism that differs from gut homeostasis (Figure 1—figure supplement 1G–K). These results are consistent with previous findings and indicate that yki RNAi is effective in downregulating ykiexpression. To further support our hypothesis, a separate MARCM clone approach independent of yki RNAi was employed using yki or sd mutant allele yki or sd . Clones were induced in parallel in adult flies raised at 25 °C for 2 or 4 days after induction. Clone sizes were compared by measuring the number of GFP+ cells per clone. Under this condition, we found that clones expressing wts RNAi were bigger than the control, and the size was not or only slightly affected by the presence of yki or sd , respectively (Figure 1J–N and Figure 1—figure supplement 1L–P). Taken together, these results indicate a non-canonical mechanism regulating midgut homeostasis by Hippo signaling. The regulatory mechanism depends on Wts function, yet is independent of the Yki-Sd transcriptional complex in Drosophila midgut.
Lola is required for ISC proliferation and midgut homeostasis
Based on our results, we propose that Wts-mediated Hippo signaling regulates midgut homeostasis independently of Yki. To identify factors that might act downstream of Wts in mediating midgut homeostasis, a genetic screen using esg to drive RNAi expression in precursors was conducted. Interestingly, expression of two independent RNAi lines VDRC12574 (Figure 2) and NIG12052 R-1 (Figure 2—figure supplement 1), both target and abolish lolaexpression (Figure 2—figure supplement 1A), resulted in an increased number of GFP+ and p-H3+ cells in the posterior midgut (Figure 2A–C and Figure 2—figure supplement 1B–D). Moreover, the p-H3+ cells were dually labeled with Dl, suggesting that these cells are proliferative ISCs (Figure 2A–C). These results indicate that reducing lolaexpression in gut precursor cells promotes ISC proliferation. In addition, MARCM lola (a hypomorphic allele) mutant clones were bigger in size compared to the control (Figure 2D–E’’’), indicating a growth advantage due to ISC hyperproliferation when lolaexpression is reduced. As shown in Figure 2E–E’’’, these lola mutant clones contained Pdm1+ ECs and Pros+ ee cells, suggesting that Lola activity is not required for ISC differentiation.
Figure 2.
Lola is required for ISC proliferation and midgut homeostasis.
(A–B’’) Representative images of Drosophila adult midguts of esg (A–A’) and esg RNAi (B–B’’). Midguts were dissected and immunostained with antibodies against Dl (red), p-H3 (gray), and DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3 (B’ and B’’). Merged images are shown in A’’ and B’’ (green, red, gray, and blue). (C) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A and B (n = 9, 10). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). (D–E’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (D–D’’’) and the hypomorphic allele lola (E–E’’’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Arm and Pros (blue) and Pdm1 (red). Areas enclosed by the dashed lines indicate respective clone size. White arrows indicate Pdm1+ ECs, and yellow arrows indicate Pros+ ee cells. Merged images are shown in D’’’ and E’’’ (green, red, and blue). (F–G’’) Representative images of Drosophila adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (F–F’’) and MyoIA RNAi (G–G’’). Midguts were dissected and immunostained with antibodies against Dl (red), p-H3 (gray), and DAPI (blue). ECs are marked with MyoIA-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3 (G’ and G’’). Merged images are shown in F’’ and G’’ (green, red, gray, and blue). (H) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in F and G (n = 10, 10). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). (I–J’’) Representative images of cross section of Drosophila adult midguts from MyoIA (I–I’’) and MyoIA RNAi (J–J’’) immunostained with antibodies against phalloidin (red) and DAPI (blue). Merged images are shown in I’’ and J’’ (green, red, and blue). Scale bars: 30 μm in A’’, B’’, D’’’, E’’’; 25 μm in F’’, G’’, I’’, J’’. Data are shown as mean ± SEM. ***p<0.001 by Student’s T-test. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized except in I-J’’. Single layer image is shown.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > lola RNAi-1 (red bar), MS1096-Gal4 > lola RNAi-2 (blue bar), and MS1096-Gal4 > lola RNAi-3 (gray bar). Note a significant decrease in the mRNA levels when lola RNAi is expressed (**p<0.01 and ***p<0.001). (B-C’) Representative images of adult midguts of esg (B-B’) and esg RNAi-2 (C-C’). Midguts were immunostained with p-H3 (red) and Arm and Pros (blue). ISCs and EBs are marked with esg-GFP (green). White arrows indicate cells marked by p-H3. Merged images are shown in B’ and C’ (green, red, and blue). (D) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in B and C (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (E-F’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (E-E’) and MyoIA RNAi-2 (F-F’). Midguts were immunostained with Dl (red), p-H3 (gray), and DAPI (nuclei, blue). ECs are marked with MyoIA-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3. Merged images are shown in E’ and F’ (green, red, gray, and blue). ECs were marked by MyoIA-Gal4 driven GFP expression. (G) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in E and F (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (H-I’’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (H-H’’) and MyoIA RNAi (I-I’’) immunostained with Caspase-3 (red), and Arm (blue). Merged images are shown in H’’ and I’’ (green, red, and blue). Scale bars: 30 μm in B’, C’, H’’, I’’; 25 μm in E’, F’. Data are shown as mean ± SEM. **p<0.01 and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 2—figure supplement 1.
Lola is required for ISC proliferation and midgut homeostasis (A)Relative lola mRNA levels were analyzed by real-time PCR.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > lola RNAi-1 (red bar), MS1096-Gal4 > lola RNAi-2 (blue bar), and MS1096-Gal4 > lola RNAi-3 (gray bar). Note a significant decrease in the mRNA levels when lola RNAi is expressed (**p<0.01 and ***p<0.001). (B-C’) Representative images of adult midguts of esg (B-B’) and esg RNAi-2 (C-C’). Midguts were immunostained with p-H3 (red) and Arm and Pros (blue). ISCs and EBs are marked with esg-GFP (green). White arrows indicate cells marked by p-H3. Merged images are shown in B’ and C’ (green, red, and blue). (D) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in B and C (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (E-F’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (E-E’) and MyoIA RNAi-2 (F-F’). Midguts were immunostained with Dl (red), p-H3 (gray), and DAPI (nuclei, blue). ECs are marked with MyoIA-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3. Merged images are shown in E’ and F’ (green, red, gray, and blue). ECs were marked by MyoIA-Gal4 driven GFP expression. (G) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in E and F (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (H-I’’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (H-H’’) and MyoIA RNAi (I-I’’) immunostained with Caspase-3 (red), and Arm (blue). Merged images are shown in H’’ and I’’ (green, red, and blue). Scale bars: 30 μm in B’, C’, H’’, I’’; 25 μm in E’, F’. Data are shown as mean ± SEM. **p<0.01 and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola is required for ISC proliferation and midgut homeostasis.
(A–B’’) Representative images of Drosophila adult midguts of esg (A–A’) and esg RNAi (B–B’’). Midguts were dissected and immunostained with antibodies against Dl (red), p-H3 (gray), and DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3 (B’ and B’’). Merged images are shown in A’’ and B’’ (green, red, gray, and blue). (C) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A and B (n = 9, 10). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). (D–E’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (D–D’’’) and the hypomorphic allele lola (E–E’’’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Arm and Pros (blue) and Pdm1 (red). Areas enclosed by the dashed lines indicate respective clone size. White arrows indicate Pdm1+ ECs, and yellow arrows indicate Pros+ ee cells. Merged images are shown in D’’’ and E’’’ (green, red, and blue). (F–G’’) Representative images of Drosophila adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (F–F’’) and MyoIA RNAi (G–G’’). Midguts were dissected and immunostained with antibodies against Dl (red), p-H3 (gray), and DAPI (blue). ECs are marked with MyoIA-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3 (G’ and G’’). Merged images are shown in F’’ and G’’ (green, red, gray, and blue). (H) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in F and G (n = 10, 10). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). (I–J’’) Representative images of cross section of Drosophila adult midguts from MyoIA (I–I’’) and MyoIA RNAi (J–J’’) immunostained with antibodies against phalloidin (red) and DAPI (blue). Merged images are shown in I’’ and J’’ (green, red, and blue). Scale bars: 30 μm in A’’, B’’, D’’’, E’’’; 25 μm in F’’, G’’, I’’, J’’. Data are shown as mean ± SEM. ***p<0.001 by Student’s T-test. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized except in I-J’’. Single layer image is shown.
Lola is required for ISC proliferation and midgut homeostasis (A)Relative lola mRNA levels were analyzed by real-time PCR.
Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > lola RNAi-1 (red bar), MS1096-Gal4 > lola RNAi-2 (blue bar), and MS1096-Gal4 > lola RNAi-3 (gray bar). Note a significant decrease in the mRNA levels when lola RNAi is expressed (**p<0.01 and ***p<0.001). (B-C’) Representative images of adult midguts of esg (B-B’) and esg RNAi-2 (C-C’). Midguts were immunostained with p-H3 (red) and Arm and Pros (blue). ISCs and EBs are marked with esg-GFP (green). White arrows indicate cells marked by p-H3. Merged images are shown in B’ and C’ (green, red, and blue). (D) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in B and C (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (E-F’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (E-E’) and MyoIA RNAi-2 (F-F’). Midguts were immunostained with Dl (red), p-H3 (gray), and DAPI (nuclei, blue). ECs are marked with MyoIA-GFP (green). White arrows indicate proliferative ISCs marked by Dl and p-H3. Merged images are shown in E’ and F’ (green, red, gray, and blue). ECs were marked by MyoIA-Gal4 driven GFP expression. (G) Quantification of the p-H3+ cell number in adult midguts from the indicated genotypes in E and F (n = 5, 5). Note a significant increase in the p-H3+ cell number when lola RNAi-2 is expressed (***p<0.001). (H-I’’) Representative images of adult midguts of MyoIA-Gal4; tubGal80 (MyoIA) (H-H’’) and MyoIA RNAi (I-I’’) immunostained with Caspase-3 (red), and Arm (blue). Merged images are shown in H’’ and I’’ (green, red, and blue). Scale bars: 30 μm in B’, C’, H’’, I’’; 25 μm in E’, F’. Data are shown as mean ± SEM. **p<0.01 and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.In addition to the cell-autonomous role of Lola in precursor cells, we assess the possibility that Lola functions non-cell-autonomously by expressing lola RNAi in ECs. MyoIA is a driver combining tub-Gal80 and Myo IA-Gal4, an enhancer trap inserted in the gut specific brush border myosin IA gene (Morgan et al., 1994). Myo IA-driven GFP expression (MyoIA-GFP) labels ECs (Figure 2F–F’’). Compared with the control groups, expressing either lola RNAi in ECs dramatically promoted ISC proliferation, as indicated by the increased Dl+ and p-H3+ cell number (Figure 2F–H and Figure 2—figure supplement 1E–G). Moreover, reducing lolaexpression in ECs resulted in gut hypertrophy associated with multi-layer of intestinal cells (Figure 2I–J’’), possibly a consequence of hyperproliferation. Based on the findings that ECs interact with ISCs and regulate their proliferation (Gervais and Bardin, 2017), these results suggest a non-cell-autonomous role of Lola in regulating ISC proliferation during midgut homeostasis. Importantly, reducing lolaexpression in ECs did not induce non-specific apoptosis in the posterior midgut (Figure 2—figure supplement 1H–I’’), indicating that lola RNAi promotes ISC proliferation via a specific signaling pathway. Altogether, Lola is required in both precursor cells and ECs for ISC proliferation and midgut homeostasis.
Loss of Lola activates EGFR, JAK-STAT, and microRNA bantam signaling
Due to functional similarities between Lola and Wts in mediating midgut homeostasis, we next sought to determine whether Lola, like Wts, functions as a component in Hippo signaling. It has been shown that inactivation of Hippo signaling activates EGFR, JAK-STAT, and microRNA bantam pathways to stimulate ISC proliferation (Karpowicz et al., 2010; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010). Interestingly, Lola depletion in either precursors or ECs caused a significant increase in the levels of dpERK, the dephosphorylated active form of MAPK (Gabay et al., 1997), and the mRNA levels of EGFR ligands Spitz (Spi), Vein (Vn), and Krn, all indicating EGFR activation (Figure 3A–E). Moreover, Lola depletion in either precursors or ECs activates JAK-STAT signaling as indicated by the elevated expressions of JAK-STAT ligand Upd3 and Stat-GFP, a multimerized Stat92E reporter driving the expression of a destabilized GFP to monitor JAK-STAT activity (Bach et al., 2007) (Figure 3F–M). Consistently, mRNA levels of Upds (Upd, Upd2, and Upd3), and the JAK-STAT target Socs36E were elevated dramatically upon Lola depletion (Figure 3N). Furthermore, expression levels of the microRNA bantam, a canonical downstream target of Hippo signaling essential for cell-autonomous ISC proliferation (Huang et al., 2014), were also elevated upon Lola depletion (Figure 3O–P’’’). These results demonstrate that loss of Lola activates EGFR, JAK-STAT, and microRNA bantam signaling, suggesting that Lola regulates ISC proliferation likely via mechanisms involving Hippo signaling.
Figure 3.
Loss of Lola activates EGFR, JAK-STAT, and microRNA bantam signaling.
