Literature DB >> 31929695

Co occurrence of two 16S rRNA methyltrasferases along with NDM and OXA 48 like carbapenamases on a single plasmid in Klebsiella pneumoniae.

K V L Aishwarya1, P V Geetha1, M Shanthi1, S Uma1.   

Abstract

BACKGROUND: The carbapenemase-encoding genes, blaNDM- and blaOXA-48 - like, confer resistance to all the known beta-lactams and are encountered along with other beta-lactamase-encoding genes and/or 16S ribosomal RNA (rRNA)-methylating genes. The co-occurrence of blaNDM and blaOXA-48 - like on a single plasmid is a rare occurrence. AIM AND
OBJECTIVE: The purpose of the study was to characterize the plasmids in Klebsiella pneumoniae isolates producing 16S rRNA methyltransferase along with blaNDM , blaOXA-48-like , and other resistance encoding genes.
MATERIALS AND METHODS: One-hundred and seventeen K. pneumoniae clinical isolates which were resistant to aminoglycosides were collected. Polymerase chain reaction-based screening for 16S rRNA methyltransferase genes armA, rmtB, and rmtC; carbapenamase genes blaNDM , blaOXA-48-like , blaIMP, blaVIM, and blaKPC ; and other resistance genes such as blaTEM, blaSHV, blaCTX-M, and qnr (A, B, and S) determinants acc (6') Ib-cr was performed. Conjugation experiment was carried out for seven isolates that anchored blaNDM and blaOXA-48-like along with any one of the 16S rRNA methyltransferases. The plasmid-based replicon typing for different plasmid-incompatible (Inc) group was performed on the conjugatively transferable plasmids.
RESULTS: Among the 16S rRNA methyltransferases, armA was more predominant. blaNDM and blaOXA-48 -like were present in 56 (47.86%) and 22 (18.80%) isolates, respectively. Out of seven isolates which were conjugatively transferable, only four had blaNDM and blaOXA-48 - like on the same plasmid and they belonged to Inc N and A/C replicon. Three isolates co-harbored 16S rRNA methyltransferases armA, rmtB, and rmtC, and out of the them, one isolate harbored two 16S rRNA methyltransferases armA and rmtB, on the single-plasmid replicon A/C.
CONCLUSION: This is the first report revealing the coexistence of blaNDM and blaOXA-48 - like co-harboring two 16S rRNA methylases on a single conjugative plasmid replicon belonging to incompatibility group A/C. Copyright:
© 2019 Journal of Laboratory Physicians.

Entities:  

Keywords:  16S ribosomal RNA methyltransferase; A/C replicon; Klebsiella pneumoniae; blaNDM; blaOXA-48 like; co-harboring

Year:  2019        PMID: 31929695      PMCID: PMC6943864          DOI: 10.4103/JLP.JLP_59_19

Source DB:  PubMed          Journal:  J Lab Physicians        ISSN: 0974-2727


Introduction

Aminoglycosides are highly potent broad-spectrum antibiotics with desirable properties for treating life-threatening infections. The resistance mechanisms exhibited by bacteria against aminoglycoside are as follows: (1) acquired lipid modification that makes the cell wall impermeable; (2) aminoglycoside-modifying enzymes that modify the antibiotic at specific sites, making it inactive; and (3) active expulsion of the drug by efflux mechanism. A novel mechanism of resistance to aminoglycoside was first discovered in 2003 in Pseudomonas and Enterobacteriaceae,[12] in which the aminoglycoside-binding site is modified enzymatically by 16S ribosomal RNA (rRNA) methyltransferase, commonly known as RMTases. The 16S methyltransferases which are intrinsically found in both Streptomyces spp. and Micromonospora spp. have now been identified in other bacteria as a result of the uptake of a plasmid containing the RMTase encoding gene.[3] Till date, 11 RMTases have been identified, of which armA, rmtB, and rmtC are more frequent among Enterobacteriaceae.[45] Aminoglycosides are often used as adjunct drugs for treatment, in combination with other classes of antibiotics. The 16S methylases are frequently associated with extended-spectrum beta-lactamases (ESBL), carbapenemases, and plasmid-mediated quinolone-resistant (PMQR) genes.[35] In Enterobacteriaceae, 16S rRNA methyltransferases have been found to occur with bla[6] and rarely with bla.[78] Enterobacteriaceae harboring all the above but with single 16S rRNA methyltransferases have been reported from India, Singapore, Turkey, Oman, Switzerland, and France.[91011] However, the co-occurrence of two 16S rRNA methyltransferases along with bla, bla, and other resistant determinants on a single-plasmid replicon has not been reported till date. The presence of these genes on plasmid enables their spread to other bacterial species by horizontal gene transfer. The emergence of such multidrug-resistant bacteria is a cause for concern globally. Classification of plasmids into incompatible (Inc) groups is necessary because specific Inc groups have been associated with virulence and are of epidemiological importance.[5] The plasmid Inc grouping is based on the fact that two plasmids belonging to the same Inc group cannot proliferate in the same cell line. With this as basis, Carattoli et al. in 2005 designed a polymerase chain reaction (PCR)-based replicon typing, in which 18 sets of primers were used to recognize the coding sequence of repA genes, the cis-repeats of the origin of replication, and the counter transcript RNA interference.[12] In this context, the aim of this study was to detect the co-occurrence of the most common 16S methylases armA, rmtB, and rmtC with ESBL-encoding genes (bla and bla), carbapenemase-encoding genes (bla, and bla), and PMQR-encoding genes (qnr determinants and aac (6’)-Ib-cr).

