Literature DB >> 31915512

Coenzyme Q10 Regulation of Apoptosis and Oxidative Stress in H2O2 Induced BMSC Death by Modulating the Nrf-2/NQO-1 Signaling Pathway and Its Application in a Model of Spinal Cord Injury.

Xing Li1,2,3, Jiheng Zhan1,2,3, Yu Hou1,2,3, Yonghui Hou1,2,3, Shudong Chen1,2,3, Dan Luo1,2,3, Jiyao Luan1,2,3, Le Wang4, Dingkun Lin1,2,3.   

Abstract

Spinal cord injury (SCI) has always been considered to be a devastating problem that results in catastrophic dysfunction, high disability rate, low mortality rate, and huge cost for the patient. Stem cell-based therapy, especially using bone marrow mesenchymal stem cells (BMSCs), is a promising strategy for the treatment of SCI. However, SCI results in low rates of cell survival and a poor microenvironment, which limits the therapeutic efficiency of BMSC transplantation. Coenzyme Q10 (CoQ10) is known as a powerful antioxidant, which inhibits lipid peroxidation and scavenges free radicals, and its combined effect with BMSC transplantation has been shown to have a powerful impact on protecting the vitality of cells, as well as antioxidant and antiapoptotic compounds in SCI. Therefore, we aimed to evaluate whether CoQ10 could decrease oxidative stress against the apoptosis of BMSCs in vitro and explored its molecular mechanisms. Furthermore, we investigated the protective effect of CoQ10 combined with BMSCs transplanted into a SCI model to verify its ability. Our results demonstrate that CoQ10 treatment significantly decreases the expression of the proapoptotic proteins Bax and Caspase-3, as shown through TUNEL-positive staining and the products of oxidative stress (ROS), while increasing the expression of the antiapoptotic protein Bcl-2 and the products of antioxidation, such as glutathione (GSH), against apoptosis and oxidative stress, in a H2O2-induced model. We also identified consistent results from the CoQ10 treatment of BMSCs transplanted into SCI rats in vivo. Moreover, the Nrf-2 signaling pathway was also investigated in order to detail its molecular mechanism, and the results show that it plays an important role, both in vitro and in vivo. Thus, CoQ10 exerts an antiapoptotic and antioxidant effect, as well as improves the microenvironment in vitro and in vivo. It may also protect BMSCs from oxidative stress and enhance their therapeutic efficiency when transplanted for SCI treatment.
Copyright © 2019 Xing Li et al.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31915512      PMCID: PMC6930770          DOI: 10.1155/2019/6493081

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Spinal cord injury (SCI) has always been considered as a devastating problem that results in catastrophic dysfunction, high disability rate, low mortality rate, and huge cost for the patients. It not only affects the physical and mental health of patients but is also an economic burden on the family [1-3]. At present, although various pharmacological therapies are used for SCI, functional recovery is still uncertain [4-6]. Recently, stem cell-based therapy, especially with the use of bone marrow mesenchymal stem cells (BMSCs), has been shown to be a promising SCI therapy strategy [7-9]. Numerous previous studies have illustrated the manner by which BMSC therapy in a dose-dependent manner improves the functionality in rat, rabbit, monkey, and even human models of SCI [8, 10–12]. However, low cell survival rates in a poor microenvironment have been observed after SCI treatment using BMSCs, which limit its therapeutic efficiency [13]. Oxidative stress is a critical factor that contributes to the development of a poor microenvironment during the progression of SCI [14, 15]. Therefore, methods that can be used to decrease oxidative stress, reduce apoptosis, and increase the vitality of the transplanted BMSCs are important factors that need to be researched in order to develop efficient treatment strategies for SCI [16]. Coenzyme Q10 (CoQ10) is known to be a powerful antioxidant, which inhibits lipid peroxidation and scavenges free radicals [17, 18]. Under treatment of SCI, some studies have shown that CoQ10 reduces the level of oxidative injury and antiapoptosis [19-22]. Medication combined with BMSC transplantation has been shown to have a powerful impact on protecting the vitality of cells and antioxidant and antiapoptotic compounds in SCI [23, 24]. However, the method by which CoQ10 treatment can be combined with BMSC transplantation in SCI is still unclear. Therefore, in this study, we aimed to evaluate whether CoQ10 could decrease oxidative stress and prevent the apoptosis of BMSCs in vitro, as well as explore its molecular mechanisms. Furthermore, we investigated the protective effect of CoQ10 combined with BMSC transplantation in a SCI model to verify its viability.