(A–B’) Representative images of Drosophila adult midguts of esg (A–A’) and esg RNAi (B–B’) immunostained with dpERK (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’ and B’ (green and red). Note the increased dpERK signal in lola RNAi guts compared with control. (C–D’) Representative images of Drosophila adult midguts of MyoIA (C–C’) and MyoIA RNAi (D–D’) immunostained with dpERK (red). ECs are marked with MyoIA -GFP (green). Merged images are shown in C’ and D’ (green and red). Note the increased dpERK signal in lola RNAi guts compared with control. (E) Relative mRNA levels of EGFR ligands Spi, Krn, and Vn were analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: MyoIA (black bars) and MyoIA RNAi (red bars). Note a significant increase in the mRNA levels when lola RNAi is expressed (*p<0.05 and **p<0.01). (F–I) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 LacZ (esg LacZ) (F), esg RNAi (G), MyoIA-Gal4; tubGal80 LacZ (MyoIA LacZ) (F), and MyoIA RNAi (G) immunostained with β-gal (red). Note an increase in Upd3-LacZ levels marked by β-gal when lola RNAi is expressed in either precursors or ECs. (J–M) Representative images of Drosophila adult midguts of esg-Gal4/Stat GFP; tubGal80 (esg GFP) (J), esg RNAi (K), MyoIA-Gal4/Stat GFP; tubGal80 (MyoIA GFP) (L), and MyoIA RNAi (M) immunostained with GFP (green). Note the increased Stat-GFP signal when lola RNAi is expressed in either precursors or ECs. (N) Relative mRNA levels of JAK-STAT ligands Upd, Upd2, Upd3, and EGFR downstream gene target Socs36E were analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: MyoIA (black bars) and MyoIA RNAi (red bars). Note a significant increase in the mRNA levels when lola RNAi is expressed (*p<0.05 and **p<0.01). (O–P’’’) Representative images of Drosophila adult midguts of esg (O–O’’’), and esg RNAi (P–P’’’) immunostained with β-gal (red), Dl (magenta), and DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in O’’’, and P’’’ (green, red, magenta, and blue). Note the increase in bantam-LacZ levels marked by β-gal when lola RNAi is expressed. Scale bars: 30 μm. Data are shown as mean ± SEM. *p<0.05 and **p<0.01 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Loss of Lola activates EGFR, JAK-STAT, and microRNA bantam signaling.
(A–B’) Representative images of Drosophila adult midguts of esg (A–A’) and esg RNAi (B–B’) immunostained with dpERK (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’ and B’ (green and red). Note the increased dpERK signal in lola RNAi guts compared with control. (C–D’) Representative images of Drosophila adult midguts of MyoIA (C–C’) and MyoIA RNAi (D–D’) immunostained with dpERK (red). ECs are marked with MyoIA -GFP (green). Merged images are shown in C’ and D’ (green and red). Note the increased dpERK signal in lola RNAi guts compared with control. (E) Relative mRNA levels of EGFR ligands Spi, Krn, and Vn were analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: MyoIA (black bars) and MyoIA RNAi (red bars). Note a significant increase in the mRNA levels when lola RNAi is expressed (*p<0.05 and **p<0.01). (F–I) Representative images of Drosophila adult midguts of esg-Gal4; tubGal80 LacZ (esg LacZ) (F), esg RNAi (G), MyoIA-Gal4; tubGal80 LacZ (MyoIA LacZ) (F), and MyoIA RNAi (G) immunostained with β-gal (red). Note an increase in Upd3-LacZ levels marked by β-gal when lola RNAi is expressed in either precursors or ECs. (J–M) Representative images of Drosophila adult midguts of esg-Gal4/Stat GFP; tubGal80 (esg GFP) (J), esg RNAi (K), MyoIA-Gal4/Stat GFP; tubGal80 (MyoIA GFP) (L), and MyoIA RNAi (M) immunostained with GFP (green). Note the increased Stat-GFP signal when lola RNAi is expressed in either precursors or ECs. (N) Relative mRNA levels of JAK-STAT ligands Upd, Upd2, Upd3, and EGFR downstream gene target Socs36E were analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: MyoIA (black bars) and MyoIA RNAi (red bars). Note a significant increase in the mRNA levels when lola RNAi is expressed (*p<0.05 and **p<0.01). (O–P’’’) Representative images of Drosophila adult midguts of esg (O–O’’’), and esg RNAi (P–P’’’) immunostained with β-gal (red), Dl (magenta), and DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in O’’’, and P’’’ (green, red, magenta, and blue). Note the increase in bantam-LacZ levels marked by β-gal when lola RNAi is expressed. Scale bars: 30 μm. Data are shown as mean ± SEM. *p<0.05 and **p<0.01 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola regulates midgut homeostasis independently of Yki-Sd
We next investigate if Lola function depends on the core Yki-Sd complex. A driver of ubiquitous Actin-Gal4 combined with tub-Gal80 (Actin) was used to manipulate lolaexpression ubiquitously in a temporal manner. Real-time PCR analysis of total RNAs from Actin RNAi guts revealed no significant difference in yki mRNA levels between control and RNAi samples, suggesting that Lola does not affect yki transcription (Figure 4A). No Yki protein accumulation was detected in lola mutant gut clones, suggesting that Lola does not affect Yki protein levels either (Figure 4B–C’). Genetic interaction analysis indicated that co-expression of either yki or sd RNAi with lola RNAi in ISCs did not suppress the increase in p-H3+ cell number induced by lola RNAi alone (Figure 4D and Figure 4—figure supplement 1A–F’). Furthermore, MARCM clones of double mutant lola and yki exhibited no significant difference in clone size compared to lola (Figure 4E–H’). MARCM sd mutant clones expressing lola RNAi were similarly larger in size, suggesting that Sd depletion does not suppress lola RNAi-induced ISC proliferation (Figure 4I–L’). Taken together, these results indicate that Lola restricts ISC proliferation independently of the Yki-Sd transcriptional complex.
Figure 4.
Lola regulates midgut homeostasis independently of Yki-Sd.
(A) Relative yki mRNA levels were analyzed by real-time PCR. Total RNAs were collected from whole midguts of Actin-Gal4; tub-Gal80 (Actin) and Actin RNAi. Note that yki mRNA levels remain similar to the control when lola RNAi is expressed (ns p>0.05). (B–C’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (B–B’) and the hypomorphic allele lola clones (C–C’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Yki (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in B’ and C’ (green and red). Note that Yki protein levels are not affected in lola mutant clones. (D) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in Figure 4—figure supplement 1A–F (n = 9, 10, 10, 11, 11, 9). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (*p<0.05). Co-expression of yki or sd RNAi does not suppress the increase (ns p>0.05). (E–H’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (E–E’), yki (F–F’), the hypomorphic allele lola (G–G’), yki and lola double mutants (H–H’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in E’, F’, G’, and H’ (green and red). Note that MARCM clones of yki and lola exhibit similar size to lola. (I–L’) Representative images of Drosophila adult midgut containing GFP positive MARCM clones of control (I–I’), sd (J–J’), lola RNAi (K–K’), and sd in the presence of lola RNAi (L–L’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in I’, J’, K’, and L’ (green and red). Note that MARCM clones of sd expressing lola RNAi exhibit similar size to clones expressing lola RNAi alone. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg RNAi (B-B’), esg RNAi (C-C’), esg RNAi; lola RNAi (D-D’), esg RNAi (E-E’), and esg RNAi; lola RNAi (F-F’) immunostained with DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, D’, E’, and F’ (green and blue). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 4—figure supplement 1.
Lola regulates midgut homeostasis independently of Yki-Sd.
(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg RNAi (B-B’), esg RNAi (C-C’), esg RNAi; lola RNAi (D-D’), esg RNAi (E-E’), and esg RNAi; lola RNAi (F-F’) immunostained with DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, D’, E’, and F’ (green and blue). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola regulates midgut homeostasis independently of Yki-Sd.
(A) Relative yki mRNA levels were analyzed by real-time PCR. Total RNAs were collected from whole midguts of Actin-Gal4; tub-Gal80 (Actin) and Actin RNAi. Note that yki mRNA levels remain similar to the control when lola RNAi is expressed (ns p>0.05). (B–C’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (B–B’) and the hypomorphic allele lola clones (C–C’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Yki (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in B’ and C’ (green and red). Note that Yki protein levels are not affected in lola mutant clones. (D) Quantifications of the p-H3+ cell number in adult midguts from the indicated genotypes in Figure 4—figure supplement 1A–F (n = 9, 10, 10, 11, 11, 9). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (*p<0.05). Co-expression of yki or sd RNAi does not suppress the increase (ns p>0.05). (E–H’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (E–E’), yki (F–F’), the hypomorphic allele lola (G–G’), yki and lola double mutants (H–H’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in E’, F’, G’, and H’ (green and red). Note that MARCM clones of yki and lola exhibit similar size to lola. (I–L’) Representative images of Drosophila adult midgut containing GFP positive MARCM clones of control (I–I’), sd (J–J’), lola RNAi (K–K’), and sd in the presence of lola RNAi (L–L’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Arm and Pros (red). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in I’, J’, K’, and L’ (green and red). Note that MARCM clones of sd expressing lola RNAi exhibit similar size to clones expressing lola RNAi alone. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg RNAi (B-B’), esg RNAi (C-C’), esg RNAi; lola RNAi (D-D’), esg RNAi (E-E’), and esg RNAi; lola RNAi (F-F’) immunostained with DAPI (nuclei, blue). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, D’, E’, and F’ (green and blue). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola restricts ISC proliferation by suppressing Dref and SkpA expression levels
To further elucidate the mechanism of Lola regulating ISC proliferation and midgut homeostasis, we turn to its function as a DNA binding protein and transcriptional suppressor (Southall et al., 2014). Chromatin immunoprecipitation assay followed by high-throughput sequencing (ChIP-seq) was performed to identify genes suppressed directly by Lola. Thousands of Lola-associated chromatin binding sites were identified in cultured S2 cells. Analysis of the Lola binding profiles revealed that Lola mainly binds to the regions around transcription start sites (TSS) and promoters. Among the top 500 defined scored peaks (Supplementary file-Table 1), genes related to stem cell mitosis and differentiation were manually selected for further analysis. Results from ChIP assay and real-time PCR showed dramatic enrichment of Lola in promoter regions of Oli, ec, Dref, and 3’UTR regions of pdm3 and SkpA. No significant binding (only a basal level of binding) was detected between Lola and the non-binding region (genebody, gb) (Figure 5A). As a negative control, Lola knockdown by dsRNA significantly reduced the enrichment (Figure 5A). To validate these results in vivo, total RNAs from Actin RNAi guts were collected and analyzed. Similarly, mRNA levels of pdm3, ec, Dref, and SkpA were upregulated when reducing lolaexpression, suggesting that Lola suppresses the expression of these genes (Figure 5B). To further confirm that Lola represses the transcription of these genes, Lola binding regions (1: long and 2: short) of Dref or SkpA, two target genes among all others consistently affected by Lola, were cloned into upstream or downstream of the luciferase gene and the reporter activity was assayed. As shown in Figure 5C, activities of these reporters were dramatically inhibited by Lola but not Lola∆ZF12, a truncated form of Lola that does not bind to DNA. Activities of 3xSd luc, a dual reporter reflecting Sd-Yki transcriptional activity (Zhang et al., 2008), was not affected by Lola, demonstrating the specificity of Lola repression. In addition, Dref protein levels were significantly elevated in lola mutant clones (Figure 4D–F). In summary, these results suggest that Lola regulates the expression of Dref and SkpA, and represses their transcription.
Figure 5.
Lola restricts ISC proliferation by suppressing Dref and SkpA expression levels.
(A) Relative enrichment of Lola on binding and non-binding (genebody, gb) regions compared to IgG in control (Renilla dsRNA treated, gray and black bars) and Lola knockdown cells (lola dsRNA treated, pink and red bars) were analyzed by ChIP and real-time PCR. Note a significant increase of Lola enrichment in regions near pdm3, ec, Dref and SkpA (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001). (B) Relative mRNA levels of the indicated genes analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: Actin (black bars) and Actin RNAi (blue bars). Note a significant increase in the mRNA levels of pdm3, ec, Dref and SkpA when lola RNAi is expressed (ns p>0.05, *p<0.05, and **p<0.01). (C) Relative luciferase activity of the luciferase reporter plasmids carrying Lola-binding-region on Dref or SkpA in S2 cells transfected with the indicated constructs. The luciferase reporter plasmid with 3xSd-binding sites (3xSd luc) was used as control. (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001) (D–E’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (D–D’) and the hypomorphic allele lola (E–E’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Dref (red) and Arm and Pros (blue). White arrows indicate GFP positive clonal cells and yellow arrows indicate adjacent control cells. Merged images are shown in C’ and D’ (green, red, and blue). Note an increase on Dref protein levels in the GFP positive lola mutant clones (white arrows in E and E’). (F) Quantification of Dref expression in E. (G) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in Figure 5—figure supplement 1C–H (n = 7, 8, 8, 7, 8, 7). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). Co-expression of Dref or SkpA RNAi and lola RNAi suppresses the increase (***p<0.001). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A) Relative SkpA mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > SkpA RNAi-1 (red bar), and MS1096-Gal4 > SkpA RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when SkpA RNAi is expressed (***p<0.001). (B) Relative Dref mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > Dref RNAi-1 (red bar), and MS1096-Gal4 > Dref RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when Dref RNAi is expressed (**p<0.01). (C-H’) Representative images of Drosophila adult midguts of esg (C-C’), esg RNAi (D-D’), esg RNAi (E-E’), esg RNAi; Dref RNAi (F-F’), esg RNAi (G-G’), and esg RNAi; SkpA RNAi (H-H’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in C’, D’, E’, F’, G’, and H’ (green and red). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola restricts ISC proliferation by suppressing Dref and SkpA expression levels.
(A) Relative enrichment of Lola on binding and non-binding (genebody, gb) regions compared to IgG in control (Renilla dsRNA treated, gray and black bars) and Lola knockdown cells (lola dsRNA treated, pink and red bars) were analyzed by ChIP and real-time PCR. Note a significant increase of Lola enrichment in regions near pdm3, ec, Dref and SkpA (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001). (B) Relative mRNA levels of the indicated genes analyzed by real-time PCR. Total RNAs were collected from whole midguts of the indicated genotypes: Actin (black bars) and Actin RNAi (blue bars). Note a significant increase in the mRNA levels of pdm3, ec, Dref and SkpA when lola RNAi is expressed (ns p>0.05, *p<0.05, and **p<0.01). (C) Relative luciferase activity of the luciferase reporter plasmids carrying Lola-binding-region on Dref or SkpA in S2 cells transfected with the indicated constructs. The luciferase reporter plasmid with 3xSd-binding sites (3xSd luc) was used as control. (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001) (D–E’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (D–D’) and the hypomorphic allele lola (E–E’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Dref (red) and Arm and Pros (blue). White arrows indicate GFP positive clonal cells and yellow arrows indicate adjacent control cells. Merged images are shown in C’ and D’ (green, red, and blue). Note an increase on Dref protein levels in the GFP positive lola mutant clones (white arrows in E and E’). (F) Quantification of Drefexpression in E. (G) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in Figure 5—figure supplement 1C–H (n = 7, 8, 8, 7, 8, 7). Note a significant increase in the p-H3+ cell number when lola RNAi is expressed (***p<0.001). Co-expression of Dref or SkpA RNAi and lola RNAi suppresses the increase (***p<0.001). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 5—figure supplement 1.