Materials and Methods

Ethical approval

The study was approved by the institutional ethical committee (IEC-NI/15/APR/6/18).

Bacterial isolates

The study included 117, nonrepetitive, amikacin-resistant clinical isolates of Klebsiella pneumoniae, collected over a period of 6 months (June 2015–December 2015). The isolates were obtained from specimens such as urine (65), exudates (27), blood (14), and respiratory secretions (11). All the isolates were speciated based on conventional methods or VITEK-2 system (Vitek-2 GN-card; BioMerieux, Brussels, Belgium).

Antibiotic susceptibility testing and minimum inhibitory concentration

The disc diffusion technique and determination of minimum inhibitory concentration (MIC) were performed in accordance with the Clinical Laboratory Standard Institute, 2016.[13] The antibiotics tested were amikacin (30 μg), gentamicin (10 μg), tobramycin (10 μg), imipenem (10 μg), ciprofloxacin (5 μg), piperacillin/tazobactam (100 μg/10 μg), cefotaxime (30 μg), cefazolin (30 μg), and cefuroxime (30 μg) (Himedia laboratories, Mumbai, Maharashtra, India). The MIC for amikacin was determined by agar dilution method.

Template DNA preparation

A single bacterial colony was inoculated into Luria-Bertani broth (Himedia laboratories, Mumbai, Maharashtra, India) and incubated overnight at 37°C, and it was then centrifuged at 10,000 rpm for 10 min. The pellet was re-suspended in 250 μl of Millipore water, boiled at 100°C for 10 min, and cooled and centrifuged at 10,000 rpm for 10 min. The supernatant served as the template DNA.

Polymerase chain reaction

Four sets of multiplex PCRs were carried out using the previously described primers and conditions[141516171819] for all the study isolates. The multiplex primers used for different sets of genes, their annealing temperature, and the amplicon size are listed in Table 1.
Table 1

Primers used for performing polymerase chain reaction for amplifying resistant genes