2. Materials and Methods

2.1. Materials

Male Sprague Dawley (SD) rats were supplied by the Guangzhou University of Chinese Medicine (Guangzhou, China). All procedures were performed in accordance with the animal guidelines of the Guangzhou University of Chinese Medicine. The study was approved by the ethics committee of Guangzhou University of Chinese Medicine. α-Modified Eagle's medium (α-MEM), fetal bovine serum (FBS), and trypsin were purchased from Gibco-BRL (NY, USA). A WST-1 cell proliferation and cell viability detection kit was obtained from Nanjing KeyGen Biotech Co. (Nanjing, China). Malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione (GSH) assays were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). CoQ10 (purity > 98% using HPLC) was purchased from Sigma-Aldrich (St. Louis, MO, USA), dissolved in DMSO (St. Louis, MO, USA), and diluted in a culture medium. The final concentration of the DMSO was 0.1%.

2.2. Cell Isolation and Treatment

Rat BMSC isolation was performed by collecting the cells from the bone marrow of the femurs and tibiae of 4-week-old rats, as previously described [25]. The BMSCs were plated into culture dishes containing α-MEM supplemented with 10% FBS, at 37°C in a humidified 5% CO2 environment. The culture medium was changed every other day. BMSCs from passages 3 to 5 were used for all experiments. The cells were pretreated with CoQ10 for 2 h and then cotreated with H2O2 (300 μM) for 24 h.

2.3. Immunophenotypical Analysis of BMSCs

BMSCs at a density of 3 × 105 cells were used for the phenotypic analysis using flow cytometry [26]. In brief, the cells were stained with phycoerythrin- (PE-) labeled primary antibodies against CD11, CD73, and the corresponding isotype control antibody of rat IgG1, in the dark at room temperature, and then fixed in 1% paraformaldehyde (PFA), after being washed twice with ice-cold PBS. Surface maker expression and the purity of the cells were detected using flow cytometry.

2.4. Differentiation of the BMSCs

In order to analyze whether the culture of BMSCs possesses multipotent differentiation ability in vitro, passage 3 BMSCs were cultured in a chondrogenic induction medium containing 0.3% ascorbic acid, 0.01% dexamethasone, 0.1% sodium pyruvate, 1% insulin-transferrin-selenium+premix, 0.1% proline, and 1% TGF-β3 or an osteogenic induction medium containing 1% β-glycerophosphate, 0.01% dexamethasone, and 0.2% ascorbic acid for 2 weeks. The induction medium was changed every 3 days. After differentiation, the cells were fixed with 4% PFA for 20 min for alkaline phosphatase staining, alizarin red staining, and alcian blue staining. After being washed three times in PBS, representative photographs were captured under a microscope.

2.5. Cell Viability Assay

Cell viability was evaluated using a WST-1 assay [27]. In brief, BMSCs were seeded into a 96-well plate at a density of 1 × 104/well. The cells were then pretreated with various concentrations of CoQ10 for 2 h, followed by coincubation with H2O2 for 24 h. After incubation, 10 μl of WST-1 solution was added into each well of the plate and left to incubate for another 2 h at 37°C. Absorbance was then measured at a wavelength of 450 nm, using a microplate reader (Bio-Rad, USA). All experiments were performed in triplicate.

2.6. LDH Assay

Cell cytotoxicity was determined using a LDH assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). LDH was released into the culture medium as a result of cell membrane intact damage caused by H2O2. After treatment, the cell culture medium was analyzed as instructed by the manufacturer. Absorbance was measured at 450 nm, using a microplate reader (Bio-Rad, USA). All experiments were performed in triplicate.

2.7. Flow Cytometric Evaluation of Apoptosis

After treatment, the apoptotic cells were fluorescently labeled using an Annexin V-FITC apoptosis detection kit (Roche Applied Science, Basel, Switzerland), by following the manufacturer's instructions. In brief, BMSC pellets were collected and washed twice with cold PBS and gently resuspended in 500 μl of a binding buffer containing 5 μl of Annexin V-FITC and 5 μl of PI for 15 min at room temperature. Then, the samples were analyzed using flow cytometry (BD Biosciences).

2.8. TUNEL Assay

The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed using a TUNEL cell apoptosis detection kit (Roche Applied Science, USA), by following the manufacturer's instructions. DAPI was used to stain the nuclei. The results were captured using fluorescence microscopy (Olympus, Japan).

2.9. RT-qPCR Analysis

After treatment, total RNA was extracted using a TRIzol reagent (Invitrogen, USA), by following the manufacturer's instructions. The First-Strand cDNA Synthesis Kit along with a PrimeScript RT reagent kit (TaKaRa Biotechnology Co. Ltd., Japan) was used to conduct RT-PCR analysis on a SYBR green system (Toyobo, Japan Ltd., Japan). The primer sequences used are given in Table 1.
Table 1

Primers used for target amplification in this study.