Lola restricts ISC proliferation by suppressing Dref and SkpA expression levels.
(A) Relative SkpA mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > SkpA RNAi-1 (red bar), and MS1096-Gal4 > SkpA RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when SkpA RNAi is expressed (***p<0.001). (B) Relative Dref mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > Dref RNAi-1 (red bar), and MS1096-Gal4 > Dref RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when Dref RNAi is expressed (**p<0.01). (C-H’) Representative images of Drosophila adult midguts of esg (C-C’), esg RNAi (D-D’), esg RNAi (E-E’), esg RNAi; Dref RNAi (F-F’), esg RNAi (G-G’), and esg RNAi; SkpA RNAi (H-H’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in C’, D’, E’, F’, G’, and H’ (green and red). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A) Relative SkpA mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > SkpA RNAi-1 (red bar), and MS1096-Gal4 > SkpA RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when SkpA RNAi is expressed (***p<0.001). (B) Relative Dref mRNA levels were analyzed by real-time PCR. Total RNAs were collected from wing discs of MS1096-Gal4 (black bar), MS1096-Gal4 > Dref RNAi-1 (red bar), and MS1096-Gal4 > Dref RNAi-2 (blue bar). Note a significant decrease in the mRNA levels when Dref RNAi is expressed (**p<0.01). (C-H’) Representative images of Drosophila adult midguts of esg (C-C’), esg RNAi (D-D’), esg RNAi (E-E’), esg RNAi; Dref RNAi (F-F’), esg RNAi (G-G’), and esg RNAi; SkpA RNAi (H-H’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in C’, D’, E’, F’, G’, and H’ (green and red). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.To verify whether these genes are responsible for the ISC hyperproliferation induced by lola RNAi, ISC proliferation was monitored in midguts co-expressing RNAi targeting pdm3, ec, Dref or SkpA and lola. As expected, knock down of either Dref or SkpA significantly rescued the increase in GFP+ and p-H3+ cell number induced by lola RNAi (Figure 5G and Figure 5—figure supplement 1A–H’), indicating that Lola restricts ISC proliferation via regulating Dref or SkpAexpression levels. On the other hand, knock down of either Pdm3 or ec did not rescue the increased proliferative ISC number induced by lola RNAi (data not shown), indicating that these target genes might be involved in other parts of Lola function. Based on these results, we conclude that Lola functions as a transcription factor to suppress the expression of mitosis-related genes Dref and SkpA, hence controlling ISC proliferation and midgut homeostasis.
Wts interacts with lola and affects lola turnover in vitro
Given that both Lola and Wts regulate ISC proliferation, and Lola deactivates similar downstream pathways as Hippo signaling, biochemical approaches were first taken to study the relationship between Hippo signaling components and Lola in cultured S2 cells. Hippo signaling components such as Hpo, Wts, Yki, Sb, or SdBP engineered with different N-terminal epitope tags for identification (Fg-Hpo, Myc-Wts, Fg-Yki, HA-Sd, or Myc-SbBP) were co-expressed with Lola tagged with a N-terminal Flag epitope (Fg-Lola). Interestingly, Fg-Lola protein levels were significantly increased only in the presence of Myc-Wts (Figure 6A). In addition, Fg-Lola was increasingly stabilized when adding increasing amount of Myc-Wts, indicating that Wts regulates Lola protein levels in a dosage-dependent manner (Figure 6B). Furthermore, Fg-Lola protein half-life in the presence or absence of Myc-Wts was monitored using the nascent protein synthesis inhibitor cycloheximide (CHX). As shown in Figure 6C–D, Fg-Lola proteins exhibited a rapid turnover rate with a half-life of approximately 2 hr, while Myc-Wts prolonged Fg-Lola protein half-life to about 6 hr. To investigate how Lola protein stability is regulated, S2 cells expressing Fg-Lola were treated with specific UPS inhibitors (MG132 or MG101) or lysosomal inhibitors (E64 or Leupeptin) for 3 hr followed by CHX treatment for additional 6 hr. As shown in Figure 6—figure supplement 1A, UPS inhibitors, but not lysosome inhibitors, protected Fg-Lola from degradation, indicating that UPS plays a major role in regulating Lola protein stability. In addition, Lola ubiquitination levels were reduced in the presence of Wts as shown by results from the in vivo ubiquitination assay (Figure 6—figure supplement 1B). These results demonstrate that Wts regulates Lola protein stability by protecting Lola from UPS-mediated degradation, hence the possibility of Hippo signaling regulating Lola function.
Figure 6.
Wts interacts with Lola and affects Lola protein turnover.
(A) S2 cells were co-transfected with constructs expressing different Hippo components (Fg-Hpo, Myc-Wts, Fg-Yki, HA-Sd, or Myc-SbBP) and Fg-Lola. Cell extracts were collected and analyzed by Western blot with the indicated antibodies. Note that Lola protein levels were specifically modulated by Wts. (B) Collected cell extracts from S2 cells co-transfected with plasmids expressing Fg-Lola (1 μg) and Myc-Wts (0.5, 1, 1.5, and 2 ug) were analyzed by Western blot with the indicated antibodies. Plasmids expressing GFP were also added as a control. Note that Lola is stabilized by Wts in a dosage-dependent manner. (C) S2 cells were transfected with plasmids expressing Fg-Lola with or without Myc-Wts and treated with CHX for the indicated hours. Cells were harvested and analyzed by Western blot with the indicated antibodies. Note that Lola half-life extends in the presence of Wts. (D) Quantifications of results normalized to Tubulin in C. Note that Lola half-life extends from 2 to 6 hr in the presence of Myc-Wts. (E) Co-IP analysis indicates that Fg-Lola and Myc-Wts co-immunoprecipitate with each other using antibodies against either Flag or Myc. Pull-down proteins are marked by the asterisks. (F) Co-IP analysis indicates that Myc-Wts interacts with endogenous Lola using antibodies against Lola or Myc. Pull-down proteins are marked by the asterisk. (G) Relative enrichment of Lola on binding regions of SkpA and Dref compared to IgG in control (gray and black bars) and cells expressing Myc-Wts (pink and red bars) were analyzed by ChIP and real-time PCR. Note that Wts does not affect the significant increase of Lola enrichment in these regions (ns p>0.05 and *p<0.05). (H–I’’’) Representative images of Drosophila adult midguts containing GFP positive flip-out clones of hsflp; act >CD2>Gal4; UAS-Dicer2, UAS-GFP (AG4; Dcr2GFP) (H–H’’’) and AG4; Dcr2GFP >wts RNAi (I–I’’’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Lola (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate clone regions, respectively. Merged images are shown in H’’’ and I’’’ (green, red, and blue). Note a decrease in Lola protein levels in GFP positive flip-out clones expressing wts RNAi (white arrows I-I’’’). (J) Quantification of Lola expression in I. (K) Western blot analysis of gut extracts collected from adult flies with the indicated genotypes (Actin > lola, wts, lola RNAi, or wts RNAi). Note that Lola protein levels were increased when lola or wts is overexpressed. SE: short exposure. LE: long exposure. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A) S2 cells were transfected with plasmids expressing Fg-Lola and treated with UPS inhibitors (MG132 and MG101) or lysosomal inhibitors (E64 and Leupeptin) for 3 hr followed by CHX treatment for an additional 6 hr. Cells were harvested and analyzed by Western blot with the indicated antibodies. Note that CHX-induced Lola degradation was rescued upon incubation with UPS inhibitors (MG132 and MG101), but not with DMSO or lysosomal inhibitors (E64 and Leu). (B) In vivo ubiquitination assay of Lola in S2 cells. Fg-Lola was immunoprecipitated from S2 cells expressing the indicated proteins and treated with MG132, followed by Western blot with V5 antibody to detect conjugated V5-Ub. (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES were analyzed by Western blot with the indicated antibodies. (D) Representative images of S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES immunostained with Fg (green), Myc (red), and DAPI (nuclei, blue).
(A) Schematic presentation illustrating Lola (LolaFL), truncated Lola N-terminus containing the BTB domain (1–370, LolaN), and truncated Lola C-terminus containing two zinc finger domains (371–748, LolaC). (B) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaN, or Fg-LolaC and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that Wts co-immunoprecipitated with C-terminal Lola (asterisk). (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaΔZF1, Fg-LolaΔZF2, or Fg-LolaΔZF12 and Myc-Wts or Myc-WtsKD were analyzed by Co-IP with the indicated antibodies. Note that Wts-Lola interaction is independent of Wts kinase activity and Lola zinc finger domains. (D) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Yki, and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that the total amount of co-immunoprecipitated Yki and its phosphorylation levels at S168 (pYki-S168 panel) are similar in the presence or absence of Myc-Wts.
(A-B’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and the hypomorphic allele lola (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in A’’’ and B’’’ (green, red, and blue). Note a decrease in Lola protein levels in lola clones (white arrows in B’). (C-D’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and wts (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in C’’’ and D’’’ (green, red, and blue). Note a decrease in Lola protein levels in wts clones (white arrows in D’). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 6—figure supplement 1.
Wts affected Lola UPS-mediated degradation.
(A) S2 cells were transfected with plasmids expressing Fg-Lola and treated with UPS inhibitors (MG132 and MG101) or lysosomal inhibitors (E64 and Leupeptin) for 3 hr followed by CHX treatment for an additional 6 hr. Cells were harvested and analyzed by Western blot with the indicated antibodies. Note that CHX-induced Lola degradation was rescued upon incubation with UPS inhibitors (MG132 and MG101), but not with DMSO or lysosomal inhibitors (E64 and Leu). (B) In vivo ubiquitination assay of Lola in S2 cells. Fg-Lola was immunoprecipitated from S2 cells expressing the indicated proteins and treated with MG132, followed by Western blot with V5 antibody to detect conjugated V5-Ub. (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES were analyzed by Western blot with the indicated antibodies. (D) Representative images of S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES immunostained with Fg (green), Myc (red), and DAPI (nuclei, blue).
Wts interacts with Lola and affects Lola protein turnover.
(A) S2 cells were co-transfected with constructs expressing different Hippo components (Fg-Hpo, Myc-Wts, Fg-Yki, HA-Sd, or Myc-SbBP) and Fg-Lola. Cell extracts were collected and analyzed by Western blot with the indicated antibodies. Note that Lola protein levels were specifically modulated by Wts. (B) Collected cell extracts from S2 cells co-transfected with plasmids expressing Fg-Lola (1 μg) and Myc-Wts (0.5, 1, 1.5, and 2 ug) were analyzed by Western blot with the indicated antibodies. Plasmids expressing GFP were also added as a control. Note that Lola is stabilized by Wts in a dosage-dependent manner. (C) S2 cells were transfected with plasmids expressing Fg-Lola with or without Myc-Wts and treated with CHX for the indicated hours. Cells were harvested and analyzed by Western blot with the indicated antibodies. Note that Lola half-life extends in the presence of Wts. (D) Quantifications of results normalized to Tubulin in C. Note that Lola half-life extends from 2 to 6 hr in the presence of Myc-Wts. (E) Co-IP analysis indicates that Fg-Lola and Myc-Wts co-immunoprecipitate with each other using antibodies against either Flag or Myc. Pull-down proteins are marked by the asterisks. (F) Co-IP analysis indicates that Myc-Wts interacts with endogenous Lola using antibodies against Lola or Myc. Pull-down proteins are marked by the asterisk. (G) Relative enrichment of Lola on binding regions of SkpA and Dref compared to IgG in control (gray and black bars) and cells expressing Myc-Wts (pink and red bars) were analyzed by ChIP and real-time PCR. Note that Wts does not affect the significant increase of Lola enrichment in these regions (ns p>0.05 and *p<0.05). (H–I’’’) Representative images of Drosophila adult midguts containing GFP positive flip-out clones of hsflp; act >CD2>Gal4; UAS-Dicer2, UAS-GFP (AG4; Dcr2GFP) (H–H’’’) and AG4; Dcr2GFP >wts RNAi (I–I’’’). Midguts were dissected 2 days after clone induction and immunostained with antibodies against Lola (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate clone regions, respectively. Merged images are shown in H’’’ and I’’’ (green, red, and blue). Note a decrease in Lola protein levels in GFP positive flip-out clones expressing wts RNAi (white arrows I-I’’’). (J) Quantification of Lolaexpression in I. (K) Western blot analysis of gut extracts collected from adult flies with the indicated genotypes (Actin > lola, wts, lola RNAi, or wts RNAi). Note that Lola protein levels were increased when lola or wts is overexpressed. SE: short exposure. LE: long exposure. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Wts affected Lola UPS-mediated degradation.
(A) S2 cells were transfected with plasmids expressing Fg-Lola and treated with UPS inhibitors (MG132 and MG101) or lysosomal inhibitors (E64 and Leupeptin) for 3 hr followed by CHX treatment for an additional 6 hr. Cells were harvested and analyzed by Western blot with the indicated antibodies. Note that CHX-induced Lola degradation was rescued upon incubation with UPS inhibitors (MG132 and MG101), but not with DMSO or lysosomal inhibitors (E64 and Leu). (B) In vivo ubiquitination assay of Lola in S2 cells. Fg-Lola was immunoprecipitated from S2 cells expressing the indicated proteins and treated with MG132, followed by Western blot with V5 antibody to detect conjugated V5-Ub. (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES were analyzed by Western blot with the indicated antibodies. (D) Representative images of S2 cells transfected with plasmids expressing Fg-Lola, and Myc-Wts, Myc-WtsNLS or Myc-WtsNES immunostained with Fg (green), Myc (red), and DAPI (nuclei, blue).
Wts interacts with C-terminal Lola independently of Wts kinase activity and Lola zinc finger domains.
(A) Schematic presentation illustrating Lola (LolaFL), truncated Lola N-terminus containing the BTB domain (1–370, LolaN), and truncated Lola C-terminus containing two zinc finger domains (371–748, LolaC). (B) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaN, or Fg-LolaC and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that Wts co-immunoprecipitated with C-terminal Lola (asterisk). (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaΔZF1, Fg-LolaΔZF2, or Fg-LolaΔZF12 and Myc-Wts or Myc-WtsKD were analyzed by Co-IP with the indicated antibodies. Note that Wts-Lola interaction is independent of Wts kinase activity and Lola zinc finger domains. (D) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Yki, and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that the total amount of co-immunoprecipitated Yki and its phosphorylation levels at S168 (pYki-S168 panel) are similar in the presence or absence of Myc-Wts.
