Literature DB >> 31923228

Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls.

Marta Filipa Silva1, Gonçalo Pereira1, Carla Carneiro1, Andrew Hemphill2, Luísa Mateus1, Luís Lopes-da-Costa1, Elisabete Silva1.   

Abstract

A new species of the Campylobacter genus is described, isolated from the preputial mucosa of bulls (Bos taurus). The five isolates obtained exhibit characteristics of Campylobacter, being Gram-negative non-motile straight rods, oxidase positive, catalase negative and microaerophilic. Phenotypic characteristics and nucleotide sequence analysis of 16S rRNA and hsp60 genes demonstrated that these isolates belong to a novel species within the genus Campylobacter. Based on hsp60 gene phylogenetic analysis, the most related species are C. ureolyticus, C. blaseri and C. corcagiensis. The whole genome sequence analysis of isolate FMV-PI01 revealed that the average nucleotide identity with other Campylobacter species was less than 75%, which is far below the cut-off for isolates of the same species. However, whole genome sequence analysis identified coding sequences highly homologous with other Campylobacter spp. These included several virulence factor coding genes related with host cell adhesion and invasion, transporters involved in resistance to antimicrobials, and a type IV secretion system (T4SS), containing virB2-virB11/virD4 genes, highly homologous to the C. fetus subsp. venerealis. The genomic G+C content of isolate FMV-PI01 was 28.3%, which is one of the lowest values reported for species of the genus Campylobacter. For this species the name Campylobacter portucalensis sp. nov. is proposed, with FMV-PI01 (= LMG 31504, = CCUG 73856) as the type strain.

Entities:  

Year:  2020        PMID: 31923228      PMCID: PMC6953823          DOI: 10.1371/journal.pone.0227500

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Campylobacteraceae family of the order Campylobacterales is the largest and most diverse family in class Epsilonproteobacteria of the phylum Proteobacteria [1]. Campylobacter, the type genus of the family, contains species known to be pathogenic to humans [2] and other animals [3] as well as non-pathogenic species that colonize a large range of molluscs, reptiles, birds and mammals [4]. Presently, the Campylobacter genus comprises 31 species and 13 subspecies [5]. Cells of most Campylobacter species are motile, microaerophilic, Gram-negative, slender, spirally curved rods and 0.5–5 μm long by 0.2–0.8 μm wide. However, some species exhibit straight rod morphology [1] and C. gracilis, C. hominis, C. ureolyticus and C. blaseri are non-motile [6-9]. Seven species colonize cattle [4], of which C. coli, C. hyointestinalis, C. jejuni, C. lanienae and C. ureolyticus are found in faeces [10-12], C. sputorum is a commensal of the penile and preputial mucosae [13] and C. fetus includes two subspecies with clinical relevance in cattle. The C. fetus subspecies fetus colonizes the bovine intestinal tract, causing sporadic abortion, whereas the subspecies venerealis inhabits exclusively the genital tract of cattle, and is the etiologic agent of Bovine Genital Campylobacteriosis [14]. Herein, we describe a new species of Campylobacter isolated from a beef herd with history of reproductive failure compatible with Bovine Genital Campylobacteriosis, in the Alentejo province of Portugal.

Material and methods

Ethics statement

The in vivo samples used in this study were obtained from a bull that performed natural mating in a herd with clinical signs of Bovine Genital Campylobacteriosis. The samples were collected by a certified veterinarian, using the recommended OIE sampling methods for diagnostic purposes. No ethical approval was required as this was part of a routine veterinarian evaluation of beef herd reproductive failure. Ex vivo samples were obtained from animals slaughtered for human consumption. As sampling was performed post-mortem, in a certified slaughterhouse, no ethical approval from an Institutional Animal Care and Use Committee (IACUC) or other relevant ethics board was required.

Sampling, isolation procedures and culture conditions

Samples were obtained in vivo and post-mortem. The in vivo sample was collected from one mature Charolais bull, for laboratory diagnostic purposes. This sample was obtained from the preputial fornix using a technique combining scraping and small volume fluid washing (phosphate buffered saline; PBS) of the mucosa [15], and transported to the laboratory within 4 hours in two aliquots, one in Weybridge transport enrichment medium (TEM) and one in PBS. The bull had a normal routine breeding soundness evaluation and performed natural mating in a beef herd in the Alentejo province of Portugal. This herd showed fertility features compatible with Bovine Genital Campylobacteriosis, namely a low breeding season fertility, and late and spread calvings within the calving season. Post-mortem samples were also collected from the preputial fornix at two slaughterhouses and transported to the laboratory in PBS within 4 hours. The in vivo collected sample transported in Weybridge TEM was incubated at 37°C in a microaerobic atmosphere (Genbox Microaer, Biomérieux, France) for 48 hours, as an enrichment step. Enriched samples were plated through two different approaches: i) passively filtered onto blood agar (BA) and ii) spread in Campylobacter Skirrow Agar (CSA) [16]. In the BA approach, 0.65-μm mixed cellulose ester membrane filters (Advantec, Japan) were applied to the surface of BA plates supplemented with 5% sheep blood (Columbia agar + 5% sheep blood, Biomérieux) and inoculated with 100 μl of enriched sample for 30 minutes in aerobic conditions at room temperature; filters were then removed. In the CSA approach, 100 μl of enriched sample was spread on CSA plates. The BA and CSA plates were then incubated in microaerobic conditions at 37°C for 72 hours. The samples transported in PBS (in vivo and post-mortem collected) were diluted (ten-fold dilutions; 10−1, 10−2 and 10−3), streaked onto BA plates and incubated in a microaerobic atmosphere at 37°C for 48 hours. Colonies with Campylobacter-like morphology (small, smooth, translucent) were streaked onto BA and returned to a microaerobic atmosphere for a further incubation at 37°C for 48 hours. Before phenotypic and genotypic characterization, cells were microscopically examined using Gram staining.