NamePrimerAccession numberSequence (5′-3′)
BaxForwardNM_017059.2CACCAGCTCTGAACAGATCA
ReverseATCGCCAATTCGCCTGAGAC

Caspase-3ForwardXM_006253130.3CGATTATGCAGCAGCCTCAA
ReverseAGGAGATGCCACCTCTCCTT

Bcl-2ForwardNM_016993.1CTGTGGATGACTGAGTACCTGAAC
ReverseAGAGACAGCCAGGAGAAATCAAAC

GAPDHForwardXM_017592435.1CAAGTTCAACGGCACAGTCAAG
ReverseACATACTCAGCACCAGCATCAC

2.10. Measurement of Oxidative Stress

Intracellular ROS generation was measured using H2DCF-DA (Sigma Aldrich), as reported [28], while the level of GSH was determined using a GSH assay kit, by following the manufacturer's instructions.

2.11. Western Blotting Analysis

Western blotting experiments were performed following standard methods [27]. In brief, the proteins were loaded onto 10% SDS-PAGE and electrotransferred onto polyvinylidene difluoride membranes (Millipore, USA). The membranes were incubated with primary antibodies against Bax and Caspase-3 (1 : 1,000, Cell Signaling Technology), as well as Bcl-2, NQO-1 (1 : 1000 dilution, Abcam, UK), and Nrf-2 (1 : 1,000, R&D), overnight at 4°C, followed by sequential incubation with the secondary antibodies conjugated with horseradish peroxidase (HRP) (1 : 1000, Cell Signaling Technology), at room temperature for 2 h. GAPDH (1 : 1000 dilution, Abcam, UK) was used as the internal reference. Quantified densitometric analysis was conducted using an ImageQuant LAS 4000 mini detection system (GE Healthcare, Buckinghamshire, UK), and the results were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD).

2.12. Experimental SCI Model and BMSC Transplantation

Fifty adult male SD rats weighing 200-250 g were randomly divided into 5 groups (n = 10 per group): (1) the sham group, (2) the SCI model group, (3) the BMSC group, (4) the CoQ10 group, and (5) the CoQ10+BMSC group. A SD rat SCI model was induced with a moderate contusion based on Allen's method, as previously described [29]. In brief, SD rats were anesthetized with sodium pentobarbital (40 mg/kg, i.p.). Then, the incision area was shaved, and a laminectomy was performed at T9-T10 levels, under sterile conditions. After exposing the spinal cord surface with an intact dura, a 10 g weight impactor (diameter, 2 mm) was dropped from a height of 50 mm onto the exposed dura at the T10 level. Successful induction of SCI led to spinal cord congestion, tail swing reflexes, swaying of legs, and slow paralysis. Each rat was provided with bladder pressing 3 times daily. 3 days after SCI induction, the rats in the BMSC group and CoQ10+BMSC group were injected with BMSCs through the tail vein. CoQ10 (20 mg/kg) was orally administered for 2 days before surgery and continued until the rats were sacrificed. Similar procedures and treatments were performed on all vehicle groups. All SD rats were sacrificed 1 week postsurgery.

2.13. MDA, SOD, and GSH Assays

Following the manufacturer's instructions for the MDA, SOD, and GSH assays, the liquid supernatant of the spinal tissue samples was obtained for measurement. The MDA levels were determined at 532 nm, the SOD activity was measured at 550 nm, and GSH levels were determined at 420 nm, using a microplate reader (Bio-Rad, USA). All experiments were performed in triplicate.

2.14. Immunohistochemical Analysis

The rats were anesthetized and then perfused transcardially using ice-cold PBS followed by 4% PFA for 30 min. A 10 mm segment at the center lesion site of the spine was collected for experiments. The samples were cut into serial crosswise sections with a thickness of 4 μm, using a cryostat microtome (Leica RM2016; Leica Instruments, Heidelberg, Germany). The spine tissues were treated with 3% hydrogen peroxide to block endogenous peroxidase and were incubated with 2% normal goat serum [30]. The sections were incubated overnight with Caspase-3 (1 : 50 in PBS, Cell Signaling Technology) at 4°C. The sections were then washed with PBS and incubated with secondary antibodies. Specific labeling was detected using biotin-conjugated goat anti-rabbit IgG and avidin-biotin peroxidase complex (Vector Laboratories, DBA). Images were captured under fluorescence microscopy (Olympus DP80, Japan). Positive staining quantitative analysis was performed using ImageJ software (National Institutes of Health, Bethesda, MD).

2.15. Statistical Analysis

Data are expressed as mean ± standard deviation. Statistical analyses were performed using SPSS version 16.0 software (SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) or Student's t-test was used to identify differences among groups. A P value of <0.05 was considered statistically significant.