Wts affects Lola protein levels in vivo.
(A-B’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and the hypomorphic allele lola (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in A’’’ and B’’’ (green, red, and blue). Note a decrease in Lola protein levels in lola clones (white arrows in B’). (C-D’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and wts (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in C’’’ and D’’’ (green, red, and blue). Note a decrease in Lola protein levels in wts clones (white arrows in D’). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.To further explore possible interaction between Wts and Lola, co-immunoprecipitation (Co-IP) assays in S2 cells expressing Myc-Wts and Fg-Lola were conducted. As shown in Figure 6E, Lola and Wts reciprocally interacted, validating a physical interaction between two proteins. Co-IP analysis of S2 cells expressing Myc-Wts using the anti-Lola antibody for IP pulled down Myc-Wts, further demonstrating that Wts interacts with endogenous Lola (Figure 6F). To map which Lola region binds to Wts, two truncated Lola protein variants, each engineered with a Flag tag, were constructed: the N-terminal Lola (amino acid 1 to 370) containing the BTB domain (Fg-LolaN) and the C-terminal Lola (amino acid 371 to 748) containing the two zinc finger motifs (ZF1 and ZF2, Fg-LolaC) (Figure 6—figure supplement 2A). Co-IP results indicated that Fg-LolaC, but not Fg-LolaN, co-immunoprecipitated with Myc-Wts (Figure 6—figure supplement 2B), suggesting that Wts interacts with Lola C-terminus. Deletion of either ZF1 or ZF2 or both in Lola C-terminus did not affect binding between Wts and Lola, suggesting that Wts-Lola interaction does not require DNA binding (Figure 6—figure supplement 2A and C). Furthermore, ChIP-qPCR analysis revealed no detectable change of Lola enrichment on Dref or SkpA binding regions when co-expressing Wts in S2 cells (Figure 6G), indicating that Wts does not affect Lola-DNA binding. In toto, these results suggest that Wts interacts with Lola C-terminus independently of Lola binding to DNA.
Figure 6—figure supplement 2.
Wts interacts with C-terminal Lola independently of Wts kinase activity and Lola zinc finger domains.
(A) Schematic presentation illustrating Lola (LolaFL), truncated Lola N-terminus containing the BTB domain (1–370, LolaN), and truncated Lola C-terminus containing two zinc finger domains (371–748, LolaC). (B) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaN, or Fg-LolaC and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that Wts co-immunoprecipitated with C-terminal Lola (asterisk). (C) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Fg-LolaΔZF1, Fg-LolaΔZF2, or Fg-LolaΔZF12 and Myc-Wts or Myc-WtsKD were analyzed by Co-IP with the indicated antibodies. Note that Wts-Lola interaction is independent of Wts kinase activity and Lola zinc finger domains. (D) Collected cell extracts from S2 cells transfected with plasmids expressing Fg-Lola, Yki, and Myc-Wts were analyzed by Co-IP with the indicated antibodies. Note that the total amount of co-immunoprecipitated Yki and its phosphorylation levels at S168 (pYki-S168 panel) are similar in the presence or absence of Myc-Wts.
Given that Wts is a Serine/Threonine protein kinase, we next sought to determine if Lola is a Wts substrate and phosphorylated by Wts. Surprisingly, Lola exhibited no shift in molecular weight when analyzed by the phos-tag gels (Figure 6E), suggesting that Wts interacts with Lola in a manner independent of phosphorylation. To further validate this conclusion, a construct expressing Wts KD (WtsK743R, a kinase dead form of Wts) (Lai et al., 2005) was generated. Not only that Wts KD interacted with Lola by Co-IP (Figure 6—figure supplement 2C), Wts KD stabilized Lola similarly as the wild-type Wts (data not shown). These results suggest that Wts kinase activity is not essential for binding to Lola and does not affect Lola protein stability. On the other hand, previous studies have suggested that Wts interacts and phosphorylates Yki (Goulev et al., 2008; Huang et al., 2005; Oh and Irvine, 2008). In our hands, both total amount and the S168 phosphorylation level of Yki co-immunoprecipitated with Wts remained unaffected in the presence or absence of Fg-Lola, suggesting that Wts-Lola interaction does not affect Wts-Yki interaction and Wts-mediated Yki phosphorylation (Figure 6—figure supplement 2D). Taken together, these results demonstrate that Wts binds to Lola directly to moderate its turnover rate, a process independent of Wts kinase activity, Lola DNA binding, Wts-Yki interaction, and Wts-mediated Yki phosphorylation.It is noteworthy to mention that both Wts and Lola proteins have been predicted to contain the nuclear export signal (NES) (http://www.cbs.dtu.dk/services/NetNES/) and the nuclear localization signal (NLS) (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi), indicating that Wts possibly localizes to the nucleus in addition to the cytoplasm, whereas Lola localizes to the cytoplasm in addition to the nucleus. Our results showed that expression of Wts fused with a C-terminal nuclear localization signal (NLS) (WtsNLS) caused a remarkable increase in Lola protein levels, suggesting that WtsNLS stabilizes Lola in the nucleus (Figure 6—figure supplement 1C–D), whereas the expression of Wts fused with a C-terminal nuclear export signal (NES) (WtsNES) only reduced the increased Lola protein levels partially (Figure 6—figure supplement 1C–D), suggesting the possibility of Lola translocating to cytoplasm where it is protected by Wts. These results indicate that Wts interacts with Lola both in the cytoplasm and nucleus.
Wts regulates lola protein levels in vivo
In addition to our evidence that Wts interacts with and stabilizes Lola in S2 cells, endogenous Lola protein levels were examined using antibodies against Lola. Immunostainings showed that Lola is ubiquitously expressed in all cell types in the midgut and absent in the lola MARCM clones (Figure 6—figure supplement 3A–B’’’). Consistent with the cell culture data, a dramatic decrease in the anti-Lola staining was also detected in both flip-out clones expressing wts RNAi using the driver hsflp; act >CD2>Gal4; UAS-Dicer2, UAS-GFP (AG4; Dcr2GFP > wts RNAi) and wts MARCM clones in midguts (Figure 6H–J and Figure 6—figure supplement 3C–D’’’). Furthermore, endogenous Lola protein levels were analyzed by Western blot using gut extracts that ubiquitously express lola, lola RNAi, wts, or wts RNAi. Similar to lola overexpression, wts overexpression increased Lola protein levels (Figure 6K). Collectively, these results indicate that Wts regulates Lola protein levels in vivo.
Figure 6—figure supplement 3.
Wts affects Lola protein levels in vivo.
(A-B’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and the hypomorphic allele lola (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in A’’’ and B’’’ (green, red, and blue). Note a decrease in Lola protein levels in lola clones (white arrows in B’). (C-D’’’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’’’) and wts (B-B’’’) immunostained with Lola (red) and DAPI (nuclei, blue). Merged images are shown in C’’’ and D’’’ (green, red, and blue). Note a decrease in Lola protein levels in wts clones (white arrows in D’). Scale bars: 30 μm. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola is essential for Wts-mediated ISC proliferation and midgut homeostasis
Based on the results that Wts modulates Lola protein stability and Lola is required for midgut homeostasis, genetic interaction between Wts and Lola in regulating midgut homeostasis was analyzed. Whereas reduced ykiexpression did not rescue the increase in the GFP+ and p-H3+ cell number induced by esg RNAi (Figure 1A–E), lola overexpression dramatically reduced this increase (Figure 7A and Figure 7—figure supplement 1A–D’). Similar reduction was detected in midguts expressing lola and wts RNAi in ECs (MyoIA > lola; wts RNAi, Figure 7—figure supplement 1E). These results indicate that lola overexpression blocks the hyperproliferation induced by wts RNAi both cell-autonomously and non-cell-autonomously. To further validate our observation, expressing lola in GFP+wts MARCM clones that exhibited the overgrowth phenotype dramatically reduced the clone size (Figure 7B–F). On the other hand, wts overexpression in lola MARCM clones did not affect the increased clone size (Figure 7—figure supplement 2A–D). Taken together, these results suggest that Lola is essential for Wts function in midgut homeostasis.
Figure 7.
Lola is essential for Wts-mediated ISC proliferation and midgut homeostasis.
(A) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in Figure 7—figure supplement 1A–F (n = 18, 21, 19, 20, 18, 19). Note that co-expression of lola, Dref RNAi, or SkpA RNAi in the presence of wts RNAi suppresses the increase in the p-H3+ cell number (ns p>0.05, *p<0.05, and ***p<0.001). (B–E’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (B–B’), wts (C–C’), lola (D–D’), and wts in the presence of lola (E–E’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in B’, C’, D’, and E’ (green and blue). Note a decrease in the wts clone size in the presence of lola. (F) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in B-E at 2, 4, and 6 days after clone induction (***p<0.001). Average of 29–92 clones from 10 midguts for each genotype were quantified. (G) Heatmap of 2116 union DEGs in adult guts carrying genotypes: Actin, Actin > yki, Actin > lola RNAi, and Actin > wts RNAi. A decrease and an increase in expression is indicated by blue and red color, respectively. Note a high degree of similarity in the DEG expression profiles for lola and wts RNAi. (H) An illustrated model on Drosophila midgut homeostasis regulated by the Wts-Lola-Dref/SkpA signaling axis. Wts interacts with Lola and regulates its stability. In the absence of Lola, ISC undergoes hyperproliferation due to de-repression of Dref and SkpA expression levels. Yki and Lola regulate different target gene expression levels, thereby controlling midgut homeostasis via separate means. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A-D’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg RNAi (C-C’), and esg RNAi (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes: MyoIA, MyoIA, MyoIA RNAi, MyoIA RNAi, MyoIA RNAi, Dref RNAi, and MyoIA RNAi, SkpA RNAi (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001) (n = 9, 11, 8, 10, 8, 10). Note that co-expression of lola and wts RNAi suppresses the increase in the p-H3+ cell number (***p<0.001). (F) Relative mRNA levels of the indicated genes were analyzed by real-time PCR. Total RNAs were collected from the control (black bars) and wts (red bars) clonal guts. Note a significant increase in the mRNA levels of Dref and SkpA in wts clonal samples (p=0.0352, 0.0382). An increase in the EGFR ligand Vn and the JAK-STAT ligand Upd3 is also shown as positive controls (p=0.00112, 0.00447). (G-H’) Representative images of Drosophila adult midguts of esg RNAi, Dref RNAi (G-G’) and esg RNAi, SkpA RNAi (H-H’) immunostained with Arm and Pros (red). Merged images are shown in G’ and H’ (green and red). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A-C’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’), lola (B-B’), and lola in the presence of wts (C-C’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Arm and Pros (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in A’, B’, and C’ (green, red, and blue). (D) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in A-C 4 days after clone induction (ns p>0.05, ***p<0.001). Average of 107–162 clones from 10 midguts for each genotype were quantified. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg >lola (C-C’), and esg (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A-D (n = 6, 6, 7, 9). Note that co-expression of lola and yki does not suppress the increase in the p-H3+ cell number induced by yki overexpression (ns p>0.05). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 7—figure supplement 1.
Lola is essential for Wts-mediated midgut homeostasis.
(A-D’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg RNAi (C-C’), and esg RNAi (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes: MyoIA, MyoIA, MyoIA RNAi, MyoIA RNAi, MyoIA RNAi, Dref RNAi, and MyoIA RNAi, SkpA RNAi (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001) (n = 9, 11, 8, 10, 8, 10). Note that co-expression of lola and wts RNAi suppresses the increase in the p-H3+ cell number (***p<0.001). (F) Relative mRNA levels of the indicated genes were analyzed by real-time PCR. Total RNAs were collected from the control (black bars) and wts (red bars) clonal guts. Note a significant increase in the mRNA levels of Dref and SkpA in wts clonal samples (p=0.0352, 0.0382). An increase in the EGFR ligand Vn and the JAK-STAT ligand Upd3 is also shown as positive controls (p=0.00112, 0.00447). (G-H’) Representative images of Drosophila adult midguts of esg RNAi, Dref RNAi (G-G’) and esg RNAi, SkpA RNAi (H-H’) immunostained with Arm and Pros (red). Merged images are shown in G’ and H’ (green and red). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Figure 7—figure supplement 2.
Lola is essential for Wts-mediated midgut homeostasis.
(A-C’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’), lola (B-B’), and lola in the presence of wts (C-C’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Arm and Pros (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in A’, B’, and C’ (green, red, and blue). (D) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in A-C 4 days after clone induction (ns p>0.05, ***p<0.001). Average of 107–162 clones from 10 midguts for each genotype were quantified. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola is essential for Wts-mediated ISC proliferation and midgut homeostasis.
(A) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in Figure 7—figure supplement 1A–F (n = 18, 21, 19, 20, 18, 19). Note that co-expression of lola, Dref RNAi, or SkpA RNAi in the presence of wts RNAi suppresses the increase in the p-H3+ cell number (ns p>0.05, *p<0.05, and ***p<0.001). (B–E’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (B–B’), wts (C–C’), lola (D–D’), and wts in the presence of lola (E–E’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in B’, C’, D’, and E’ (green and blue). Note a decrease in the wts clone size in the presence of lola. (F) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in B-E at 2, 4, and 6 days after clone induction (***p<0.001). Average of 29–92 clones from 10 midguts for each genotype were quantified. (G) Heatmap of 2116 union DEGs in adult guts carrying genotypes: Actin, Actin > yki, Actin > lola RNAi, and Actin > wts RNAi. A decrease and an increase in expression is indicated by blue and red color, respectively. Note a high degree of similarity in the DEG expression profiles for lola and wts RNAi. (H) An illustrated model on Drosophila midgut homeostasis regulated by the Wts-Lola-Dref/SkpA signaling axis. Wts interacts with Lola and regulates its stability. In the absence of Lola, ISC undergoes hyperproliferation due to de-repression of Dref and SkpAexpression levels. Yki and Lola regulate different target gene expression levels, thereby controlling midgut homeostasis via separate means. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola is essential for Wts-mediated midgut homeostasis.