Molecular identification and phylogenetic analysis

Genomic DNA from bacterial isolates was extracted using DNeasy Blood and Tissue kit (Qiagen, Germany), according to the manufacturer’s instructions. The 16S rRNA gene was amplified and sequenced using a universal set of primers–fD1 and rP1 (Table 1). Additionally, the flanking regions were amplified and sequenced with the primer sets FrAF/Vc1-2 and FrBF/FrBR (Table 1). Primers (FrAF, FrBF and FrBR) were designed using Primer-BLAST [17], based on the whole genome sequencing data. Primers FrAF and FrBR were designed to target a neighbour sequence of the 16S rRNA gene in order to obtain a full-length sequence. PCR reactions were carried out in a 50 μl mixture containing 0.3 μM of each primer, 200 μM of deoxynucleotide-triphosphates (4you4 dNTP Mix, Bioron, Germany), 1x reaction buffer (Complete NH4 reaction Buffer, 10x, Bioron), 2 units of DFS-Taq Polymerase (Bioron) and 3 μl of DNA. The thermal cycle conditions were as follows: 94°C for 2 min, followed by 30 cycles of denaturation (94°C for 30 s), annealing (30 s), and extension (72°C for 60 s), with a terminal extension step of 72°C for 5 min. The annealing temperature set for each primer pair is shown in Table 1. The amplified sequences were aligned and trimmed to create a full-length 16S rRNA gene sequence. The nucleotide sequence of FMV-PI01 isolate (GenBank accession no: MN417497) was compared with other 16S rRNA gene sequences deposited in the NCBI database, using BLASTN algorithm. To investigate the taxonomic position of the bacterial isolates, a phylogenetic tree based on 1513 nucleotide positions of 16S rRNA gene sequences was reconstructed. Available sequences of 16S rRNA gene of other Campylobacter species were retrieved from the GenBank database for phylogenetic analysis with Molecular Evolutionary Genetic Analysis (MEGA) X software [18]. Sequences were aligned with Clustal W algorithm [19] and positions with missing data were trimmed. The phylogenetic tree was reconstructed by the neighbour-joining method and stability of grouping was estimated by bootstrap analysis, set for 1000 replications. To further refine the phylogenetic analysis, a phylogenetic tree based on hsp60 gene (also known as cpn60 and groEL) sequences was also reconstructed, as described above. The amplification and sequencing of hsp60 gene were carried out using two primer pairs (hsp60_AF/hsp60_AR and hsp60_BF/hsp60_BR, Table 1) to obtain a 1472 bp long sequence.
Table 1

Primer sequences used for 16S rRNA and hsp60 genes amplification.

GeneDesignationPrimers (5′-3′)Annealing temperatureAmplicon size (bp)Reference
16S rRNAfD1AGAGTTTGATCCTGGCTCAG52°C1475[20]
rP1ACGGTTACCTTGTTACGACTT
FrAFCGATTGAGCCAAGGGCTTTA52°C461This study
Vc1-2RACTTAACCCAACATCTCACG[21]
FrBFACACGTGCTACAATGGCATA53°C451This study
FrBRTCTCTGAAAACTAAACAAGGATGA
hsp60hsp60_AFAACTTTATGGTGGCGTTAAAA52°C1118
hsp60_ARAGTTTCTGTTGCAGCACCTA
hsp60_BFAGCTTAATGTTGTTGAGGGA51°C1085
hsp60_BRTTACATCATACCACCCATAC