3. Results

3.1. Characterization of BMSCs

During the initial phase, BMSCs were found to show a fibroblast-like shape with colonies and floating cells in the culture (Figure 1(a)). The presence of floating cells was completely abolished at passage 3 (Figure 1(b)). The results of the flow cytometry analysis show that 92.8% of cells express CD73 and only 0.2% cells express CD11 (Figures 1(c)–1(e)). The BMSCs were found to have a multipotent ability of differentiating into chondrogenic/osteogenic cells upon induction (Figures 1(f)–1(h)).
Figure 1

Morphologies, phenotypic characterizations, and differentiation of BMSCs. (a) Representative fields of BMSC morphologies at the primary passage (A) and passage 3 (B). (b) The phenotypic characterizations of BMSCs were identified with the corresponding isotype control (C), CD11 (0.2%) (D), and CD73 (92.8%) (F). (c) The differentiation of BMSC analysis: alcian blue staining (F), alizarin red staining (G), and alkaline phosphatase staining (H).

3.2. Protective Effects of CoQ10 on BMSCs Exposed to H2O2

The viability of BMSCs under H2O2 induction was found to range from 100 to 500 μM within the 24 h period. The chosen concentration of 300 μM H2O2 was found to result in the death of approximately 50-60% of cells (Figure 2(b)). In order to study the protective effect of CoQ10 on H2O2-induced BMSC death, WST-1 and LDH assays were performed. The results show that CoQ10 significantly enhances cell viability (Figures 2(c) and 2(d)) and decreases cell death (Figure 2(e)).
Figure 2

Effects of CoQ10 on the viability of H2O2-induced BMSCs. Cells were pretreated with different concentrations (20, 40, and 80 μM) of CoQ10 for 2 h followed with H2O2 (300 μM) for 24 h. (a) Structure of CoQ10. (b) Cells were cultured with different concentrations (100-500 μM) of H2O2 for 24 h. (c) Cells were cultured with different times (12-24 h) of H2O2 (300 μM). (d) The cell viability was determined by WST-1 assay. (e) The cell death was determined by LDH assay. Data are presented as mean ± SEM. ∗P < 0.05 or ∗∗P < 0.01 compared with the control group. #P < 0.05 compared with the H2O2-induced alone group.

3.3. CoQ10 Protects BMSCs from Apoptosis Induced by H2O2

In order to investigate whether CoQ10 decreases H2O2-induced apoptosis of BMSCs, Annexin V/Propidium Iodide (PI) staining and TUNEL assay were used. The results show that only 4.73% ± 0.36 of Annexin V-FITC and PI-positive stained cells were detected in the control group and 12.78% ± 0.98 of positive cells were detected in the H2O2 group, while pretreatment with CoQ10 effectively decreased the apoptotic rate to 7.06% ± 0.43 (Figure 3(a)). These results correspond with that of the TUNEL assay (Figure 3(b)). Moreover, upregulation of the proapoptotic proteins Bax and Caspase-3 and downregulation of the antiapoptotic protein Bcl-2 were detected in the BMSCs after H2O2 induction, both at the protein and mRNA levels (Figures 3(c) and 3(d)), while pretreatment with CoQ10 significantly reversed this expression. Brusatol, a Nfr-2 signal inhibitor, was found to significantly block the protective effect of CoQ10 on H2O2-induced apoptosis.
Figure 3

CoQ10 alleviated H2O2-induced BMSC apoptosis. Cells were pretreated with CoQ10 (40 μM) for 2 h followed with H2O2 (300 μM) for 24 h. (a) Annexin V-FITC/PI assay was used to evaluate the apoptosis (A) control group, (B) CoQ10 group, (C) H2O2 group, (D) H2O2+CoQ10 group, and (E) H2O2+CoQ10+brusatol group. (b) TUNEL assays (with green fluorescence) measured the cell apoptosis. (c) The protein expression of Bax, Bcl-2, and Caspase-3 was measured by Western blot. (d) The gene expression of Bax, Bcl-2, and Caspase-3 was determined by real-time quantitative PCR. Data are presented as mean ± SEM. ∗P < 0.05 compared with the control group, #P < 0.05 compared with the H2O2-induced alone group, and &P < 0.05 compared with the CoQ10+H2O2-induced group.

3.4. CoQ10 Decreases the Antioxidative Effects Exerted on BMSCs

In order to confirm the protective effect exerted by CoQ10 on BMSCs as a result of decreased oxidative stress, we evaluated intracellular ROS (Figure 4(a)) and GSH (Figure 4(b)) levels. The results show that the level of ROS significantly increased in the H2O2-treated group but decreased after CoQ10 treatment. Accordingly, the levels of GSH and brusatol detected confirm the protective effect of CoQ10 on BMSCs against oxidative stress.
Figure 4

CoQ10 scavenges ROS produced by H2O2. (a) H2DCF-DA was used to determine the level of ROS induced by H2O2. (b) Quantitative analysis of DCF fluorescent intensity. (c) GSH assay kit was used to measure the level of GSH. Data are presented as mean ± SEM. ∗P < 0.05 or ∗∗P < 0.01 compared with the control group, #P < 0.05 compared with the H2O2-induced alone group, and &P < 0.05 compared with the CoQ10+H2O2-induced group.