(A-D’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg RNAi (C-C’), and esg RNAi (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes: MyoIA, MyoIA, MyoIA RNAi, MyoIA RNAi, MyoIA RNAi, Dref RNAi, and MyoIA RNAi, SkpA RNAi (ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001) (n = 9, 11, 8, 10, 8, 10). Note that co-expression of lola and wts RNAi suppresses the increase in the p-H3+ cell number (***p<0.001). (F) Relative mRNA levels of the indicated genes were analyzed by real-time PCR. Total RNAs were collected from the control (black bars) and wts (red bars) clonal guts. Note a significant increase in the mRNA levels of Dref and SkpA in wts clonal samples (p=0.0352, 0.0382). An increase in the EGFR ligand Vn and the JAK-STAT ligand Upd3 is also shown as positive controls (p=0.00112, 0.00447). (G-H’) Representative images of Drosophila adult midguts of esg RNAi, Dref RNAi (G-G’) and esg RNAi, SkpA RNAi (H-H’) immunostained with Arm and Pros (red). Merged images are shown in G’ and H’ (green and red). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, *p<0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.(A-C’) Representative images of Drosophila adult midguts containing GFP positive MARCM clones of control (A-A’), lola (B-B’), and lola in the presence of wts (C-C’). Midguts were dissected 4 days after clone induction and immunostained with antibodies against Arm and Pros (red) and DAPI (nuclei, blue). Areas enclosed by the dashed lines indicate respective clone size. Merged images are shown in A’, B’, and C’ (green, red, and blue). (D) Quantifications of the cell number per clone in adult midguts from the indicated genotypes in A-C 4 days after clone induction (ns p>0.05, ***p<0.001). Average of 107–162 clones from 10 midguts for each genotype were quantified. Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Lola and Yki regulate the midgut homeostasis in different means.
(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg >lola (C-C’), and esg (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A-D (n = 6, 6, 7, 9). Note that co-expression of lola and yki does not suppress the increase in the p-H3+ cell number induced by yki overexpression (ns p>0.05). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.Furthermore, Dref and SkpA mRNA levels were also elevated in wts clonal midguts (Figure 7—figure supplement 1F). Genetic interaction analysis between wts and Dref or SkpA showed that co-expression of SkpA or Dref RNAi in wts RNAi midguts dramatically reduced the increase in the GFP+ and p-H3+ cell number (Figure 7A, Figure 7—figure supplement 1E and G–H’), indicating that SkpA and Dref are both required for Wts function in midgut homeostasis. These results support our hypothesis that Wts stabilizes Lola such that SkpA and Dref expressions are transcriptionally suppressed, thereby restricting ISC proliferation.Finally, RNA sequencing (RNA-seq) analysis using RNAs isolated from adult guts expressing wts RNAi, lola RNAi or yki using Actin identified a collection of 2116 differentially expressed genes (DEGs), using the R package DESeq2 (padj <0.05) (Figure 7G, Supplementary file 2) (Love et al., 2014). Based on the DEG heatmap and hierarchical cluster analysis, a high degree of similarity was detected between samples from wts and lola RNAi, suggesting strong functional correlation between Wts and Lola, but not Yki and Lola, in regulating midgut homeostasis. On the other hand, lola overexpression did not rescue the elevated GFP+ and p-H3+ cell number induced by yki overexpression (Figure 7—figure supplement 3A–E), reinforcing the notion that Lola restricts ISC proliferation in an Yki-independent manner. Taken together, these results suggest that while Wts regulates Lola and Yki in different means, Lola are functionally similar with Wts. Yki and Lola regulate the expression of different target genes, and direct different transcription programs in the process of Hippo-mediated ISC proliferation and midgut homeostasis (Figure 7H).
Figure 7—figure supplement 3.
Lola and Yki regulate the midgut homeostasis in different means.
(A-F’) Representative images of Drosophila adult midguts of esg (A-A’), esg (B-B’), esg >lola (C-C’), and esg (D-D’) immunostained with Arm and Pros (red). ISCs and EBs are marked with esg-GFP (green). Merged images are shown in A’, B’, C’, and D’ (green and red). (E) Quantifications of the p-H3+ cell number in adult midguts with the indicated genotypes in A-D (n = 6, 6, 7, 9). Note that co-expression of lola and yki does not suppress the increase in the p-H3+ cell number induced by yki overexpression (ns p>0.05). Scale bars: 30 μm. Data are shown as mean ± SEM. ns p>0.05, **p<0.01, and ***p<0.001 by Student’s T-test. At least 10 midguts were dissected for each genotype. Confocal images were taken from the basal layer of the midgut where ISCs can be clearly visualized. Single layer image is shown.
Discussion
Mechanisms that regulate Drosophila midgut homeostasis and regeneration are complex and under a series of delicate controls. The Hippo pathway, which output is mainly transduced by the effector Yki-Sd complex, has been shown to be crucial for both midgut homeostasis and regeneration. In the present study, we identify a novel transcription factor Lola acting downstream of Hippo signaling to restrict ISC proliferation. The Hippo component Wts interacts with and stabilizes Lola in a Yki-independent manner. Lola then suppresses downstream Dref and SkpAexpression levels to regulate ISC proliferation. Our results suggest that Lola is an effector of a non-canonical Hippo signaling pathway essential for ISC proliferation and midgut homeostasis (Figure 7H).
Lola is a new player in Hippo-mediated ISC proliferation and midgut homeostasis
Our present findings suggest that Lola regulates ISC proliferation and midgut homeostasis. Reduced lolaexpression in both ISCs and ECs promotes ISC proliferation, indicating that Lola functions both cell-autonomously and non-cell-autonomously. These precursors remain correctly differentiated when Lola is absent, suggesting that Lola only affects ISC proliferation, but not differentiation. Similarly, inactivation of Hippo signaling also causes enhanced ISC proliferation, indicating the possibility that Lola functions downstream of Hippo. Consistent to the characterized phenotype for Hippo signaling inactivation, downregulating lolaexpression in ECs activates EGFR and JAK-STAT signaling, and Lola regulates Hippo downstream bantamexpression levels in ISCs. Taken together, these results suggest that Lola regulates ISC proliferation and homeostasis likely via mechanisms involving Hippo signaling.Our biochemical results strongly support that Lola is a Hippo component. Not only that Lola interacts with and is stabilized by Wts, our in vivo analysis of ISC proliferation also indicates that lola overexpression rescues the enhanced ISC proliferation induced upon Wts depletion, a phenotype not affected by Yki. These findings indicate that Lola functions downstream of Hippo signaling via interaction with Wts. In addition, four lines of evidence suggest that Lola functions independently of the Yki-Sd complex: first, yki mRNA and protein levels are not affected by Lola, suggesting that yki is not a Lola transcriptional target. Genetic interaction analysis also shows that neither Yki nor Sd suppresses the enhanced ISC proliferation induced by lola RNAi. Next, RNA-seq transcriptional profiles of samples expressing lola RNAi strongly correlate with the ones expressing wts RNAi, but not the ones expressing yki, indicating that Yki and Lola work downstream of Wts to mediate different outputs in terms of regulating ISC proliferation. Furthermore, Lola-Wts interaction does not affect Wts-Yki binding and Wts-mediated Yki phosphorylation, suggesting Wts regulates Yki and Lola via separate means. Finally, co-expression of lola and yki does not rescue the enhanced ISC proliferation induced by yki overexpression, indicating that Lola and Yki work independently from each other. These results demonstrate that Lola is a novel effector of Hippo signaling in regulating ISC proliferation and midgut homeostasis; Lola functions by interacting with Wts and in a manner independent of the Yki-Sd complex.
Mechanisms of Lola-mediated ISC proliferation and midgut homeostasis
As a transcriptional suppressor, it is intriguing to speculate that Lola regulates downstream gene expression by suppressing their transcription levels, hence affecting ISC proliferation. Using ChIP-seq analysis and luciferase reporter assays, two distinct gene targets of Lola were identified: Dref and SkpA. Lola enrichment was detected on the Dref promoter and the 3’UTR region of SkpA, respectively, indicating that the repression modes of Lola on Dref and SkpA are different. Transcription of these two genes are also directly repressed by lola. Downregulation of Dref or SkpAexpression in gut precursors expressing either wts or lola RNAi rescues the enhanced ISC proliferation, providing the genetic evidence that Lola regulates ISC proliferation vis suppressing Dref and SkpAexpression. Wts-mediated ISC proliferation also requires Lola and its downstream transcription targets Dref and SkpA. Moreover, co-expression of Dref RNAi and yki does not rescue the enhanced ISC proliferation induced by yki overexpression, reconfirming the Yki-independent mechanism of Lola repressing Dref/SkpA signaling in regulating ISC proliferation and midgut homeostasis (data not shown).
Wts regulates lola stability
Due to its important role in ISC proliferation and midgut homeostasis, Lola protein levels are expected to be under precise and delicate controls. Interestingly, Wts physically interacts with Lola and Lola protein levels are regulated by Wts both in vitro and in vivo. It has been proposed that Wts and Mats colocalize in the cytoplasm or at the cell cortex, thereby restricting Yki in the cytoplasm (Dong et al., 2007; Oh and Irvine, 2008; Sun et al., 2015). Exceptions have been reported, however, that activated LATS1/2 (Wts in mammals) is accumulated in the nucleus, where it phosphorylates YAP (Yki in mammals) (Li et al., 2014). Based on these observations, it is feasible to speculate that Wts translocates to the nucleus and interacts with Lola, therefore regulating Lola protein stability. Our cell culture data further indicate a possibility of Lola translocation into the cytoplasm, and Wts interacts with Lola both in cytoplasm and nucleus. Despite the possibility of Wts translocation into the nucleus (or Lola translocation into the cytoplasm), Wts is unlikely to regulate Lola stability via phosphorylation, an event happened for Yki in the cytoplasm based on our results that Wts kinase activity is not required for Wts-Lola interaction. Furthermore, Wts-Lola interaction is independent of Wts-Yki interaction and Wts-mediated Yki phosphorylation, demonstrating that Wts controls Yki and Lola activity via separate and distinct mechanisms.Our biochemical results provide further insights on possible mechanisms of how Wts controls Lola stability. Wts interacts with the C-terminal Lola, where the DNA binding zinc finger motifs reside. Deletion of zinc finger motifs does not affect Wts-Lola binding, nor Wts affects Lola enrichment on Dref or SkpA binding regions. These results suggest that Wts-Lola interaction and Lola binding to DNA are two independent events. Wts possibly interacts with Lola at the C-terminus in regions outside of the zinc finger motifs, structuring conformational changes which indirectly affect interaction between proteins and other parts of Lola such as the N-terminal BTB domain. It has been shown that BTB domain-containing proteins serve as both a linker and substrate adaptor within the Cul3-based E3 ligases (Furukawa et al., 2003; Geyer et al., 2003; Pintard et al., 2004). Proteins containing either the Leucine-rich repeats (LRR) or WD40 domain, such as the F-box protein in the SCF E3 complex, have been shown to mediate the degradation of BTB domain substrate adaptor (Wimuttisuk et al., 2014). Interestingly, our results indicate that Lola is degraded via a UPS-dependent mechanism and its ubiquitination is affected by the presence of Wts. Based on these findings, it is possible that Wts-Lola interaction modulates the interaction between Lola and other LRR or WD40-containing proteins, hence preventing Lola ubiquitination and degradation by the UPS system.
Hippo-Lola signaling in normal midgut homeostasis
During stress or injury-induced regeneration, ISCs rapidly proliferate in order to replenish the cell loss in a short time (Amcheslavsky et al., 2009; Buchon et al., 2009a; Buchon et al., 2010; Buchon et al., 2009b). Abundant evidence has suggested that Yki is a central Hippo effector in the regeneration process. Not only that Yki protein levels and transcription levels of Hippo downstream target genes are upregulated during regeneration, loss of Yki in either precursors or ECs blocks DSS- or infection-induced ISC proliferation, respectively. yki overexpression also leads to activation of EGFR and JAK-STAT signaling pathways (Karpowicz et al., 2010; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010). These results suggest that Yki and Hippo signaling are important for midgut regeneration.Unlike regeneration, normal midgut homeostasis only requires a basal level of cell turnover and ISCs proliferate to a minimum extent to maintain the need (Antonello et al., 2015; Jiang et al., 2011). During normal condition, Hippo signaling restricts ISC proliferation, thus serving an inhibitory role in regulating ISC proliferation and midgut homeostasis. Inactivation of Wts or Hpo, similarly as yki overexpression, leads to inactivation of Hippo signaling, thus enhancing ISC proliferation (Karpowicz et al., 2010; Ren et al., 2010; Shaw et al., 2010; Staley and Irvine, 2010). Nonetheless, Yki inactivation does not affect ISC proliferation, raising the argument that Yki is not as prominently needed in midgut homeostasis as in regeneration. Conserved and similarly in mammals, depletion of Yki homologs YAP1 and/or TAZ protein in the intestine does not affect normal homeostasis, indicating that YAP1 (Barry et al., 2013; Cai et al., 2010; Camargo et al., 2007) and TAZ (Azzolin et al., 2014) might be dispensable under normal conditions. Our results that Lola mediates ISC proliferation via non-canonical Hippo signaling resolve the argument by supporting a complementary yet equally important role for Lola during Hippo-mediated ISC proliferation and midgut homeostasis. Upstream components might trigger Hippo signaling via controlling Wts protein levels instead of Wts phosphorylation, hence regulating Lola stability. Whereas Yki is critically needed during injury-induced regeneration, Lola plays a more fundamental and maintenance role during homeostasis, a process that Yki is dispensable. Collectively, our work uncovers a novel mechanism that Hippo regulates ISC proliferation via Lola-mediated non-canonical downstream signaling; Hippo-Lola signaling controls ISC basal proliferation and midgut homeostasis, whereas Yki in the canonical Hippo signaling controls rapid ISC proliferation during regeneration.In the present study, we uncover a novel transcription factor Lola that functions downstream of Hippo signaling in regulating Drosophila midgut homeostasis. During normal homeostasis and maintenance, the Wts-Lola-Dref/SkpA signaling axis serves as a critical mediator restricting ISC proliferation, adding another layer of complexity in the regulatory mechanism of ISC proliferation. Considering the importance of Hippo signaling in intestinal diseases and tumorigenesis, our findings provide new insights on developing potential biomarkers or strategies of therapeutic targets for anti-cancer research.