Biochemical characterization and growth conditions

For biochemical characterization, bacterial cultures grown in a microaerobic atmosphere at 37°C for 48 hours were used. Oxidase activity was determined with oxidase test sticks (Liofilchem, Italy) and catalase activity was evaluated by observation of bubbling formation on a 3% peroxide hydrogen solution within 5 seconds. Urease and hydrogen sulfide (H2S) production were assessed on Christensen Urea Agar (Liofilchem) and Triple Sugar Iron (TSI) Agar (Liofilchem), respectively. Additionally, commercial tests were used to evaluate nitrate reduction, hippurate hydrolysis (Liofilchem) and indoxyl acetate hydrolysis (Indoxyl strips, Sigma-Aldrich), following the manufacturer’s instructions. The growth on BA supplemented with 1% glycine, 2% NaCl, 3.5% NaCl, 0.04% Tetrazolium chloride (TTC) and on MacConkey agar was determined according to standardized procedures, previously described [22,23]. The evaluation of growth on anaerobic and aerobic atmospheres at 37°C, and microaerobic growth at 25°C, 37°C or 42°C, after 48 to 96 hours was also performed. The bacterial motility was assessed by the hanging drop technique [24], using bacterial suspensions in PBS after 48 hours of growth on BA. Reference strains C. fetus subsp. fetus NCTC 10842, C. fetus subsp. venerealis NCTC 10354, C. coli CNET 068, C. jejuni subsp. jejuni NCTC 11168, and isolates identified as C. sputorum bv. sputorum, and Proteus sp. were used as controls in the tests described above.

Electron microscopy

Electron micrographs were taken from a pure culture of isolate FMV-PI01. Preparations for electron microscopy were performed as previously described [25-27], followed by post-fixation in 2% osmium tetroxide and stepwise dehydration (30/50/70/90/100%) in ethanol. For transmission electron microscopy, samples were embedded in EPON812. Ultrathin sections (80 nm) were placed onto 300-mesh formvar-carbon-coated nickel grids (Plano, Wetzlar, Germany) and stained with Uranyless and lead citrate [27]. Specimens were viewed on a CM12 transmission electron microscope operating at 60 kV. For scanning electron microscopy, fixed and dehydrated samples were resuspended in two changes of hexamethyl-disilazane (Sigma), sputter coated with gold, and inspected on a JEOL 840 scanning electron microscope operating at 25 kV.

Whole genome sequencing and comparative genomic analysis

The genomic DNA was extracted from a pure culture of the isolate FMV-PI01, grown on BA over 48 hours, using the DNeasy Blood and Tissue kit (Qiagen, Germany). After the genomic library preparation, the generated DNA fragments were sequenced using the HiSeq 4000 System (Illumina), with 150 bp paired-end reading sequences and assembled using CLC Genomics Workbench version 11.0.1 (CLC bio, Denmark), at Stabvida (Caparica, Portugal). The assembled genome was annotated with the Rapid Annotation Using Subsystem Technology (RAST) 2.0 pipeline [28,29]. The average nucleotide identity (ANI) was calculated with the webserver JspeciesWS [30] for the isolate FMV-PI01 and other Campylobacter species. The G+C content was determined based on the whole genome sequence of isolate FMV-PI01. The identification of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated (Cas) systems was performed using the CRISPRCasFinder webserver [31]. Additionally, the presence of putative virulence factor coding genes was evaluated based on the homology of translated sequences using BLASTP. Only sequences with query coverage >95% and identity >50% with known protein sequences of virulence factors were considered. To estimate the pathogenic potential of this novel species, the assembled genome of isolate FMV-PI01 was analysed with the PathogenFinder Web server [32], using the automatic model option.

Results and discussion

Morphological characterization

The aliquot of the in vivo collected preputial sample transported in Weybridge TEM produced no Campylobacter-like morphology colonies on either approach (BA and CSA). In contrast, the in vivo collected preputial sample aliquot transported in PBS and streaked onto BA produced Campylobacter-like morphology colonies (isolate FMV-PI01). Post-mortem preputial samples, collected in PBS, produced four isolates (isolates FMV-PI02 to FMV-PI05) from beef bulls arising from four geographically distinct herds. Colony morphology in BA was common to all isolates, colonies being punctiform, circular, with convex elevation, smooth margins, without pigmentation and no haemolysis observable. Bacterial cells from all isolates were Gram-negative and exhibited a straight rod shape. Electron microscopy revealed that isolate FMV-PI01 bacterial cells had an average length of 1.68±0.07 μm (n = 30) and an average width of 0.44±0.01 μm (n = 30), and were devoid of a flagellum. Occasional filamentous cells were observed displaying lengths up to 18 μm (Fig 1).
Fig 1

Electron micrographs of isolate FMV-PI01.

(A) Transmission electron microscope micrograph in longitudinal and transverse views. Scale bar, 500 nm. (B) Scanning electron microscope micrograph in detail. Scale bar, 2 μm (C) Scanning electron microscope micrograph with evident long filamentous cells (white arrow). Scale bar, 2 μm.

Electron micrographs of isolate FMV-PI01.

(A) Transmission electron microscope micrograph in longitudinal and transverse views. Scale bar, 500 nm. (B) Scanning electron microscope micrograph in detail. Scale bar, 2 μm (C) Scanning electron microscope micrograph with evident long filamentous cells (white arrow). Scale bar, 2 μm.