3.5. CoQ10 Inhibits H2O2-Induced Apoptosis of BMSCs through the Nrf-2/NQO-1 Signaling Pathway

In order to explore whether the Nrf-2/ARE signaling pathway is involved in the protective effect of CoQ10 against oxidative stress and apoptosis, levels of Nrf-2 and NQO-1 proteins were measured using Western blotting. The results show that protein levels of Nrf-2 and NQO-1 had decreased significantly in the H2O2-treated group. However, after treatment with CoQ10, this effect was reversed (Figure 5). Furthermore, brusatol was able to partially block the protective effect of CoQ10 during H2O2-induced cytotoxicity.
Figure 5

CoQ10 protected BMSCs from H2O2-induced apoptosis and oxidative stress via the Nrf-2/NQO-1 signaling pathway. Cells were pretreated with CoQ10 (40 μM) for 2 h, followed by coincubation with H2O2 (300 μM) for 24 h. Data are presented as mean ± SEM. ∗P < 0.05 compared with the control group, #P < 0.05 compared with the H2O2-induced alone group, and &P < 0.05 compared with the CoQ10+H2O2-induced group.

3.6. Effects of BMSCs, CoQ10, and Their Combined Effect on Oxidative Stress in SCI

In order to evaluate the effect of BMSCs, CoQ10, and their combined effect on oxidative stress in SCI, the liquid supernatant of the spinal tissue samples was analyzed using SOD, MDA, and GSH assay kits. The results show that the expression of SOD and GSH had decreased and that the expression of MDA had increased in the SCI group and BMSC group. The administration of CoQ10 and the resulting combination significantly reversed levels of SOD, MDA, and GSH. These results indicate that treatment with CoQ10 and its combination with BMSCs significantly decrease oxidative stress in SCI (Figure 6).
Figure 6

CoQ10 decreased oxidative stress in a rat SCI model. (a) The level of SOD was measured by a SOD assay kit (b) The level of MDA was measured by a MDA assay kit. (c) The level of GSH was measured by a GSH assay kit. Data are presented as mean ± SEM. ∗P < 0.05 compared with the control group, #P < 0.05 compared with the SCI group, and &P < 0.05 compared with the BMSC group (n = 6).

3.7. Effects of BMSCs, CoQ10, and Their Combined Effect on Apoptosis in SCI

In order to investigate the effects of BMSCs, CoQ10, and their combined effect on apoptosis in SCI, the expression of the proapoptotic proteins Bax and Caspase-3 as well as the expression of the antiapoptotic protein Bcl-2 were detected in the spine tissue samples. The results show that the expression of the Bax and Caspase-3 proteins was upregulated and the expression of the Bcl-2 protein was downregulated in both the SCI group and the BMSC group. The administration of CoQ10 and the resulting combination significantly reversed these results (Figure 7(a)). Moreover, the immunohistochemistry assay also found similar results for the Caspase-3 protein (Figure 7(b)). These findings indicate that treatment with CoQ10 and its combined effect with BMSCs significantly decrease apoptosis in SCI.
Figure 7

CoQ10 reduced apoptosis in a rat SCI model. (a) The spine tissue sample protein expression of Bax, Bcl-2, and Caspase-3 was measured by Western blot. (b) Immunohistochemical analysis determined the Caspase-3 protein expression. (c) TUNEL staining of the cell apoptosis rate. Scale bar = 50 μm. Data are presented as mean ± SEM. ∗P < 0.05 compared with the control group, #P < 0.05 compared with the SCI group, and &P < 0.05 compared with the BMSC group (n = 6).

3.8. Effects of BMSCs, CoQ10, and Their Combined Effect on the Nrf-2/ARE Signaling Pathway in SCI

In order to examine whether the protective effects of BMSCs, CoQ10, and their combined effect on SCI are activated through the Nrf-2/NQO-1 signaling pathway, the levels of Nrf-2 and NQO-1 proteins in the spine tissue samples were measured. As shown in Figure 8, the protein levels of Nrf-2 and NQO-1 were found to have significantly decreased in both the SCI group and the BMSC group. However, these effects were found to be significantly reversed after the administration of CoQ10 and its combination with BMSCs (Figure 8). These findings indicate that the protective effect of BMSCs, CoQ10, and their combined effect in SCI is activated through the Nrf-2/NQO-1 signaling pathway.
Figure 8

Treatment with CoQ10 combining BMSC transplantation affects the Nrf-2/NQO-1 signaling pathway after SCI. The spine tissue sample protein expression of Nrf-2 and NQO-1 was measured by Western blot. Data are presented as mean ± SEM. ∗P < 0.05 compared with the control group, #P < 0.05 compared with the SCI group, and &P < 0.05 compared with the BMSC group (n = 6).