Materials and methods
Plasmids and cloning
The full length lola DNA fragment (lola-RD: 2247 bp) was amplified from Drosophila cDNA (BDGP DGC clone LD28033) by PCR. LolaN and C are truncated lola variants with 1–1110 bp and 1111–2247 bp, respectively. Lola ∆ZF1, ∆ZF2, and ∆ZF12 are truncated lola variants deleting 1435–1498 bp, 1525–1596 bp, and 1435–1596 bp, respectively. For expression in S2 cells and flies, the DNA fragments mentioned above were cloned in frame with the Flag-tag in the pUAST-Fg vector according to the standard protocols. The NLS and NES sequences were listed as follow:NLS: 5’-CCTAAGAAGAAGAGGAAGGTT-3’NES: 5’-CTTCAGCTACCACCGCTTGAGAGACTTACTCTT-3’
Drosophila Stocks and Genetics
The fly stocks used in this study are listed in the Key Resources Table.
Temperature-controlled expression
The experiment using esg-Gal4/UAS-GFP; tubGal80 and MyoIA-Gal4/UAS-GFP; tubGal80 were crossed and cultured at 18°C to restrict Gal4 activity. The F1 adult flies were shifted to 29°C for 5 days to induce transgene expression. 10 female adult flies at least were dissected for each genotype, followed by immunostaining, microscopy, and statistical analysis.
MARCM clonal analysis
GFP positive mutant clones were generated using the MARCM system. Flies were crossed and raised at 25°C, F1 adult flies with designated genotypes were subjected to heat shock at 37°C for 1 hr and then cultured at 25°C or 18°C for days specified before dissection. Clones of more than 10 midguts were analyzed in each group.
Immunohistochemistry
All immunostaining experiments were done on midguts of female flies. The guts were dissected and fixed in 4% formaldehyde (Sigma) for 1 hr and washed three times in PBS supplemented with 0.1% Triton X-100 (PBS-T). The guts were incubated in the primary antibody diluted in PBS-T overnight at 4°C, followed by three washes with PBS-T. After incubation with a second antibody at room temperature for 1 hr, midguts were washed for 3 times and mounted in PBS/glycerol medium with DAPI. Primary antibodies used in this study are listed in the Key Resources Table.
Microscopy and statistical analysis
Fluorescent microscopy was performed on a Leica LAS SP8 confocal microscope; confocal images were obtained using the Leica AF Lite system. Confocal images from the basal layer of the posterior midguts (sub-region R5a, https://flygut.epfl.ch/overview) where ISCs can be clearly visualized were taken under 40 × objective. Single layer image is shown. The quantification of p-H3+ cell per guts was undertaken by counting the p-H3+ cell numbers over the whole gut of indicated genotypes. The p-H3+ cell number quantification data were statistically present as average with the standard error of mean (SEM) and p-values of significance is calculated by Student’s T-test (tails = 2, Two-sample unequal variance): * is p<0.05, ** is p<0.01, *** is p<0.001, ns is no significance with p>0.05.To quantify the expression of indicated protein in Figure 5 and Figure 6, the intensity of the indicated proteins and GFP signal in the view region was analyzed using the Leica AF Lite system. For each group, 50 (GFP−) of which were quantified as wild type and 50 (GFP+) were quantified as lola or wts. The quantification data were statistically present as average with the standard error of mean (SEM) and p-values of significance is calculated by Student’s T-test (tails = 2, Two-sample unequal variance): * is p<0.05, ** is p<0.01, *** is p<0.001, ns is no significance with p>0.05.
Real-time PCR
Total RNAs were extracted from 10 midguts of 5-day-old female flies or 20 wing discs from third-instar larvae with indicated genotypes using Trizol Reagent (Invitrogen), and the cDNAs were synthesized using ReverTra Ace synthesis kit (Toyobo). Real-time PCR was performed using the SYBR Green Real-time PCR Master Mix (Toyobo) reagent with the ABI7500 System. Results were repeated for three independent biological replicates. RpL32 was used as a normalized control. The RT-PCR data were statistically present as average with the standard error of mean (SEM) and p-values of significance were calculated by Student’s T-test (tails = 2, Two-sample unequal variance) in Excel: * is p<0.05, ** is p<0.01, *** is p<0.001, ns is no significance with p>0.05.
Cell line
S2Drosophila cells from ATCC Ref: CRL-1963 were used. The identity has been athenticated (STR profiling). No mycoplasm contamination.
Cell culture, Transfection, Immunoprecipitation, Ubiquitination assay, Western blot and immunostaining
S2 cells were cultured in Drosophila Schneider’s Medium (Invitrogen) with 10% fetal bovine serum, 100 U/ml of penicillin, and 100 mg/ml of Streptomycin. Plasmid transfection was carried out using X-tremeGENE HP DNA Transfection Reagent (Sigma) according to manufacturer’s instructions. A ubiquitin-Gal4 construct and the indicated constructs (cloned into pUAST expression vectors) were co-transfected for all transfection experiments. CHX (50 mg/ml, Sigma) was used to inhibit nascent protein synthesis. MG132 (50 mg/ml, Sigma) and MG-101 (50 mg/ml, Sigma) were used to inhibit the UPS activity. E64 (50 mM; Sigma) and Leupeptin (50 mM; Sigma) were used to inhibit lysosome function. Immunoprecipitation, Ubiquitination assay, Western blot and immunostaining were performed according to standard protocols as previously described (Guo et al., 2013; Zhang et al., 2008; Zhang et al., 2006).
RNA interference in S2 Drosophila cells
For RNAi in S2 cells, primers were designed as follows: Renilla-dsRNA-F (use as control) (5’- taatacgactcaatagggatgacgtvaaaagtttac −3’); Renilla-dsRNA-R (use as control) (5’- taatacgactcaatagggagactacatccggtttacc −3’); lola-dsRNA-F (5’- taatacgactcaatagggatggatgacgatcagcagtt −3’); lola-dsRNA-R (5’- taatacgactcaatagggcggctgccggtccgctggac −3’).PCR reactions were used as templates for in vitro RNA production (in vitro Transcription T7 kit, Takara), and RNAs were purified using isopropyl-alcohol. dsRNAs were then annealed (68°C for 10 min and 37°C for 30 min). To perform knockdown experiment, S2 cells were diluted into 1 × 106 cells ml−1 with serum free medium for 1 hr starvation with 15 μg dsRNA.
ChIP
ChIP assays were performed using S2 cells. Cells were cross-linked for 15 min at 37°C in 1 ml of 1% formaldehyde in PBS buffer. The cross-linking was stopped by adding Glycine to a final concentration of 0.125M. Next, fixed cells were washed for 10 min in 1 ml ice-cold PBS for three times. Cells were sonicated in 1 ml sonication buffer (50 mM Hepes-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, pH 8.0, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and proteinase cocktail) with a Bioruptor sonicator. The sonication yielded genomic DNA fragments with an average size of about 200 bp. After centrifugation, lysates were incubated with 4 μg antibody for 4 hr (or overnight); 40 μl protein A/G PLUS agarose (Santa Cruz) was then added and incubated for another 4 hr (or overnight) on a rotator at 4°C. Beads were washed three times with the ChIP wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, pH 8.0, 150 mM NaCl, and 20 mM Tris-Cl, pH 8.0), and then washed again with ChIP final wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, pH 8.0, 500 mM NaCl, and 20 mM Tris-Cl, pH 8.0). Genomic DNA was eluted with elution buffer (1% SDS and 100 mM NaHCO3) at 65°C for 30 min. 5 M NaCl was added to a final concentration of 200 mM for further incubation at 65°C for 4 hr (or overnight). Then, 0.5 M EDTA and 20 mg/ml proteinase K were added until their final concentrations were 5 mM and 0.25 mg/ml, respectively. The resulted mixture was incubated at 55°C for 2 hr to digest the protein. Genomic DNA was purified with a DNA purification kit (QIAGEN) and subjected to high throughput sequencing or real-time PCR.The ChIP-seq data were deposited in the Gene Expression Omnibus (accession number GSE136999). The list of top 500 peaks of Lola ChIP-seq profile is shown in Supplementary file 1 in detail.
Luciferase reporter assay
To generate the Dref-luc-1 or Dref-luc-2 reporter genes, 2 DNA segments covering Lola-binding region of Dref were subcloned between BglII and KpnI sites of the pGL3-Promoter vector (Dref-luc-1: −304 to +43, Dref-luc-2: −211 to −3), respectively. For SkpA-luc-1 or SkpA-luc-2, 2 DNA segments covering Lola-binding region of SkpA were subcloned downstream of the luciferaser gene into the BamHI site of the pGL3-Promoter vector (SkpA-luc-1: +1384 to +1716, SkpA-luc-2: +1458 to +1604), respectively.For luciferase reporter assays, S2 cells were transfected with indicated reporters and copia-renilla luciferase reporter constructs in 24 well plate together with Fg-Lola or Fg-Lola∆ZF12 expressing constructs. Cells were incubated for 48 hr after transfection. The reporter assay was performed using the Dual-Luciferase reporter assay system (Promega). Dual-Luciferase measurements were performed in triplicate using GloMax-Multi JR Single-Tube Multimode Reader. The DLR data were statistically present as average with the standard error of mean (SEM) and p-values of significance is calculated by Student’s T-test (tails = 2, Two-sample unequal variance) in Excel: * is p<0.05, ** is p<0.01, *** is p<0.001, ns is no significance with p>0.05.
RNA-seq and statistical analysis
The transcriptomes were generated by RNA sequencing (RNA-seq) analysis using RNAs isolated from adult guts expressing wts RNAi, lola RNAi or yki using Actin. 30 midguts dissected from indicated genotypes incubated for 5 days at 29°C were dissected to extract total RNAs per sample for RNA-Seq experiment.After assessing RNA quality with Agilent Bioanalyzer, mRNAs were enriched by poly-A pull-down from total RNA samples (3 ug mRNA per sample, RIN >7 required). Then, sequencing libraries constructed with Illumina TruSeq Stranded mRNA Sample Prep Kit were sequenced using Illumina HiSeq X ten. We sequenced about 26M paired-end 150 bp reads for each sample.After quality check with fastqc (version 0.11.8), we mapped the reads to an index of Drosophila melanogaster reference genome (BDGP6) using Hisat2 (version 2.1.0) (Kim et al., 2015). Then we converted sam files to bam files with samtools (version 1.9; Li et al., 2009). The aligned reads were assigned to genes using annotations from Ensembl (Drosophila_melanogaster.BDGP6.94.gtf) and HTseq-count (version 0.11.2) (Anders et al., 2015). The differentially expressed genes (DEGs) were identified using R package DESeq2 (version 1.25.12) (Love et al., 2014). Compared with the control group, genes with padj (adjusted p-value, corrected p-value after Multiple Comparisons by method 'BH' which DESeq2 provided)<0.05 were defined as DEGs. The union of all the DEGs from 3 groups of samples emerged into a cellection of 2116 DEGs.The heatmap of the DEGs and hierarchical cluster analysis were employed to examine the correlation of gene expression pattern from indicated samples. We converted gene counts to Z-score to center and scaled the numeric matrix by R generic function ‘scale’. The R package ComplexHeatmap (version 1.20.0) was used to draw the heatmap of the DEGs’ expression from indicated samples (Gu et al., 2016). We used euclidean method to calculate distance between these two vectors in Hierarchical cluster analysis, and ward.D2 is used as the agglomeration method.The raw RNA-seq data was deposited in the Sequence Read Archive (accession number SRP220236). The expression of 2116 DEGs indicated by reads counts of the RNA-seq profiles are shown in Supplementary file 2.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:The role of canonical Hippo signaling in restricting intestinal stem cell (ISC) proliferation is well established, but whether and how the non-canonical Hippo signaling is involved in ISC basal proliferation is less well-defined. This paper breaks new ground in identifying Lola as a transcription factor that acts as a non-canonical Hippo pathway component to restrict ISC proliferation independently of Yki-Sd. The findings are significant and add to the current knowledge of non-canonical Hippo signaling and will be appreciated in the intestinal stem cell and Hippo signaling fields.Decision letter after peer review:Thank you for submitting your article "Lola regulates Drosophila adult midgut homeostasis via non-canonical Hippo signaling" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Utpal Banerjee as the Senior Editor.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The reviewers were generally enthusiastic for this manuscript. It breaks new ground in identifying Lola as a transcription factor in a non-canonical Hippo signaling pathway However there were concerns raised by all three and in particular reviewer 3 that need to be addressed in the full revision as noted below:Summary:The role of canonical Hippo signaling in restricting intestinal stem cell (ISC) proliferation is well established, but whether and how the non-canonical Hippo signaling is involved in ISC basal proliferation are less well-defined.In this paper, Hao et al. identify transcription factor Lola that acts as a non-canonical Hippo pathway component to restrict intestinal stem cell (ISC) proliferation independently of Yki-Sd, restricting ISC proliferation cell autonomously in the ISC and also non-cell-autonomously in the EC. Lola is stabilized by Warts (Wts) through direct protein-protein interactions. Lola rescues the enhanced ISC proliferation caused by Wts reduction or deletion by suppressing Dref and SkpAexpression. The findings are significant and add to the current knowledge of non-canonical Hippo signaling. The data are of high quality, obtained by elegant experiments and implicate Lola as a non-canonical Hippo signaling component maintaining fly midgut homeostasis. These novel findings will be appreciated in the intestinal stem cell and Hippo signaling fields.However a number of major concerns were raised which need to be addressed. One concern relates to the biological significance of Lola in controlling Hippo pathway outputs. Another concern relates to the lack of experiments showing in vivo regulation, in the gut, of endogenous Lola by Wts.Essential revisions:The authors should address the two major issues identified by the reviewers summarized below and in the detailed major comments:1) Interaction between Wts and Lola.As the authors demonstrate, Warts stabilizes Lola independent of Warts' kinase activity. In this context, Lola's activity is largely dependent upon the protein levels of Warts rather than its activity. However, much work on the Hippo kinase cascade (Hippo on/off) shows that Warts activity is mainly regulated by phosphorylation/dephosphorylation, without changes in protein levels. Given this, physiologically, it seems that the upstream regulators in the Hippo pathway that control