Phenotypic characterization

The phenotypic tests were validated by control Campylobacter species strains, whose results were all in agreement with those reported in the literature [33]. All five isolates presented identical phenotypic characteristics (Table 2). Isolates were positive for oxidase activity, a feature present in all Campylobacter species except C. gracilis and sporadic isolates of C. concisus and C. showae [1]. Isolates were negative for catalase activity and were unable to hydrolyse urea, hippurate and indoxyl acetate. From the seven Campylobacter species that colonize cattle, only C. jejuni is able to hydrolase hippurate [4,8]. Contrary to the majority of Campylobacter species, the isolates were unable to reduce nitrate. In fact, only three other species of the Campylobacter genus fail to reduce nitrate: C. hominis, C. mucosalis and C. concisus [1]. Production of H2S was not observed in TSI agar. The growth tests showed that the isolates were microaerophilic, although they could tolerate anaerobic conditions with weaker growth. The microbial growth in microaerobic conditions was similar to the majority of the Campylobacter species [1], observable at 37°C and 42°C, but not at 25°C. Further testing showed that four of the five isolates grew in the presence of 1% glycine, but none grew on BA supplemented with 2% or 3.5% NaCl. Growth was not observed either on MacConkey agar or on Muller Hinton Agar supplemented with 5% sheep blood. Unlike other Campylobacter species (e.g. C. hominis and C. ureolyticus) [34], the isolates did not require hydrogen (H2) to grow since the employed gas-generating sachet Genbox does not release hydrogen. No motility was observed on the hanging drop method preparation, which can justify the absence of colonies with Campylobacter-like morphology in the BA approach since that technique was developed to isolate motile Campylobacter spp. that can cross the 0.65-μm mixed cellulose ester membrane filters. To summarize, the five isolates were Gram-negative rods, microaerophilic and oxidase positive, which are phenotypic traits common to the genus Campylobacter [13]. However, the isolates were distinguishable from the most related species C. sputorum, C. corcagiensis, C. blaseri, C. ureolyticus and C. geochelonis (see genomic characterization), since unlike these species, the isolates could not reduce nitrate (Table 2).
Table 2

Phenotypic characteristics differentiating FMV-PI isolates from the other Campylobacter species.

Taxa: 1—FMV-PI isolates (n = 5); 2—C. hominis; 3—C. gracilis; 4—C. sputorum; 5—C. ureolyticus; 6—C. corcagiensis; 7—C. mucosalis; 8—C. concisus; 9—C. pinnipediorum subsp. pinnipediorum; 10—C. curvus; 11—C. rectus; 12—C. showae; 13—C. coli; 14—C. hyointestinalis subsp. hyointestinalis; 15—C. jejuni subsp. jejuni; 16—C. lanienae; 17- C. fetus subsp. venerealis;; 18—C. hepaticus; 19—C. avium; 20—C. canadensis; 21—C. cuniculorum; 22—C. geochelonis; 23—C. helveticus; 24—C. insulaenigrae; 25—C. lari subsp. lari; 26—C. peloridis; 27—C. subantarcticus; 28—C. upsaliensis; 29—C. volucris; 30—C. blaseri; 31—C. iguaniorum; 32—C. ornithocola. Data for reference taxa were obtained from previous species descriptions [7–9,33,35–47]. + 90–100%; (+) 75–89%; v 26–74%; (-) 11–25%; - 0–10%; nd–not determined; w—weakly positive.

1234567891011121314151617181920212223242526272829303132
Motility---+-+++nd++++++++++++++++ndnd+nd-ndnd
Oxidase++-++++v+++v++++++++++++++++++++
Catalase--(-)v*v+--+-(-)+++++(+)+wv++-++++-+++-
α-haemolysis---+v--(-)+(-)++(-)v++V---+-+nd+nd++nd-+-
Urease---v*++--+----------v-----ndnd-nd+-+
Hippurate hydrolysis---------(-)----+--(+)+--+----------
Indoxyl acetate hydrolysis--(+)-vv---v+v+-+--++-+-+--nd-+-+--
Nitrate reduction--(+)(+)+(+)(-)(-)++++++++(+)v+v+++++ndnd+++++
H2S production---+-++-+(-)-v-+-----v---+-nd---+++
Growth in/at/on:
1% glycinev+++++v(-)v++v(+)++-(-)+-v-+v+++(+)+-++-
2% NaCl-nd++++-(-)ndvv+---nd---nd-+--+(+)+--ndndnd
3.5% NaCl-nd-v+nd--nd------nd--nd-ndnd---nd--ndndndnd
MacConkey Agar--(+)vv-(+)-nd(+)-+vv-+V--+---nd-nd(-)-w+ndnd
TTC 0.04%--------ndV--+-+nd-+-ndv--nd+ndndv-ndndnd
25°C, microaerobic-----nd--+----(-)--+----+-------+++
37°C, microaerobic++-++++++v-v++++++++++++++++++++
42°C, microaerobic+(-)v+v++(+)-v(-)v++++-+++(+)-+-++++++--
37°C, anaerobicw+++++++++++---+V--+-+---nd+-++++
37°C, aerobic--------------------------------
H2 requirement-++-+-++-+++-v----v----nd-nd--nd---

*test results differ between biovars.