4. Discussion

Spinal cord injury (SCI) is one of the most devastating diseases and is still an unresolved event in medicine [2, 31, 32]. A large number of studies have already proven that treatment with BMSCs, which have an ability to differentiate into the neuronal-like cells, is an effective therapy for SCI [23, 33–35]. However, the survival rate of BMSCs after transplantation is low, as a result of the poor microenvironment produced in SCI, which limits its therapeutic efficiency. In the SCI microenvironment, oxidative stress plays a pivotal role and can lead to cellular damage and even cell apoptosis [36, 37]. In our present study, we demonstrate that CoQ10 exerts antioxidative and antiapoptotic effects in H2O2-induced oxidative injury, which imitates the poor microenvironment of SCI in vitro. In the H2O2-induced model, CoQ10 treatment was found to significantly decrease the expression of the proapoptotic proteins Bax and Caspase-3, as determined through TUNEL-positive staining and the products of oxidative stress (ROS), while increasing the expression of the antiapoptotic protein Bcl-2 and the products of antioxidation (GSH) against apoptosis and oxidative stress. We also found similar effects from CoQ10 treatment of BMSCs transplanted into SCI rats, which also showed decreased levels of oxidative products (MDA), Bax, and Caspase-3 and increased activities of antioxidant enzymes (SOD) and Bcl-2 in vivo. Moreover, the Nrf-2 signaling pathway was investigated in detail to reveal its molecular mechanism and the results show that it plays an important role during these processes, both in vitro and in vivo. Apoptosis is an important factor of cell inactivation, which is a phenomenon of cell death [38]. Members of the Bcl-2 family of proteins, including Bcl-2 and Bax proteins, play an important role in apoptosis. Bax, the proapoptotic protein, promotes caspase-induced apoptosis by enhancing cytochrome c release [39]. However, Bcl-2, the antiapoptotic protein, inhibits apoptosis by combining with Bax to form a heterodimer that decreases cytochrome c release [28]. Caspase-3, a caspase family member, can cause DNA fragmentation, which ultimately results in cell apoptosis [40, 41]. In our present study, the results show that the upregulation of Bax and Caspase-3 and the downregulation of Bcl-2 are both observed in the H2O2-induced BMSC model, as well as the rat SCI model. Furthermore, the BMSC transplantation model shows similar results to that of the rat SCI model. These findings are also consistent with that of previous research [24, 25, 42, 43]. However, these results are reversed by CoQ10 treatment, which indicates its antiapoptotic ability. Moreover, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining and immunohistochemistry analysis were also used to further confirm the antiapoptotic effects in vitro and in vivo, respectively. Together, these results indicate that CoQ10 exerts an antiapoptotic function, both in vitro and in vivo. Many previously published studies have shown that oxidative stress exerts critical impacts during the process of SCI [44, 45]. The definition of oxidative stress is the imbalance between oxidants (ROS and MDA) and antioxidants (GSH and SOD), which ultimately leads to cellular death [36]. ROS can cause lipid peroxidation, inactivation of proteins, and DNA fragmentation, ultimately resulting in apoptosis [46]. MDA, the ultimate product of lipid peroxidation, can directly trigger tissue damage [24]. GSH and SOD have an ability to scavenge free radicals, in order to exert antioxidative functions [47]. Consistent with results of previous research [24, 25, 48], an increase in levels of oxidative stress products (ROS and MDA) and a decrease in levels of antioxidants (GSH and SOD) were found in both the H2O2-induced BMSC and the SCI model. Treatment with CoQ10 was found to significantly decrease ROS production and increase the activity of GSH in the H2O2-induced BMSC model. In vivo, compared with the SCI and BMSC groups, decreasing levels of MDA and increasing levels of SOD and GSH were found in the CoQ10 treatment and combination groups. These findings indicate that CoQ10 has an ability to resist oxidative stress. In order to investigate the detailed molecular mechanism of antioxidation and antiapoptosis, the Nrf-2/NQO-1 signaling pathway was evaluated. The Nrf-2/NQO-1 signaling pathway plays a pivotal role in antioxidative stress. Nuclear factor erythroid 2-related factor 2 (Nrf-2), a transcription factor, is involved in the regulation of a number of ROS-detoxifying enzymes. NQO-1, a widely distributed FAD-dependent flavoprotein, accelerates obligatory two-electron reductions of nitroaromatics, quinones, azo dyes, and quinonimines. NQO-1 exerts highly effective antioxidant functions and performs a cytoprotective role [49]. When oxidative stress is exerted, Nrf-2 is liberated from Keap-1 and is translocated into the nucleus, where it combines with ARE and activates the ARE-dependent transcription of phase II and antioxidant defense enzymes, including heme oxygenase-1 (HO-1) and NAD (P)H:quinone acceptor oxidoreductase 1 (NQO-1), attenuating cellular oxidative stress [50, 51]. In the present study, we found that levels of Nrf-2 and NQO-1 proteins significantly decrease in both H2O2-induced BMSC death and the SCI rat model. These findings are consistent with previous research results [23, 25, 52]. However, treatment with CoQ10 significantly increases the levels of Nrf-2 and NQO-1 proteins, both in vitro and in vivo. These results indicate that CoQ10 exerts an antioxidant and antiapoptotic function via the Nrf-2/NQO-1 signaling pathway. In order to further evaluate the involvement of the Nrf-2/NQO-1 signaling pathway, a unique inhibitor of the Nrf-2 pathway, brusatol, was used [53]. The results show that brusatol reverses the protective effect and downregulates the expression of Nrf-2/NQO-1 proteins in vitro. These results indicate that the Nrf-2/NQO-1 signaling pathway is involved in the antioxidant and antiapoptotic effects of CoQ10 against H2O2-induced cell death. In the future study, we will use Nrf-2 and NQO-1 KO/KI models to further confirm that CoQ10 exerts an antioxidant and antiapoptotic function via the Nrf-2/NQO-1 signaling pathway. In conclusion, our results indicate that CoQ10 exerts an antiapoptotic and antioxidant effect against H2O2-induced BMSC death via activating the Nrf-2/NQO-1 pathway in vitro. Moreover, CoQ10 also decreases oxidative stress and was found to improve the microenvironment in the rat SCI model. Therefore, it may be able to protect BMSCs from oxidative stress and enhance the therapeutic efficiency of BMSC transplantation for SCI treatment.
  53 in total