Multiplex setgenePrimerAnnealing temperature (°C)Amplicon size (bp)
1armAF-CCGAAATGACAGTTCCTATCR-GAAAATGAGTGCCTTGGAGG52864
rmtBF-GCT TTC TGC GGG CGA TGT AAR-ATG CAA TGC CGC GCT CGT AT173
rmtCF-CGA AGA AGT AAC AGC CAA AGR-ATC CCA ACA TCT CTC CCA CT711
2blaTEMF- TTTCGTGTCGCCCTTATTCCR-ATCGTTGTCAGAAGTAAGTTGG60404
blaSHVF- CGCCTGTGTATTATCTCCCTR- CGAGTAGTCCACCAGATCCT294
blaCTX-MF- CGCTGTTGTTAGGAAGTGTGR- GGCTGGGTGAAGTAAGTGAC754
3blaIMPF- GGAATAGAGTGGCTTAAYTCR-TCGGTTTAAYAAAACAACCACC55232
blaVIMF-GATGGTGTTTGGTCGCATAR- CGAATGCGCAGCACCAG390
blaOXA-48-likeF- GCGTGGTTAAGGATGAACACR- CATCAAGTTCAACCCAACCG438
blaNDMF -GGTTTGGCGATCTGGTTTTCR -CGGAATGGCTCATCACGATC621
blaKPCF- CGTCTAGTTCTGCTGTCTTGR- CTTGTCATCCTTGTTAGGCG798
4qnrAF- TCAGCAAGAGGATTTCTCAR- GGCAGCACTATTACTCCCA52516
qnrBF- GATCGTGAAAGCCAGAAAGGR- ACGATGCCTGGTAGTTGTCC469
qnrSF- ACGACATTCGTCAACTGCAAR- TAAATTGGCACCCTGTAGGC417
Simplexacc (6’) Ib-crF- TTGGAAGCGGGGACGGAR- ACACGGCTGGACCATA53260
Primers used for performing polymerase chain reaction for amplifying resistant genes Each reaction volume contained 2 μl of the DNA template added to the master mix which includes 10 pmol of the forward and reverse primers (Sigma-Aldrich, Missouri, United States), 10 Mm dNTPs (Takara, Shiga, Japan), 5U taq polymerase (Takara, Shiga, Japan), and 10X buffer with MgCl2 (Takara, Shiga, Japan). Amplification reactions were performed under the following conditions: initial denaturation at 95°C for 4 min, followed by 32 cycles of denaturation at 94°C for 30 s, annealing based on the primer employed for 30 s with an extension at 72°C for 50 s, and a final extension for one cycle at 72°C for 5 min. The PCR product was then run on a 1.5% agarose gel for detection of the amplified fragment. Strains previously confirmed by PCR were sequenced and used as positive controls.

Bacterial conjugation

Mating-out assays were performed at 37°C using Escherichia coli J53 as recipient, and the donors were the isolates which were positive for 16S methylases along with bla, and bla genes. The transconjugants were screened on MacConkey agar plate containing 100 μg of sodium azide (Himedia Laboratories, Mumbai, Maharashtra, India) along with 10 μg of cefoxitin[20] and 4 μg of amikacin[21](SRL Pvt. Ltd, Mumbai, Maharashtra, India) each. The transconjugants were subjected to PCR detection of the antibiotic-resistant genes to confirm the transfer from the donor to the recipients.

Plasmid-based replicon typing

Plasmid-Inc group for the transconjugants was determined by plasmid-based replicon typing (PBRT) performed as described by Carattoli et al.[12] The 18 Inc groups tested were HI1, HI2, I1-αγ, X, L/M, N, FIA, FIB, W, Y, P, FIC, A/C, T, FIIAs, F, K, and B/O. PBRT was carried out in Applied Biosystems (Vetri 96-well thermal cycler, Pittsburgh, Pennsylvania) with five different multiplex-PCRs and three simplex-PCRs under the following conditions: all the amplifications were performed with the following amplification scheme: cycle of denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for all the Inc groups except that of F Inc group simplex which anneals at 52°C for 30 s with an extension at 72°C for 50 s, and a final extension for one cycle at 72°C for 5 min. The amplicon was then run on a 1.5% agarose gel for detection of the amplified fragment, and its corresponding Inc group was identified. The primers used for both multiplex- and simplex-PCRs performed are summarized in Table 2.
Table 2

Primers used for replicon typing

Multiplex setReplicon typePrimerAnnealing temperature (°C)Amplicon size (bp)
1HI1F- GGAGCGATGGATTACTTCAGTACR-TGCCGTTTCACCTCGTGAGTA60471
HI2F- TTTCTCCTGAGTCACCTGTTAACACR- GGCTCACTACCGTTGTCATCCT644
I1F- CGAAAGCCGGACGGCAGAAR-TCGTCGTTCCGCCAAGTTCGT139
2XF-AACCTTAGAGGCTATTTAAGTTGCTGATR-TGAGAGTCAATTTTTATCTCATGTTTTAGC60376
L/MF- GGATGAAAACTATCAGCATCTGAAGR- CTGCAGGGGCGATTCTTTAGG785
NF- GTCTAACGAGCTTACCGAAGR-GTTTCAACTCTGCCAAGTTC559
3FIAF-CCATGCTGGTTCTAGAGAAGGTGR -GTATATCCTTACTGGCTTCCGCAG60462
FIBF-GGAGTTCTGACACACGATTTTCTGR-CTCCCGTCGCTTCAGGGCATT308
WF-CCTAAGAACAACAAAGCCCCCGR-GGTGCGCGGCATAGAACCGT242
4YF-AATTCAAACAACACTGTGCAGCCTGR-GCGAGAATGGACGATTACAAAACTTT60765
PF-CTATGGCCCTGCAAACGCGCCAGAAAR-TCACGCGCCAGGGCGCAGCC534
FICF-GTGAACTGGCAGATGAGGAAGGR-TTCTCCTCGTCGCCAAACTAGAT262
5A/CF-GAGAACCAAAGACAAAGACCTGGAR-ACGACAAACCTGAATTGCCTCCTT60465
TF-TTGGCCTGTTTGTGCCTAAACCATR-CGTTGATTACACTTAGCTTTGGAC750
FII SF-CTGTCGTAAGCTGATGGCR-CTCTGCCACAAACTTCAGC270
Simplex 1FrepBF-TGATCGTTTAAGGAATTTTGR-GAAGATCAGTCACACCATCC52270
Simplex 2K/BF-GCGGTCCGGAAAGCCAGAAAAR-TCTTTCACGAGCCCGCCAAA60160
Simplex 3B/OF-GCGGTCCGGAAAGCCAGAAAAR-TCTGCGTTCCGCCAAGTTCGA60159
Primers used for replicon typing