Phenotypic characteristics differentiating FMV-PI isolates from the other Campylobacter species.

Taxa: 1—FMV-PI isolates (n = 5); 2—C. hominis; 3—C. gracilis; 4—C. sputorum; 5—C. ureolyticus; 6—C. corcagiensis; 7—C. mucosalis; 8—C. concisus; 9—C. pinnipediorum subsp. pinnipediorum; 10—C. curvus; 11—C. rectus; 12—C. showae; 13—C. coli; 14—C. hyointestinalis subsp. hyointestinalis; 15—C. jejuni subsp. jejuni; 16—C. lanienae; 17- C. fetus subsp. venerealis;; 18—C. hepaticus; 19—C. avium; 20—C. canadensis; 21—C. cuniculorum; 22—C. geochelonis; 23—C. helveticus; 24—C. insulaenigrae; 25—C. lari subsp. lari; 26—C. peloridis; 27—C. subantarcticus; 28—C. upsaliensis; 29—C. volucris; 30—C. blaseri; 31—C. iguaniorum; 32—C. ornithocola. Data for reference taxa were obtained from previous species descriptions [7-9,33,35-47]. + 90–100%; (+) 75–89%; v 26–74%; (-) 11–25%; - 0–10%; nd–not determined; w—weakly positive. *test results differ between biovars.

Phylogenetic analysis

The 16S rRNA gene sequence alignment revealed that the five bacterial isolates shared 99.87% sequence similarity. This homology, associated to their similar phenotypic characteristics, confirms that they belong to the same species. The comparative analysis of the 16S rRNA gene sequence of isolate FMV-PI01, using the BLASTN algorithm, confirmed that this isolate is closely related to the genus Campylobacter. The highest identities were obtained with C. concisus and C. gracilis (100% coverage and 94.7% identity) and C. hominis (100% coverage and 94.1% identity). These 16S rRNA sequence identities are below the threshold of 97%, defined for bacteria belonging to the same species [48], which supports the identification of a novel species within the Campylobacter genus. The phylogenetic analysis using 16S rRNA and hsp60 genes (Figs 2 and 3) demonstrated that these isolates form a robust cluster. However, the phylogenetic position of the five isolates was not clearly established based on the phylogenetic analysis. The low bootstrap values observed (< 70%) indicate that the 16S rRNA and hsp60 genes have a weak discriminatory power relatively to the group of phylogenetically related species.
Fig 2

Phylogenetic tree based on 16S rRNA gene sequences of Campylobacter species, reconstructed by the neighbour-joining method.

Bootstrap values (%) obtained from 1000 simulations are indicated at the nodes. Bootstrap values lower than 70% are not shown. Bar: 0.0050 substitutions per site.

Fig 3

Phylogenetic tree based on hsp60 gene sequences of Campylobacter species, reconstructed by the neighbour-joining method.

Bootstrap values (%) obtained from 1000 simulations are indicated at the nodes. Bootstrap values lower than 70% are not shown. Bar: 0.050 substitutions per site.

Phylogenetic tree based on 16S rRNA gene sequences of Campylobacter species, reconstructed by the neighbour-joining method.

Bootstrap values (%) obtained from 1000 simulations are indicated at the nodes. Bootstrap values lower than 70% are not shown. Bar: 0.0050 substitutions per site.

Phylogenetic tree based on hsp60 gene sequences of Campylobacter species, reconstructed by the neighbour-joining method.

Bootstrap values (%) obtained from 1000 simulations are indicated at the nodes. Bootstrap values lower than 70% are not shown. Bar: 0.050 substitutions per site. The 16S rRNA phylogenetic analysis identified C. gracilis, C. hominis, C. sputorum, C. geochelonis, C. blaseri, C. corcagiensis and C. ureolyticus as the most related taxa. This was also observed in the phylogenetic analysis based on hsp60 gene, except for C. gracilis, which was not grouped with FMV-PI isolates. The hsp60 gene analysis provided a better phylogenetic resolution, with a higher number of branches with high bootstrap values. Although the 16S rRNA gene is the most commonly accepted for use in taxonomic studies, phylogenetic analysis based on hsp60 gene is more discriminative for some bacterial taxa as the family Campylobacteraceae [33,49,50]. A greater interspecies variation in the nucleotide sequence of hsp60 gene than in 16S rRNA gene may explain these findings [50].