1.  Health Conditions: Effect on Function, Health-Related Quality of Life, and Life Satisfaction After Traumatic Spinal Cord Injury. A Prospective Observational Registry Cohort Study.

Authors:  Carly S Rivers; Nader Fallah; Vanessa K Noonan; David G Whitehurst; Carolyn E Schwartz; Joel A Finkelstein; B Catharine Craven; Karen Ethans; Colleen O'Connell; B Catherine Truchon; Chester Ho; A Gary Linassi; Christine Short; Eve Tsai; Brian Drew; Henry Ahn; Marcel F Dvorak; Jérôme Paquet; Michael G Fehlings; Luc Noreau
Journal:  Arch Phys Med Rehabil       Date:  2017-07-19       Impact factor: 3.966

2.  Berberine protects homocysteic acid-induced HT-22 cell death: involvement of Akt pathway.

Authors:  Meihui Chen; Min Tan; Minghua Jing; Anmin Liu; Qinyu Liu; Shijun Wen; Ziwei Chen; Xiaojuan Chao; Xixin He; Charles Ramassamy; Youheng Gao; Rongbiao Pi
Journal:  Metab Brain Dis       Date:  2014-07-23       Impact factor: 3.584

3.  Coenzyme Q10 Influences on the Levels of TNF-α and IL-10 and the Ratio of Bax/Bcl2 in a Menopausal Rat Model Following Lumbar Spinal Cord Injury.

Authors:  Sajad Hassanzadeh; Seyed Behnamedin Jameie; Maryam Soleimani; Mona Farhadi; Mahdieh Kerdari; Navid Danaei
Journal:  J Mol Neurosci       Date:  2018-06-14       Impact factor: 3.444

Review 4.  NAD(P)H:quinone acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector.

Authors:  Albena T Dinkova-Kostova; Paul Talalay
Journal:  Arch Biochem Biophys       Date:  2010-03-31       Impact factor: 4.013

5.  Traumatic spinal cord injury in the United States, 1993-2012.

Authors:  Nitin B Jain; Gregory D Ayers; Emily N Peterson; Mitchel B Harris; Leslie Morse; Kevin C O'Connor; Eric Garshick
Journal:  JAMA       Date:  2015-06-09       Impact factor: 56.272

6.  Longitudinal Prediction of Quality-of-Life Scores and Locomotion in Individuals With Traumatic Spinal Cord Injury.

Authors:  Shivayogi V Hiremath; Nathan S Hogaboom; Melissa R Roscher; Lynn A Worobey; Michelle L Oyster; Michael L Boninger
Journal:  Arch Phys Med Rehabil       Date:  2017-06-21       Impact factor: 3.966

7.  Bridging defects in chronic spinal cord injury using peripheral nerve grafts combined with a chitosan-laminin scaffold and enhancing regeneration through them by co-transplantation with bone-marrow-derived mesenchymal stem cells: case series of 14 patients.

Authors:  Sherif M Amr; Ashraf Gouda; Wael T Koptan; Ahmad A Galal; Dina Sabry Abdel-Fattah; Laila A Rashed; Hazem M Atta; Mohammad T Abdel-Aziz
Journal:  J Spinal Cord Med       Date:  2013-11-26       Impact factor: 1.985

Review 8.  Biochemical, physiological and medical aspects of ubiquinone function.