Results

The study isolates exhibited resistance to all the antimicrobials tested by disc diffusion method. A high degree of resistance to amikacin (MIC range of >512 μg/mL) was observed in all the study isolates. PCR screening revealed that, of the 117 isolates, 79 (67.52%) harbored armA, 19 (16.23%) rmtB, and 16 carried (13.67%) rmtC. Of these, four isolates harbored more than one 16S rRNA methyltransferase. bla and bla were detected in 60 (51.28%) and 25 isolates (21.36%), respectively. The co-occurrence of bla and bla carbapenamase was observed in seven isolates, along with one of the 16S rRNA methyltransferases. Other carbapenemases such as bla, and bla were not encountered. The other resistance-encoding genes detected were Qnr determinant (48), acc (6’) Ib-cr (72), bla (4), and bla (9). Sixty isolates co-harbored bla, and bla The occurrence of these genes with bla, and 16S rRNA methyltransferase is depicted in Table 3.
Table 3

Number of isolates associated with the most common 16S rRNA methyltransferases along with other resistant determinants

GenesarmA positives (n=79)rmtB positives (n=19)rmtC positives (n=16)armA+rmtB positives (n=2)rmtB+rmtC positives (n=2)armA+rmtC/armA+rmtB+rmtC (n=0)
blaNDM (n=60)361212---
blaOXA-48- like (n=25)2032---
blaNDM+ blaOXA-48 (n=7)3112--
blaIMP/VIM/KPC (n=0)------
blaTEM (n=4)22----
blaSHV (n=0)------
blaCTX-M (n=9)324---
blaTEM+blaSHV (n=18)12321--
blaSHV+blaCTX-M (n=7)25----
blaTEM+blaCTX-M (n=7)311-2-
blaTEM+blaSHV+blaCTX-M (n=70)45591--
qnr determinants (n=48)32641--
aac (6’)-Ib-cr (n=71)47111012-
Number of isolates associated with the most common 16S rRNA methyltransferases along with other resistant determinants Conjugation experiment was carried out for all the 7 out of 117 K. pneumoniae strains (KP1, KP48, KP98, KP124, KP231, KP297, and KP302) that co-harbored both bla and bla carbapenamases, along with one of the 16S rRNA methyltransferases. The conjugation yield products, namely the single transconjugant, their plasmid replicon type, the resistance genes, and their associated resistant determinants, are tabulated [Table 4].
Table 4

Isolates that co-harbored bla and bla along with their resistant determinants and plasmid-incompatible groups