ISC proliferation probably don't act through Lola. What types of regulation do act through Lola? How does Wts regulates Lola stability? Is Lola ever seen in the cytoplasm or is Warts ever seen in the nucleus? Where does the biochemical interaction between Wrts and Lola take place?Although it is recognized that the whole pathway cannot be resolved in a single paper, going a bit further in the molecular mechanism would increase the impact of the presented work. The authors should consolidate the data on the interaction between Wts and Lola to provide a mechanistic view and address the detailed comments of the reviewers on this point by performing the experiments asked on this. The transcriptional role of Lola should also be documented.2) in vivo regulation of endogenous Lola by Wts.The reviewers raise the need to provide more convincing data that Hippo signaling really regulates endogenous Lola in vivo. The experiments (Figures 5, 6) all rely on overexpressed Lola acting as a dominant repressor of proliferation, and the interpretation of the results could be wrong (Lola might repress anything in this format). The connection between Lola and Wts (or Hippo signaling in general) in this cellular context and that this is how Hippo regulates ISC proliferation should be clarified. The case will be strengthened by trying another approach such as the reverse – overexpress Wts and testing to see if it's suppressive effect can be bypassed with loss of Lola.Reviewer #1:I only have one major question for the authors. How does Wts regulates Lola stability?Other comment:In Figure 1B, D, E, Yki RNAi further increased cell proliferation caused by wts RNAi. The authors should provide some explanation.Reviewer #2:Several issues need to be addressed prior to publication and proper quantification are required for several figures. Moreover, some images need improvement and the Materials and methods section needs to be further developed.Several conclusions are drawn from knock down experiments with no direct validation of the efficiency of the RNAi transgenes. Could the authors provide molecular data/references on this?Subsection “Lola restricts ISC proliferation by suppressing Dref and SkpAexpression levels”. Lola is supposed to work as a transcriptional repressor, hence the KD of its targets is expected to rescue the phenotype induced by lola KD. This is not the case for all of them, could the authors explain this result? Also, it is puzzling that one of the targets tested functionally shows ChIP enrichment in the 3'UTR (SkpA). A direct assay for the transcriptional control of Lola (at least on this gene) would validate the hypothesis of the authors, they could for example perform transfection assays in S2 cells.Since a key message of the manuscript is that Wrts stabilizes Lola, Is Lola ever seen in the cytoplasm or is Warts ever seen in the nucleus? Where does the biochemical interaction between Wrts and Lola take place? Although the whole pathway cannot be resolved in a single paper, going a bit further in the molecular mechanism would increase the impact of the presented work.Reviewer #3:One major concern relates to the biological significance of Lola in controlling Hippo pathway outputs. As the authors demonstrate, Warts stabilizes Lola independent of Warts' kinase activity. In this context, Lola's activity is largely dependent upon the protein levels of Warts rather than its activity. However, much work on the Hippo kinase cascade (Hippo on/off) shows that Warts activity is mainly regulated by phosphorylation/dephosphorylation, without changes in protein levels. Given this, physiologically, it seems that the upstream regulators in the Hippo pathway that control ISC proliferation probably don't act through Lola. What types of regulation do act through Lola is not addressed in this paper. Another big problem is that there aren't really any good experiments showing in vivo regulation, in the gut, of endogenous Lola by Wts. The experiments (Figures 5, 6) all rely on overexpressed Lola acting as a dominant repressor of proliferation, and the interpretation of the results could be wrong (Lola might repress anything in this format). So, while the work on Lola is good, the connection between Lola and Wts (or Hippo signaling in general) in this cellular context is not demonstrated in a convincing way.Specific points follow below:1) Although knockdown of Yki in ISCs doesn't change the basal level of ISC proliferation, silencing Yki in ISCs does suppress the stress-induced proliferative response (Ren et al., 2010; Shaw et al., 2010). This indicates that Yki is essential in ISCs for regenerative proliferation. To demonstrate that Lola is functionally as relevant as Yki in ISCs, the authors could test if overexpression of Lola in ISCs also represses stress-induced proliferation (e.g. P.e infection or DSS treatment).2) Although the genetic data shows that co-expression of SkpA or Dref RNAi in esg>wtsRNAi midguts dramatically reduced the increase of ISC mitosis (Figure 6A), to solidly demonstrate that Warts-Lola-Dref/SkpA is a linear pathway, the authors need to sort out (FACS sorting technique) the GFP+-progenitor cells from the "esgGFP>wtsRNAi" guts and run qPCR to check if Dref/SkpA are transcriptionally upregulated by Wts-KD.3) Is overexpression of Dref /SkpA in ISCs (autonomous role) or ECs (non-autonomous role) sufficient to trigger ISC mitosis?4) EGFR ligands and Upd1,2,3 are upregulated upon Lola-KD in ECs (Figure 2—figure supplement 2). These genes have been demonstrated to be regulated by the canonical Hippo/Yki pathway in ECs upon stress conditions. Given this, the authors should clarify if these genes' upregulation is Yki-dependent or not. In addition, the authors show that esg>LolaRNAi upregulates Bantam, which is a classical Yki target. So, what is the Yki's function in this context? Please explain.5) Following the above question, it is well known that apoptotic ECs will generate Upd2/3 to promote gut regeneration. The authors need to clarify whether LolaRNAi in ECs promotes ISC mitosis through a specific signaling pathway, or just through triggering non-specific EC apoptosis (Myo1Ats> LolaRNAi, DCP-1 or Caspase-3 staining is recommended).6) As noted above, the data in Figure 5 and 6 don't really establish that endogenous Lola is regulated by Wts in ISCs. This is a major shortcoming of the paper. This could be addressed by overexpressing Wts, to see if it can counteract Lola-RNAi to suppress ISC proliferation. If it can, well then Wts probably has other targets that regulate ISC proliferation. As noted above, it would also be helpful to show data on endogenous Lola protein (not detected in Figure 5I), and epistasis experiments where Lola DNA binding and effects on transcriptional targets were tested.7) Figure 6A is a nice dataset that positions Dref/SkpA at the downstream of Wts. But, it would be better to perform these epistasis tests using Myo1Ats as well.Essential revisions:The authors should address the two major issues identified by the reviewers summarized below and in the detailed major comments:1) Interaction between Wts and Lola.As the authors demonstrate, Warts stabilizes Lola independent of Warts' kinase activity. In this context, Lola's activity is largely dependent upon the protein levels of Warts rather than its activity. However, much work on the Hippo kinase cascade (Hippo on/off) shows that Warts activity is mainly regulated by phosphorylation/dephosphorylation, without changes in protein levels. Given this, physiologically, it seems that the upstream regulators in the Hippo pathway that control ISC proliferation probably don't act through Lola. What types of regulation do act through Lola? How does Wts regulates Lola stability? Is Lola ever seen in the cytoplasm or is Warts ever seen in the nucleus? Where does the biochemical interaction between Wrts and Lola take place?Although it is recognized that the whole pathway cannot be resolved in a single paper, going a bit further in the molecular mechanism would increase the impact of the presented work. The authors should consolidate the data on the interaction between Wts and Lola to provide a mechanistic view and address the detailed comments of the reviewers on this point by performing the experiments asked on this. The transcriptional role of Lola should also be documented.To address these questions, new data have been added to the revised manuscript and details were given below point-by-point to each reviewer’s comment.2) in vivo regulation of endogenous Lola by Wts.The reviewers raise the need to provide more convincing data that Hippo signaling really regulates endogenous Lola in vivo. The experiments (Figures 5, 6) all rely on overexpressed Lola acting as a dominant repressor of proliferation, and the interpretation of the results could be wrong (Lola might repress anything in this format). The connection between Lola and Wts (or Hippo signaling in general) in this cellular context and that this is how Hippo regulates ISC proliferation should be clarified. The case will be strengthened by trying another approach such as the reverse – overexpress Wts and testing to see if it's suppressive effect can be bypassed with loss of Lola.Experiments using a second reverse approach by overexpressing wts in lola mutant clones have been done. Please see below for detailed responses and also revision in the manuscript.Reviewer #1:I only have one major question for the authors. How does Wts regulates Lola stability?Our evidence suggests that Wts interacts with Lola C-terminus. This interaction potentially causes conformational changes which indirectly affect interaction between proteins and other parts of Lola such as the N-terminal BTB domain. It has been shown that BTB domain-containing proteins serve as both a linker and substrate adaptor within the Cul3-based E3 ligases (Furukawa et al., 2003; Geyer et al., 2003; Pintard, Willems, and Peter, 2004). Proteins containing either the Leucine-rich repeats (LRR) or WD40 domain, such as the F-box protein in the SCF E3 complex, mediate the degradation of BTB domain substrate adaptor (Wimuttisuk et al., 2014). Interestingly, our results suggest that Lola is degraded via UPS-dependent (SCF complex-dependent) mechanism and that its ubiquitination is moderately abolished in the presence of Wts (Figure 6—figure supplement 1A-B in the revised manuscript). Based on these findings, it is possible that Wts-Lola interaction modulates the interaction between Lola and other LRR or WD40-containing proteins, hence preventing Lola ubiquitination and degradation by UPS.Multiple upstream signals integrate to activate the Hippo pathway. Despite that Hippo signaling mainly transduces via triggering Wts phosphorylation (Udan et al., 2003; Wu et al., 2003), previous studies indicate that some upstream components regulate the Hippo signaling by controlling Wts protein levels. The atypical cadherin Fat (Ft) (Cho et al., 2006), the atypical myosin Dachs (D) together with the LIM domain protein Zyxin (Zyx) (Rauskolb et al., 2011), and the tumor suppressor gene Scribble (Scrib) (Verghese et al., 2012) function as components of the Hippo pathway via regulating Wts stability. It is possible that these upstream components signal through Wts protein level to control Lola stability for downstream ISC proliferation.Regarding where the Wts-Lola interaction takes place, both Wts and Lola proteins have been predicted to contain the nuclear export signal (NES) (http://www.cbs.dtu.dk/services/NetNES/) (la Cour et al., 2004) and the nuclear localization signal (NLS) (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi) (Kosugi et al., 2009), respectively. These results indicate that Wts possibly localizes to the nucleus in addition to the cytoplasm, whereas Lola localizes to the cytoplasm in addition to the nucleus (Author response image 1). Our cell culture results indicate that Wts affects Lola stability both in the cytoplasm and the nucleus. An NLS or NES sequence was added to the wts 3’ end to drive Wts entry to or exit out of the nucleus, respectively. Western blot analysis indicated that the WtsNLS expression caused a remarkable increase in Lola protein levels, suggesting that WtsNLS stabilizes Lola in the nucleus (Figure 6—figure supplement 1C in the revised manuscript). Immunostaining results also revealed a diffuse pattern of Lola colocalizing with WtsNLS in the nucleus (Figure 6—figure supplement 1D in the revised manuscript). In contrast, WtsNES expression did not cause such colocalization pattern in the nucleus and only diminished the increase of Lola protein levels partially (Figure 6—figure supplement 1C, D in the revised manuscript), suggesting the possibility of Lola translocation to the cytoplasm where it is protected by Wts. Taken together, these results suggest that Wts interacts with Lola both in the cytoplasm and the nucleus.
Author response image 1.
These results have been added to the revised manuscript and discussed in the Discussion section.Other comment:In Figure 1B, D, E, Yki RNAi further increased cell proliferation caused by wts RNAi. The authors should provide some explanation.We thank the reviewer for the comments. To accurately analyze the difference on cell proliferation between wts RNAi alone and wts RNAi + yki RNAi, we increased the sample size for each genotype. A more detailed analysis showed that there is no statistical significance between results from these two samples. These new results were shown in Figure 1E in the revised manuscript.Reviewer #2:Several issues need to be addressed prior to publication and proper quantification are required for several figures. Moreover, some images need improvement and the Materials and methods section needs to be further developed.We thank the reviewer for the comments. New quantifications have been made for Figure 1F-H’, Figure 5D-E’, Figure 6G-H’’, and images in Figure 1F-H’, Figure 7G have been improved. The DrosophilaStocks and Genetics, Microscopy and Statistical Analysis, and RNA-seq and Statistical Analysis sections in the Materials and methods section have been revised. Please see the revised manuscript and figures, also throughout different sections in this response letter.Several conclusions are drawn from knock down experiments with no direct validation of the efficiency of the RNAi transgenes. Could the authors provide molecular data/references on this?The efficiencies of RNAi lines for wts, lola, Dref, and SkpA have been verified by qPCR. As shown in Author response image 2, the expression levels of these genes were efficiently repressed. We have added the references of several RNAi transgenes in the Key Resources Table in the Materials and methods section.
Author response image 2.