Genomic characterization

The Whole Genome Shotgun project was deposited at DDBJ/ENA/GenBank under the accession VWSJ00000000. The version described in this paper is version VWSJ01000000. The genome of isolate FMV-PI01 is 1 767 933 bp long, composed of 98 contigs, with 28.3% G+C content. This G+C content is one of the lowest reported for species of the genus Campylobacter. The G+C content of a bacterial species may reflect adaptation to environmental niches and lifestyles, since non-free-living bacteria generally have shorter genomes with lower G+C content, promoting energy conservation in environments with scarcity of nutrients [51,52]. Interestingly, C. sputorum, also with one of the lowest G+C contents within the genus Campylobacter (29%) [53], colonizes the bull’s preputial mucosa, exhibiting niche preferences similar to herein described isolates. The ANI analysis revealed that homology with other Campylobacter species was less than 75%, which is far below the 95–96% cut-off for isolates of the same species [54]. These nucleotide similarities are in accordance with the hsp60 and 16S rRNA genes phylogenetic analysis results, showing that C. ureolyticus, C. corcagiensis and C. blaseri are the most closely related taxa with ANI values of 74.3%, 73.3% and 73.0%, respectively, followed by C. geochelonis (72.3%), C. sputorum (72.2%), C. hominis (70.1%) and C. gracilis (65.9%). The ANI values of these two latter species (C. gracilis and C. hominis) support the results of the analysis based on hsp60 gene rather than the 16S rRNA gene. Overall, these findings support that the herein described isolates belong to the Campylobacter genus, representing a novel species, for which the designation Campylobacter portucalensis sp. nov. is proposed. The ANI analysis homology between Campylobacter portucalensis sp. nov. and its most related Campylobacter species is shown in Table 3.
Table 3

Average nucleotide identity (ANI) values (%) based on BLAST for C. portucalensis sp. nov. and the most related Campylobacter species.

Strains: 1 –C. portucalensis sp. nov. FMV-PI01; 2 –C. hominis ATCC BAA-381; 3 –C. fetus subsp. fetus 82–40; 4 –C. lari RM2100; 5 –C. insulaenigrae NCTC 12927; 6 –C. hyointestinalis subsp. hyointestinalis LMG 9260; 7 –C. hepaticus HV10; 8 –C. jejuni subsp. jejuni LMG 9872; 9 –C. corcagiensis CIT 045; 10 –C. blaseri 17500004–5; 11 –C. ureolyticus DSM 20703; 12 –C. sputorum bv. faecalis CCUG 20703; 13 –C. gracilis ATCC 33236; 14 –C. concisus ATCC 33237; 15 –C. geochelonis RC20.

123456789101112131415
1*70.169.869.769.669.669.369.373.373.074.772.265.968.472.3
270.2*69.268.368.269.168.268.369.869.771.670.268.268.370.2
369.468.5*68.267.978.567.667.868.869.469.369.566.668.269.7
470.068.568.9*81.968.874.374.569.069.869.869.865.568.069.0
569.768.368.481.9*68.474.174.068.669.569.669.365.467.568.5
669.168.478.667.967.7*67.467.868.769.069.269.566.768.669.7
769.468.268.574.574.568.2*84.468.669.169.369.265.167.068.1
869.168.168.174.473.968.384.4*68.568.869.168.965.667.668.4
972.368.968.667.867.868.567.567.7*71.273.070.365.467.771.1
1072.569.369.268.968.669.268.368.371.8*72.871.265.467.972.6
1174.871.669.869.769.469.869.169.273.973.1*72.065.868.672.3
1271.970.269.869.469.169.868.868.871.271.571.8*66.268.870.9
1365.567.266.264.664.466.464.464.865.264.764.865.4*67.767.0
1467.767.468.367.066.668.666.566.967.767.867.8168.268.0*69.0
1571.469.269.367.967.269.367.167.571.072.171.3370.267.368.8*

Average nucleotide identity (ANI) values (%) based on BLAST for C. portucalensis sp. nov. and the most related Campylobacter species.

Strains: 1 –C. portucalensis sp. nov. FMV-PI01; 2 –C. hominis ATCC BAA-381; 3 –C. fetus subsp. fetus 82–40; 4 –C. lari RM2100; 5 –C. insulaenigrae NCTC 12927; 6 –C. hyointestinalis subsp. hyointestinalis LMG 9260; 7 –C. hepaticus HV10; 8 –C. jejuni subsp. jejuni LMG 9872; 9 –C. corcagiensis CIT 045; 10 –C. blaseri 17500004–5; 11 –C. ureolyticus DSM 20703; 12 –C. sputorum bv. faecalis CCUG 20703; 13 –C. gracilis ATCC 33236; 14 –C. concisus ATCC 33237; 15 –C. geochelonis RC20. A total of 1877 coding sequences (CDS) and 41 RNAs (36 transfer RNA and 5 ribosomal RNA genes) were identified in FMV-PI01’s genome. Of the identified CDS, 497 were assigned to 191 subsystems. Subsystems with higher number of genes are related to metabolic processes, and include “protein metabolism” (n = 126), “amino acids and derivatives” (n = 136) and “cofactors, vitamins, prosthetic groups and pigments” (n = 65) (Fig 4). Nineteen genes involved in “Virulence, disease and defence” and 16 genes related to “stress response” were identified (Fig 4).
Fig 4

Subsystem category distribution in the genome of isolate FMV-PI01, based on the RAST server.