Isolate numberSourceDonor-resistant determinantsTransconjugant-resistant determinantsPlasmid-incompatible group
KP1ExudatesblaNDM, blaOXA-48-like, armA, blaTEM, blaSHV. blaCTX-MblaOXA-48-like, armA, blaTEM, blaCTX-ML/M
KP48RespiratoryblaNDM, blaOXA-48-like, rmtCblaNDM, blaOXA48-like, rmtCN
KP98UrineblaNDM, blaOXA-48-like, armA, rmtB, blaTEM, blaSHV. blaCTX-M , aac (6’)-Ib-cr, qnrBblaNDM , armA, rmtB, blaCTX-M, aac (6’)-Ib-cr, qnrBA/C
KP124UrineblaNDM, blaOXA-48-like, rmtB, blaSHV. blaCTX-M, qnrB, aac (6’)-Ib-crblaNDM, blaOXA-48-like, blaCTX-M,N
KP231UrineblaNDM, blaOXA-48-like, armA, rmtB, blaTEM, blaSHV. aac (6’)-Ib-crblaNDM, blaOXA-48-like, rmtB, armA, blaTEM, aac (6’)-Ib-crA/C
KP297BloodblaNDM, blaOXA-48-like, armA, blaTEM, blaSHV. blaCTX-MblaOXA-48-like, armA, blaTEM, blaCTX-MN
KP302UrineblaNDM, blaOXA-48-like, armA, blaCTX-M, qnrB, aac (6’)-Ib-crblaNDM, blaOXA-48-like, armA, blaCTXM, qnrB, aac (6’)-Ib-crA/C
Isolates that co-harbored bla and bla along with their resistant determinants and plasmid-incompatible groups Out of the seven isolates that were conjugatively transferable, only four isolates had bla and bla on the same plasmid, and they belonged to replicon-Inc N and A/C. Of them, two isolates harbored only a single plasmid. One K. pneumoniae harbored two 16S rRNA methyltransferases armA and rmtB.

Discussion

K. pneumoniae is a common enterobacterial pathogen causing healthcare-associated infections such as bacteremia, urinary tract infection, pneumonia, and meningitis. The rampant usage of antibiotics is modeling the bacteria to exhibit a phenomenal change in the drug susceptibility pattern with remarkable changes at their genetic level.[21] All the 117 K. pneumoniae isolates exhibited high-level resistance to amikacin with an MIC >512 μg/mL. Such high levels of resistance are attributable to the use of S-adenyosyl-L-methionine as a co-substrate and methylation of the aminoglycoside-binding A-site of the 16S rRNA of the bacterial ribosome.[22] The plasmid-mediated 16S rRNA methyltransferase usually exhibits a strong linkage with multidrug-resistant determinants.[23] Among the ESBLs, bla and bla were the most frequently encountered [Table 3]. Similar to our observation, the coexistence of these in Enterobacteriaceae has been reported from India previously.[242526] In this study, the prevalence of armA (67.52%) was high when compared to that of rmtB (16.23%) and rmtC (13.67%). The greater occurrence of armA is presumably due to its co-existence with bla on the same plasmid and its location on an effective transposon Tn1548.[27] The presence of more than one 16S rRNA methyltransferase is seldom reported. Interestingly, we found four isolates (3.41%) harboring multiple 16S rRNA methyltransferases in combinations of armA + rmtB and rmtB + rmtC. The occurrence of more than one 16S rRNA methylases in our study was low as compared to a report from Northeast India[5] where it was observed in 27.64% of E. coli. In a report from Morocco,[28] only 2 out of 116 aminoglycoside-resistant K. pneumoniae harbored both bla and aac (6’)-Ib-cr. In this study, a higher proportion (46/117) co-harbored the above determinants, which is a cause for worry because it restricts the application of combination therapy. Most of the bla-harboring plasmids are usually untypeable,[29] whereas bla plasmids are associated with IncL/M. The bla producers can co-harbor other beta-lactamases and/or 16SrRNA methyltransferase genes (armA, rmtB, and rmtC). However, the co-occurrence of bla and bla in a single plasmid is rarely reported.[30] In the present study, seven isolates harboring bla and bla along with 16S rRNA methyltransferase were conjugatively transferable. The incompatibility typing of plasmids revealed that armA was encoded within L/M-, A/C-, and N-Inc groups, whereas, rmtB and rmtC were encoded within A/C- and N-Inc groups, respectively. Two isolates which anchored both armA and rmtB were encoded within a single Inc group A/C. This pattern is in accordance with the report from North India[5] where multiple 16S methyltransferase genes were found on diverse Inc group types such as FIB, FIIS, I, T, X, N, Y, L/M, and FIA. By PBRT, the bla and bla were encoded within plasmids belonging to L/M-, A/C-, and N-Inc groups. Previously, Soundari et al. have reported the presence of both bla and bla in IncHI3 replicon.[29]

Conclusion

Our findings underline the emerging threat of multidrug-resistant pathogens that produce 16S rRNA methylase disseminating in this region. This study is of epidemiological importance. There is co-occurrence of two 16SrRNA methyltransferases along with bla and bla on single-plasmid replicon, and they belong to Inc A/C. To the best of our knowledge, this is the first report of such an occurrence till date. However, multi- centric studies needs to be carried out with increased sample size to have a better understanding about the different plasmid Inc types involved, their diverse source of origin and acquisition which would aid in the control strategies.