Authors:  L Ernster; G Dallner
Journal:  Biochim Biophys Acta       Date:  1995-05-24

9.  HSYA alleviates secondary neuronal death through attenuating oxidative stress, inflammatory response, and neural apoptosis in SD rat spinal cord compression injury.

Authors:  Jun-Peng Pei; Li-Hong Fan; Kai Nan; Jia Li; Xiao-Qian Dang; Kun-Zheng Wang
Journal:  J Neuroinflammation       Date:  2017-05-03       Impact factor: 8.322

10.  Human bone marrow-derived and umbilical cord-derived mesenchymal stem cells for alleviating neuropathic pain in a spinal cord injury model.

Authors:  Mahmoud Yousefifard; Farinaz Nasirinezhad; Homa Shardi Manaheji; Atousa Janzadeh; Mostafa Hosseini; Mansoor Keshavarz
Journal:  Stem Cell Res Ther       Date:  2016-03-08       Impact factor: 6.832

View more
  24 in total

1.  Characteristics of circRNAs expression profiles in the piglets intestine induced by oxidative stress.

Authors:  Zhi-Xin Li; Wei Chen; Ming Qin; Li-Xue Wang; Yong-Qing Zeng
Journal:  Genes Genomics       Date:  2021-08-27       Impact factor: 1.839

2.  Differential expression profiles of long noncoding RNAs and mRNAs in human bone marrow mesenchymal stem cells after exposure to a high dosage of dexamethasone.

Authors:  Tao Li; Yingxing Xu; Yingzhen Wang; Yaping Jiang
Journal:  Stem Cell Res Ther       Date:  2021-01-06       Impact factor: 6.832

3.  Icariin Promotes the Osteogenesis of Bone Marrow Mesenchymal Stem Cells through Regulating Sclerostin and Activating the Wnt/β-Catenin Signaling Pathway.

Authors:  Jianliang Gao; Shouyu Xiang; Xiao Wei; Ram Ishwar Yadav; Menghu Han; Weihao Zheng; Lili Zhao; Yichuan Shi; Yanming Cao
Journal:  Biomed Res Int       Date:  2021-01-22       Impact factor: 3.411

4.  Stability of Reduced and Oxidized Coenzyme Q10 in Finished Products.

Authors:  Žane Temova Rakuša; Albin Kristl; Robert Roškar
Journal:  Antioxidants (Basel)       Date:  2021-02-27

5.  Alfalfa saponins inhibit oxidative stress-induced cell apoptosis through the MAPK signaling pathway.

Authors:  Yalei Cui; Fen Li; Xiaoyan Zhu; Junying Xu; Abaidullah Muhammad; Yanyan Chen; Defeng Li; Boshuai Liu; Chengzhang Wang; Zhichang Wang; Sen Ma; Xule Liu; Yinghua Shi
Journal:  Redox Rep       Date:  2022-12       Impact factor: 4.412

Review 6.  Sirtuins: Potential Therapeutic Targets for Defense against Oxidative Stress in Spinal Cord Injury.

Authors:  Jialiang Lin; Zhencheng Xiong; Jionghui Gu; Zhuoran Sun; Shuai Jiang; Dongwei Fan; Weishi Li
Journal:  Oxid Med Cell Longev       Date:  2021-06-24       Impact factor: 6.543

7.  Polydatin promotes the neuronal differentiation of bone marrow mesenchymal stem cells in vitro and in vivo: Involvement of Nrf2 signalling pathway.

Authors:  Jiheng Zhan; Xing Li; Dan Luo; Yu Hou; Yonghui Hou; Shudong Chen; Zhifeng Xiao; Jiyao Luan; Dingkun Lin
Journal:  J Cell Mol Med       Date:  2020-04-16       Impact factor: 5.310

8.  Treatment of rats with spinal cord injury using human bone marrow-derived stromal cells prepared by negative selection.

Authors:  Lorenzo Romero-Ramírez; Siyu Wu; Johannes de Munter; Erik Ch Wolters; Boris W Kramer; Jörg Mey
Journal:  J Biomed Sci       Date:  2020-02-18       Impact factor: 8.410

9.  Inflammatory response and oxidative stress attenuated by sulfiredoxin‑1 in neuron‑like cells depends on nuclear factor erythroid‑2‑related factor 2.

Authors:  Zhiliang Wu; Zhenghao Lu; Jun Ou; Xiaotao Su; Jingnan Liu
Journal:  Mol Med Rep       Date:  2020-09-28       Impact factor: 2.952

10.  Sodium Tanshinone IIA Silate Exerts Microcirculation Protective Effects against Spinal Cord Injury In Vitro and In Vivo.

Authors:  Xing Li; Dan Luo; Yu Hou; Yonghui Hou; Shudong Chen; Jiheng Zhan; Jiyao Luan; Le Wang; Dingkun Lin
Journal:  Oxid Med Cell Longev       Date:  2020-10-08       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.