The CRISPRCasFinder identified one CRISPR-Cas system in FMV-PI01’s genome, which contains 15 CRISPR repeats with 13 CRISPR spacers and a type III-D Cas system. Despite CRISPR-Cas systems have been associated with phage defence mechanisms, these systems may also play a role in bacterial virulence and host immune evasion [55]. The diversity of CRISPR-Cas systems within the Campylobacter genus is wide, being the Cas systems type I and II the most common among Campylobacter species [55]. However, the type III-D, which was found in the genome of C. portucalensis sp. nov., was also identified in C. fetus. The mechanisms behind the selection of each system in different bacterial species [56], as well as the role of Cas system type III-D in C. fetus, remain unclear. A more detailed analysis using BLASTP algorithm allowed the identification of genes potentially involved in adhesion and invasion to host cells. These genes encode homologous of the fibronectin/fibrinogen binding protein (98% query cover, 62% identity), collagenase like peptidase of U32 family (100% query cover, 81% identity) and Campylobacter invasion antigen B, ciaB (100% query cover, 64% identity). These virulence factor coding genes are present in several Campylobacter species, namely in C. fetus and C. jejuni [57]. Adhesion of C. jejuni to host cells is mediated by the fibronectin binding protein [58-60], and the mutational inactivation of the ciaB gene reduced the invasion in INT 407 cells, revealing that ciaB is involved in the internalization of C. jejuni [61,62]. Therefore, the presence of these genes in the genome of C. portucalensis is potentially related to host cell adhesion and invasion in the bovine reproductive tract. In addition, genes encoding multidrug efflux pumps of the resistance-nodulation-cell division family were found, namely a CmeABC efflux pump. These transporters are present in several species of Campylobacter (e.g. C. jejuni, C. coli, C. fetus and C. lari) and contribute to multidrug resistance [63]. For instance, this efflux pump in C. jejuni is involved in resistance to bile salts [64], macrolides, tetracycline [65], ciprofloxacin and other antimicrobials [66]. The C. portucalensis FMV-PI01’s genome encodes a type IV secretion system (T4SS), containing virB2-virB11/virD4 genes, highly homologous to the C. fetus subsp. venerealis T4SS (99% coverage and 97.2% identity). This T4SS was confirmed to contribute to C. fetus subsp. venerealis virulence properties, namely invasive and cytotoxic potential [67,68]. The fact that C. portucalensis sp. nov. and C. fetus subsp. venerealis, the causative agent of Bovine Genital Campylobacteriosis, share virulence factor coding genes and are both inhabitants of the bull preputial mucosa, may suggest that this novel Campylobacter species has the potential to cause disease in cattle. The herd from which the isolate FMV-PI01 was obtained presented signs of reproductive failure compatible with Bovine Genital Campylobacteriosis, the reason for the disease investigation. As in the above disease, where the bull acts as an asymptomatic carrier and signs of disease are only reflected on the female (embryonic and fetal mortalities) and herd (fertility rate, calving pattern and calving interval) sides [14], the bull from which the samples were taken was clinically sound. However, since several interacting factors may contribute to beef cattle herd’s infertility, one cannot conclude that the observed reproductive failure was the result of the infection with C. portucalensis sp. nov. To further investigate the pathogenic potential of C. portucalensis sp. nov in cattle fertility, research in the female reproductive tract needs to be addressed. The evaluation of the pathogenic potential based on the PathogenFinder analysis showed that the probability of isolate FMV-PI01 being a human pathogen was 82.6%, indicating that this isolate may have the potential to cause disease in humans.

Conclusion

The distinct phenotypic and genotypic characteristics of the bacterial isolates confirm the identification of a novel species within the Campylobacter genus, for which the name Campylobacter portucalensis sp. nov. is proposed. C. portucalensis sp. nov. is an inhabitant of bulls’ preputial mucosa with unknown pathogenic potential.

Description of Campylobacter portucalensis sp. nov

Campylobacter portucalensis sp. nov. (por.tu.cal.en’sis. N.L. masc. adj. portucalensis referring to Portugal, from where the type strain was originally isolated). In Columbia agar (supplemented with 5% sheep blood), after 48 hours in microaerobic atmosphere at 37°C, colonies are punctiform (1 mm in diameter), convex, circular with smooth margins and without any pigments. Colonies are non-haemolytic. Cells are Gram-negative, straight rods (length 1.68±0.07 μm and width 0.44±0.01 μm). A flagellum is absent and cells are non-motile. Occasional longer filamentous cells are observable. Growth is observed on blood agar at 37°C under microaerobic and anaerobic (weak growth), but not aerobic conditions. Does not require H2 supplementation to grow. Isolates grow in microaerobic conditions at 37°C and 42°C but not at 25°C. Strains may differ in their ability to grow on blood agar medium supplemented with 1% glycine. Growth is not observed on blood agar medium supplemented with 2% and 3.5% NaCl. Unable to grow on Macconkey agar or Mueller-Hinton agar. Phenotypically, C. portucalensis sp. nov. is oxidase positive and catalase negative. Negative for urease activity. Unable to hydrolyse hippurate and indoxyl acetate. Does not reduce nitrate. Does not produce hydrogen sulfide in TSI medium. The genomic G+C content of the type strain is 28.3%. The type strain FMV-PI01 (= LMG 31504, = CCUG 73856) was isolated from the reproductive tract of a bull (Bos taurus) sampled in the Alentejo province of Portugal in 2018.
  61 in total

1.  Base composition bias might result from competition for metabolic resources.

Authors:  Eduardo P C Rocha; Antoine Danchin
Journal:  Trends Genet       Date:  2002-06       Impact factor: 11.639

2.  Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells.