Financial support and sponsorship

This study was supported by the Department of Science and Technology under INSPIRE-fellowship scheme (reference number IF150368).

Conflicts of interest

There are no conflicts of interest.
  28 in total

1.  Updated multiplex polymerase chain reaction for detection of 16S rRNA methylases: high prevalence among NDM-1 producers.

Authors:  Béatrice Berçot; Laurent Poirel; Patrice Nordmann
Journal:  Diagn Microbiol Infect Dis       Date:  2011-10-13       Impact factor: 2.803

2.  qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States.

Authors:  A Robicsek; J Strahilevitz; D F Sahm; G A Jacoby; D C Hooper
Journal:  Antimicrob Agents Chemother       Date:  2006-08       Impact factor: 5.191

3.  Emergence of OXA-carbapenemase- and 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway.

Authors:  Nabil Karah; Bjørg Haldorsen; Nils O Hermansen; Yngvar Tveten; Eivind Ragnhildstveit; Dag H Skutlaberg; Ståle Tofteland; Arnfinn Sundsfjord; Ørjan Samuelsen
Journal:  J Med Microbiol       Date:  2010-12-16       Impact factor: 2.472

4.  Emergence of metallo-β-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia.

Authors:  Laurent Poirel; Emilie Lagrutta; Peter Taylor; Jeanette Pham; Patrice Nordmann
Journal:  Antimicrob Agents Chemother       Date:  2010-09-07       Impact factor: 5.191

5.  Plasmid-mediated 16S rRNA methylases conferring high-level aminoglycoside resistance in Escherichia coli and Klebsiella pneumoniae isolates from two Taiwanese hospitals.

Authors:  Jing-Jou Yan; Jiunn-Jong Wu; Wen-Chien Ko; Shu-Huei Tsai; Chin-Luan Chuang; Hsiu-Mei Wu; Ying-Jiun Lu; Jau-Dai Li
Journal:  J Antimicrob Chemother       Date:  2004-10-14       Impact factor: 5.790

6.  Extended spectrum beta-lactamases in Escherichia coli & Klebsiella pneumoniae & associated risk factors.

Authors:  Ankur Goyal; K N Prasad; Amit Prasad; Sapna Gupta; Ujjala Ghoshal; Archana Ayyagari
Journal:  Indian J Med Res       Date:  2009-06       Impact factor: 2.375

7.  Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation.

Authors:  Marc Galimand; Patrice Courvalin; Thierry Lambert
Journal:  Antimicrob Agents Chemother       Date:  2003-08       Impact factor: 5.191

Review 8.  Global spread of Carbapenemase-producing Enterobacteriaceae.

Authors:  Patrice Nordmann; Thierry Naas; Laurent Poirel
Journal:  Emerg Infect Dis       Date:  2011-10       Impact factor: 6.883

9.  RmtC and RmtF 16S rRNA Methyltransferase in NDM-1-Producing Pseudomonas aeruginosa.

Authors:  Mohibur Rahman; Kashi Nath Prasad; Ashutosh Pathak; Binod Kumar Pati; Avinash Singh; Cristina M Ovejero; Saheem Ahmad; Bruno Gonzalez-Zorn
Journal:  Emerg Infect Dis       Date:  2015-11       Impact factor: 6.883

10.  Occurence of ArmA and RmtB Aminoglycoside Resistance 16S rRNA Methylases in Extended-Spectrum β-Lactamases Producing Escherichia coli in Algerian Hospitals.

Authors:  Amel Ayad; Mourad Drissi; Claire de Curraize; Chloé Dupont; Alain Hartmann; Sébastien Solanas; Eliane Siebor; Lucie Amoureux; Catherine Neuwirth
Journal:  Front Microbiol       Date:  2016-09-12       Impact factor: 5.640

View more
  2 in total

Review 1.  Research Updates of Plasmid-Mediated Aminoglycoside Resistance 16S rRNA Methyltransferase.

Authors:  Weiwei Yang; Fupin Hu
Journal:  Antibiotics (Basel)       Date:  2022-07-07

2.  Increasing Trends of Association of 16S rRNA Methylases and Carbapenemases in Enterobacterales Clinical Isolates from Switzerland, 2017-2020.

Authors:  Claudine Fournier; Laurent Poirel; Sarah Despont; Julie Kessler; Patrice Nordmann
Journal:  Microorganisms       Date:  2022-03-14
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.