Subsection “Lola restricts ISC proliferation by suppressing Dref and SkpAexpression levels”. Lola is supposed to work as a transcriptional repressor, hence the KD of its targets is expected to rescue the phenotype induced by lola KD. This is not the case for all of them, could the authors explain this result? Also, it is puzzling that one of the targets tested functionally shows ChIP enrichment in the 3'UTR (SkpA). A direct assay for the transcriptional control of Lola (at least on this gene) would validate the hypothesis of the authors, they could for example perform transfection assays in S2 cells.To address reviewer’s concern, luciferase reporter assays have been performed. lola binding regions of Dref or SkpA (1: long, 2: short) were cloned into the reporter, among them the SkpA 3’UTR region was cloned to the C-terminus. Our results showed that transcription activities of these reporters were repressed in the presence of Lola, while the dual reporter activity reflecting Sd-Yki transcription 3xSd luc (Zhang et al., 2008) was not affected. Expression of Lola lacking the DNA binding zinc finger regions (Fg-Lola∆ZF12) did not cause repression. These results showed that Dref and SkpA are under Lola transcriptional control and directly repressed by Lola. These results were shown in Figure 5C in the revised manuscript.Since a key message of the manuscript is that Wrts stabilizes Lola, Is Lola ever seen in the cytoplasm or is Warts ever seen in the nucleus? Where does the biochemical interaction between Wrts and Lola take place? Although the whole pathway cannot be resolved in a single paper, going a bit further in the molecular mechanism would increase the impact of the presented work.Similar questions have been raised by reviewer 1. Please see below for our response:Regarding where the Wts-Lola interaction takes place, both Wts and Lola proteins have been predicted to contain the nuclear export signal (NES) (http://www.cbs.dtu.dk/services/NetNES/) and the nuclear localization signal (NLS) (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi), respectively. These results indicate that Wts possibly localizes to the nucleus in addition to the cytoplasm, whereas Lola localizes to the cytoplasm in addition to the nucleus (Author response image 1). Our cell culture results indicate that Wts affects Lola stability both in the cytoplasm and the nucleus. An NLS or NES sequence was added to the wts 3’ end to drive Wts entry to or exit out of the nucleus, respectively. Western blot analysis indicated that the WtsNLS expression caused a remarkable increase in Lola protein levels, suggesting that WtsNLS stabilizes Lola in the nucleus (Figure 6—figure supplement 1C in the revised manuscript). Immunostaining results also revealed a diffuse pattern of Lola colocalizing with WtsNLS in the nucleus (Figure 6—figure supplement 1D in the revised manuscript). In contrast, WtsNES expression did not cause such colocalization pattern in the nucleus and only diminished the increase of Lola protein levels partially (Figure 6—figure supplement 1C, D in the revised manuscript), suggesting the possibility of Lola translocation to the cytoplasm where it is protected by Wts. Taken together, these results suggest that Wts interacts with Lola both in the cytoplasm and the nucleus.Reviewer #3:One major concern relates to the biological significance of Lola in controlling Hippo pathway outputs. As the authors demonstrate, Warts stabilizes Lola independent of Warts' kinase activity. In this context, Lola's activity is largely dependent upon the protein levels of Warts rather than its activity. However, much work on the Hippo kinase cascade (Hippo on/off) shows that Warts activity is mainly regulated by phosphorylation/dephosphorylation, without changes in protein levels. Given this, physiologically, it seems that the upstream regulators in the Hippo pathway that control ISC proliferation probably don't act through Lola. What types of regulation do act through Lola is not addressed in this paper. Another big problem is that there aren't really any good experiments showing in vivo regulation, in the gut, of endogenous Lola by Wts. The experiments (Figures 5, 6) all rely on overexpressed Lola acting as a dominant repressor of proliferation, and the interpretation of the results could be wrong (Lola might repress anything in this format). So, while the work on Lola is good, the connection between Lola and Wts (or Hippo signaling in general) in this cellular context is not demonstrated in a convincing way.Specific points follow below:1) Although knockdown of Yki in ISCs doesn't change the basal level of ISC proliferation, silencing Yki in ISCs does suppress the stress-induced proliferative response (Ren et al., 2010; Shaw et al., 2010). This indicates that Yki is essential in ISCs for regenerative proliferation. To demonstrate that Lola is functionally as relevant as Yki in ISCs, the authors could test if overexpression of Lola in ISCs also represses stress-induced proliferation (e.g. P.e infection or DSS treatment).We thank the reviewer for the suggestion. lola overexpression in ISCs represses DSS-induced proliferation as shown by Author response image 3. This piece of evidence indicates that Lola is functionally as relevant as Yki in ISCs. However, despite the repression, the fact that lola overexpression artificially increases Lola protein levels might have led to repression in any format.
Author response image 3.
2) Although the genetic data shows that co-expression of SkpA or Dref RNAi in esgts>wtsRNAi midguts dramatically reduced the increase of ISC mitosis (Figure 6A), to solidly demonstrate that Warts-Lola-Dref/SkpA is a linear pathway, the authors need to sort out (FACS sorting technique) the GFP+-progenitor cells from the "esgtsGFP>wtsRNAi" guts and run qPCR to check if Dref/SkpA are transcriptionally upregulated by Wts-KD.According to the reviewer’s suggestion, the GFP+-progenitor cells were sorted by FACS analysis and qPCR analysis was conducted. As shown in Author response image 4, esg driven wts RNAi expression resulted in a knockdown efficiency of about 40% and only Dref mRNA levels was significantly upregulated. While results from the wts clonal guts in the manuscript exhibited a 50% reduction in wtsexpression, a more apparent increase in the Dref/SkpA mRNA levels was detected.
Author response image 4.
3) Is overexpression of Dref /SkpA in ISCs (autonomous role) or ECs (non-autonomous role) sufficient to trigger ISC mitosis?According to the reviewer’s suggestion, the numbers of p-H3+ cells were analyzed when overexpressing Dref/SkpA in ISCs or ECs. As shown in Author response image 5, neither Dref nor SkpA overexpression is sufficient to activate ISC proliferation. It is possible that other factors downstream of Lola are required to function together with Dref/SkpA in regulating ISC proliferation.
Author response image 5.
4) EGFR ligands and Upd1,2,3 are upregulated upon Lola-KD in ECs (Figure 2—figure supplement 2). These genes have been demonstrated to be regulated by the canonical Hippo/Yki pathway in ECs upon stress conditions. Given this, the authors should clarify if these genes' upregulation is Yki-dependent or not. In addition, the authors show that esgts>LolaRNAi upregulates Bantam, which is a classical Yki target. So, what is the Yki's function in this context? Please explain.We thank the reviewer for the suggestion. mRNA levels of EGFR ligands and Upd1,2,3 were analyzed when expressing lola RNAi alone or lola + yki RNAi. Reducing ykiexpression partially decreased the elevated mRNA levels of these ligands (Author response image 6A). We also examined the transcriptional level of microRNA bantam. As shown in Author response image 6B-D’’’, elevated bantamexpression levels upon Lola depletion were also partially affected, but not the expansion of ISC population. These results suggest that Yki might be moderately involved in EGFR and JAK-STAT signaling activation upon Lola depletion.
Author response image 6.
5) Following the above question, it is well known that apoptotic ECs will generate Upd2/3 to promote gut regeneration. The authors need to clarify whether LolaRNAi in ECs promotes ISC mitosis through a specific signaling pathway, or just through triggering non-specific EC apoptosis (Myo1Ats> LolaRNAi, DCP-1 or Caspase-3 staining is recommended).We thank the reviewer for the suggestion. According to our results on Caspase-3 staining (Author response I mage 7), lacking lola in ECs does not trigger non-specific EC apoptosis.6) As noted above, the data in Figure 5 and 6 don't really establish that endogenous Lola is regulated by Wts in ISCs. This is a major shortcoming of the paper. This could be addressed by overexpressing Wts, to see if it can counteract Lola-RNAi to suppress ISC proliferation. If it can, well then Wts probably has other targets that regulate ISC proliferation. As noted above, it would also be helpful to show data on endogenous Lola protein (not detected in Figure 5I), and epistasis experiments where Lola DNA binding and effects on transcriptional targets were tested.We thank the reviewer for the comments. First, the effect of wts overexpression has been analyzed in lola MARCM clones (Figure 7—figure supplement 2 in the revised manuscript). Interestingly, wts overexpression does not suppress ISC proliferation induced by lola mutant, indicating that endogenous Lola is regulated by Wts in ISCs. Next, despite that it is difficult to detect endogenous Lola protein by WB analysis due to the nature of the antibodies, a faint but distinct band was detected in Figure 6J (long exposure). Furthermore, endogenous Lola protein levels decreased in wts mutant clones (Figure 6—figure supplement 3C-D’’’) or when wts RNAi is expressed (Figure 6G-I), indicating that endogenous Lola proteins are under Wts regulation.Finally, lola transcription regulation on Dref/SkpA has been tested. Not only that target gene expression levels increased upon lola RNAi expression, direct repression was also detected using luciferase reporter assays. Furthermore, results from epistatic genetic interaction analysis showed that either Dref or SkpA RNAi expression rescues lola RNAi-induced ISC proliferation (Figure 5 and Figure 5—figure supplement 1 in the revised manuscript).Taken together, these results demonstrate the endogenous Lola regulation by Wts in ISCs.7) Figure 6A is a nice dataset that positions Dref/SkpA at the downstream of Wts. But, it would be better to perform these epistasis tests using Myo1Ats as well.Thank you for the suggestion. We performed these epistasis experiments using Myo1A. Co-expression of Dref or SkpA RNAi dramatically inhibited the hyperproliferation induced by wts RNAi (Author response image 8). Together with results from experiments using esg, it is concluded that Dref/SkpA functions downstream of Wts both cell-autonomously and non-cell-autonomously. These results have been added to Figure 7—figure supplement 1E in the revised manuscript.
Author response image 8.
la Cour, T., Kiemer, L., Mølgaard, A., Gupta, R., Skriver, K., Brunak, S. (2004). Analysis and prediction of leucine-rich nuclear export signalsProtein Eng. Des. Sel., 17(6):527-36Kosugi S., Hasebe M., Tomita M., and Yanagawa H. (2009) Systematic identification of yeast cell cycle-dependent nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc. Natl. Acad. Sci. USA 106, 10171-10176
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Gene (Drosophila melanogaster)
lola
FBgn0283521
Cell line (Drosophila melanogaster)
S2
ATCC
ATCC CRL-1963 RRID:CVCL_Z232
Genetic reagent (Drosophila melanogaster)
UAS-lola RNAi
Vienna Drosophila Resource Center
VDRC12574
Genetic reagent (Drosophila melanogaster)
UAS-lola RNAi
Vienna Drosophila Resource Center
VDRC12573
Genetic reagent (Drosophila melanogaster)
UAS-lola RNAi
Fly Stocks of National Institute of Genetics
NIG12052 R-1
Genetic reagent (Drosophila melanogaster)
FRT42Dlola5D2
Bloomington Drosophila Stock Center, PMID: 8050351
Bloomington #28266
Genetic reagent (Drosophila melanogaster)
UAS-wts RNAi
Vienna Drosophila Resource Center, PMID: 21666802
VDRC9928
Genetic reagent (Drosophila melanogaster)
UAS-wts RNAi
Bloomington Drosophila Stock Center, PMID: 23989952
Bloomington #34064
Genetic reagent (Drosophila melanogaster)
UAS-wtsEPG4808
Bloomington Drosophila Stock Center, PMID: 21278706
Bloomington #30099
Genetic reagent (Drosophila melanogaster)
FRT82Bwtsx1
PMID: 7743921
Genetic reagent (Drosophila melanogaster)
FRT42DykiB5
PMID: 16096061
Genetic reagent (Drosophila melanogaster)
UAS-yki RNAi
PMID: 16096061
Genetic reagent (Drosophila melanogaster)
UAS-yki
PMID: 16096061
Genetic reagent (Drosophila melanogaster)
FRT19Asd∆B1
PMID: 18258485
Genetic reagent (Drosophila melanogaster)
UAS-sd RNAi
PMID: 18258485
Genetic reagent (Drosophila melanogaster)
UAS-Dref RNAi
Vienna Drosophila Resource Center
VDRC22209
Genetic reagent (Drosophila melanogaster)
UAS-Dref RNAi
Bloomington Drosophila Stock Center
Bloomington #31941
Genetic reagent (Drosophila melanogaster)
UAS-SkpA RNAi
Bloomington Drosophila Stock Center
Bloomington #32870
Genetic reagent (Drosophila melanogaster)
UAS-SkpA RNAi
Bloomington Drosophila Stock Center
Bloomington #32991
Genetic reagent (Drosophila melanogaster)
MS1096-Gal4; UAS-Dicer2
PMID: 10557210
Genetic reagent (Drosophila melanogaster)
esg-Gal4/UAS-GFP; tubGal80ts
PMID: 16340959
Genetic reagent (Drosophila melanogaster)
MyoIA-Gal4/UAS-GFP; tubGal80ts
PMID: 16340959
Genetic reagent (Drosophila melanogaster)
MyoIA-Gal4; tubGal80ts
a gift from Rongwen Xi, National Institute of Biological Sciences, Beijing, China
Genetic reagent (Drosophila melanogaster)
Upd3-LacZ
a gift from Rongwen Xi
Genetic reagent (Drosophila melanogaster)
bantam-lacZ
PMID: 18258485
Genetic reagent (Drosophila melanogaster)
Stat-GFP
PMID: 17008134
Genetic reagent (Drosophila melanogaster)
hsflp[122]; act > CD2>Gal4; UAS-Dicer2, UAS-GFP
PMID: 9428512
Genetic reagent (Drosophila melanogaster)
UAS-lola
This paper
generated by microinjection
Antibody
anti-Delta (mouse monoclonal)
DSHB
Cat# c594.9b, RRID:AB_528194
IF (1:100)
Antibody
anti-Prospero (mouse monoclonal)
DSHB
Cat# Prospero (MR1A), RRID:AB_528440
IF (1:2000)
Antibody
anti- Arm (mouse monoclonal)
DSHB
Cat# N2 7A1 ARMADILLO, RRID:AB_528089
IF (1:500)
Antibody
anti-p-H3 (rabbit polyclonal)
Cell Signaling
Cat# 9701, RRID:AB_331535
IF (1:2000)
Antibody
anti-dpERK (rabbit monoclonal)
Cell Signaling
Cat# 4370, RRID:AB_2315112
IF (1:1000)
Antibody
anti-β-gal (rabbit polyclonal)
Thermo Fisher
Cat# A-11132, RRID:AB_221539
IF (1:500)
Antibody
anti-Phalloidin-TRITC
PMID: 28242614
IF (1:20000)
Antibody
anti- Cleaved Caspase-3 (rabbit polyclonal)
Cell Signaling
Cat# 9661, RRID:AB_2341188
IF (1:100)
Antibody
anti-Pdm1
a gift from Xiaohang Yang, Zhejiang University, China
IF (1:500)
Antibody
anti-Dref
a gift from Masamitsu Yamaguchi, Kyoto Institute of Technology, Japan
IF (1:100)
Antibody
anti-Yki
PMID: 23999857
IF (1:100) produced by immunizing rabbits with the Yki peptide of amino acids 180–418
Antibody
anti-Lola
This paper
IF (1:100) produced by immunizing rabbits with the peptide of Lola amino acids 1–467
Authors: Wei Li; Jonathan Cooper; Lu Zhou; Chenyi Yang; Hediye Erdjument-Bromage; David Zagzag; Matija Snuderl; Marc Ladanyi; C Oliver Hanemann; Pengbo Zhou; Matthias A Karajannis; Filippo G Giancotti Journal: Cancer Cell Date: 2014-07-14 Impact factor: 31.743