Authors:  M E Konkel; B J Kim; V Rivera-Amill; S G Garvis
Journal:  Adv Exp Med Biol       Date:  1999       Impact factor: 2.622

Review 3.  Global Epidemiology of Campylobacter Infection.

Authors:  Nadeem O Kaakoush; Natalia Castaño-Rodríguez; Hazel M Mitchell; Si Ming Man
Journal:  Clin Microbiol Rev       Date:  2015-07       Impact factor: 26.132

Review 4.  Campylobacter-Associated Diseases in Animals.

Authors:  Orhan Sahin; Michael Yaeger; Zuowei Wu; Qijing Zhang
Journal:  Annu Rev Anim Biosci       Date:  2016-11-09       Impact factor: 8.923

Review 5.  Tissue culture and explant approaches to studying and visualizing Neospora caninum and its interactions with the host cell.

Authors:  Andrew Hemphill; Nathalie Vonlaufen; Arunasalam Naguleswaran; Nadine Keller; Michele Riesen; Nicole Guetg; Sangeetha Srinivasan; Ferial Alaeddine
Journal:  Microsc Microanal       Date:  2004-10       Impact factor: 4.127

6.  Campylobacter lanienae sp. nov., a new species isolated from workers in an abattoir.

Authors:  J M Logan; A Burnens; D Linton; A J Lawson; J Stanley
Journal:  Int J Syst Evol Microbiol       Date:  2000-03       Impact factor: 2.747

7.  Maximal adherence and invasion of INT 407 cells by Campylobacter jejuni requires the CadF outer-membrane protein and microfilament reorganization.

Authors:  Marshall R Monteville; Julie E Yoon; Michael E Konkel
Journal:  Microbiology (Reading)       Date:  2003-01       Impact factor: 2.777

8.  Prevalence of Campylobacter spp. in cattle in Finland and antimicrobial susceptibilities of bovine Campylobacter jejuni strains.

Authors:  Marjaana Hakkinen; Helmi Heiska; Marja-Liisa Hänninen
Journal:  Appl Environ Microbiol       Date:  2007-03-16       Impact factor: 4.792

9.  Campylobacter insulaenigrae sp. nov., isolated from marine mammals.

Authors:  Geoffrey Foster; Barry Holmes; Arnold G Steigerwalt; Paul A Lawson; Petra Thorne; Dorothy E Byrer; Harry M Ross; Jacqueline Xerry; Paul M Thompson; Matthew D Collins
Journal:  Int J Syst Evol Microbiol       Date:  2004-11       Impact factor: 2.747

10.  PathogenFinder--distinguishing friend from foe using bacterial whole genome sequence data.

Authors:  Salvatore Cosentino; Mette Voldby Larsen; Frank Møller Aarestrup; Ole Lund
Journal:  PLoS One       Date:  2013-10-28       Impact factor: 3.240

View more
  4 in total

1.  Genomic and Phenotypic Characterization of Campylobacter fetus subsp. venerealis Strains.

Authors:  Marta F Silva; Ana L Pereira; Maria J Fraqueza; Gonçalo Pereira; Luísa Mateus; Luís Lopes-da-Costa; Elisabete Silva
Journal:  Microorganisms       Date:  2021-02-09

2.  Association of Broiler Litter Microbiome Composition and Campylobacter Isolation.

Authors:  Robert Valeris-Chacin; Maria Pieters; Haejin Hwang; Timothy J Johnson; Randall S Singer
Journal:  Front Vet Sci       Date:  2021-05-24

3.  Molecular diagnosis of bovine genital campylobacteriosis using high-resolution melting analysis.

Authors:  Marta Filipa Silva; Sabine Kienesberger; Gonçalo Pereira; Luísa Mateus; Luís Lopes-da-Costa; Elisabete Silva
Journal:  Front Microbiol       Date:  2022-09-09       Impact factor: 6.064

4.  Assessment of Campylobacter fetus subsp. venerealis molecular diagnosis using clinical samples of bulls.

Authors:  Marta Filipa Silva; Ana Duarte; Gonçalo Pereira; Luísa Mateus; Luís Lopes-da-Costa; Elisabete Silva
Journal:  BMC Vet Res       Date:  2020-10-29       Impact factor: 2.741

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.