Literature DB >> 31914381

CD4+ T Follicular Helper Cells in Human Tonsils and Blood Are Clonally Convergent but Divergent from Non-Tfh CD4+ Cells.

Elena Brenna1, Alexey N Davydov2, Kristin Ladell3, James E McLaren3, Paolo Bonaiuti4, Maria Metsger2, James D Ramsden5, Sarah C Gilbert6, Teresa Lambe6, David A Price7, Suzanne L Campion8, Dmitriy M Chudakov9, Persephone Borrow10, Andrew J McMichael11.   

Abstract

T follicular helper (Tfh) cells are fundamental for B cell selection and antibody maturation in germinal centers. Circulating Tfh (cTfh) cells constitute a minor proportion of the CD4+ T cells in peripheral blood, but their clonotypic relationship to Tfh populations resident in lymph nodes and the extent to which they differ from non-Tfh CD4+ cells have been unclear. Using donor-matched blood and tonsil samples, we investigate T cell receptor (TCR) sharing between tonsillar Tfh cells and peripheral Tfh and non-Tfh cell populations. TCR transcript sequencing reveals considerable clonal overlap between peripheral and tonsillar Tfh cell subsets as well as a clear distinction between Tfh and non-Tfh cells. Furthermore, influenza-specific cTfh cell clones derived from blood can be found in the repertoire of tonsillar Tfh cells. Therefore, human blood samples can be used to gain insight into the specificity of Tfh responses occurring in lymphoid tissues, provided that cTfh subsets are studied.
Copyright © 2019 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  T follicular helper cells; TCR repertoire; blood; influenza; tonsil

Mesh:

Substances:

Year:  2020        PMID: 31914381      PMCID: PMC7029615          DOI: 10.1016/j.celrep.2019.12.016

Source DB:  PubMed          Journal:  Cell Rep            Impact factor:   9.423


INTRODUCTION

T follicular helper (Tfh) cells are specialized CD4+ T cells primarily found in germinal centers (GCs) of secondary lymphoid organs (Breitfeld et al., 2000; Kim et al., 2001; Schaerli et al., 2000). Tfh cells play a critical role in supporting B cell responses and selection of affinity-matured antibodies (Breitfeld et al., 2000; Bryant et al., 2007; Ma et al., 2009). They mediate their effects via receptor-ligand interactions with B cells and production of cytokines such as interleukin-21 (IL-21), IL-4, and the B-cell activating factor (BAFF), which induce survival and proliferation in B cells and support antibody class switching (Avery et al., 2008; Casamayor-Palleja et al., 1995; Liu et al., 1989). Expression of the chemokine receptor CXCR5 is fundamental for migration of pre-Tfh cells to the T-B cell border in lymphoid tissues and maturation of Tfh cells into B cell follicles and GCs along the follicular CXCL13 gradient (Ansel et al., 2000; Förster et al., 1996). In addition to CXCR5, Tfh cells also express PD-1 and ICOS (inducible T-cell costimulator) (Choi et al., 2011; Dorfman et al., 2006; Haynes et al., 2007; Xu et al., 2013). Some memory CD4+ T cells in secondary lymphoid organs express intermediate levels of these markers, but Tfh cells within the GC (Tfh GC cells) express high levels of CXCR5 and PD-1; hence, a CXCR5hiPD-1hi phenotype is commonly used to distinguish Tfh GC cells (Shi et al., 2018). Differences in expression of these surface markers reflect the location of CD4+ T cell sub-populations and their activation, differentiation, and functional status (Crotty, 2018). Populations of CD4+ memory T cells in the blood with similar characteristics as lymphoid Tfh cells are thought to represent circulating memory Tfh (cTfh) cells (Crotty, 2018; Hale and Ahmed, 2015). These peripheral cTfh cells express CXCR5, PD-1, and ICOS but at much lower levels than Tfh GC cells, although a minute population of circulating PD-1hiCXCR5hi CD4+ T cells can also be detected (He et al., 2013; Vinuesa et al., 2016). Although there is some controversy about phenotypic definition of cTfh cells, it is accepted that circulating CXCR5+CD4+ T cells promote immunoglobulin (Ig) class switching and plasmablast formation in co-culture with naive or memory B cells (Bentebibel et al., 2013; He et al., 2013; Locci et al., 2016; Morita et al., 2011). Different subsets of cTfh cells have been distinguished: Th1-like (CXCR3+CCR6−), Th2-like (CXCR3−CCR6−), and Th17-like (CXCR3−CCR6+) cTfh cells, based on similarities with canonical Th CD4+ cell subpopulations (Bentebibel et al., 2013; Morita et al., 2011). The diversity of cTfh cells is also evidenced by the differences in cytokine production and transcription factor expression observed when cTfh cell subsets are co-cultured with naive B cells in the presence of staphylococcal enterotoxin B (SEB). Th1-like subsets produce interferon γ (IFN-γ); Th2-like IL-4, IL-5, and IL-13; and Th17-like IL-17A and IL-22 (Bentebibel et al., 2013; Morita et al., 2011). The Th2- and Th17-like subsets of cTfh cells provide better B cell help in vitro than Th1-like cTfh cells (Boswell et al., 2014; Locci et al., 2013; Morita et al., 2011), and the transcriptional profile of CXCR3− cTfh cells shares a strong similarity with Tfh GC cells (Locci et al., 2013). In influenza virus infection, the human CD4+ T cell response is highly Th1-biased, and Th1-like (CXCR3+) cTfh cells help B cells produce virus-specific antibodies (Bentebibel et al., 2013; Pallikkuth et al., 2012). However, stimulation of Th1-like Tfh effector cells after infection or vaccination is associated with an inferior GC response and suboptimal antibody production (Bowyer et al., 2018; Cubas et al., 2015; Obeng-Adjei et al., 2015; Ryg-Cornejo et al., 2016). Difficulties in sampling secondary lymphoid organs in humans have hampered direct comparison of lymphoid and peripheral Tfh cell populations. Furthermore, the ontogeny of memory cTfh cells and their relationship with effector Tfh GC cells are still poorly understood. Although the phenotype (Chevalier et al., 2011; He et al., 2013) and transcriptional profile (Heit et al., 2017; Locci et al., 2013) of cTfh cell populations have been compared with Tfh GC cells, the extent of clonal convergence between these populations has not been fully explored. Phenotype and function are plastic features of CD4+ T cells, influenced by environmental stimuli, so the same cell type can show a different phenotypic profile in different compartments or under different cell culture conditions (Sallusto et al., 2018). It has been unclear whether cTfh cells originate from CXCR5− memory CD4+ T cells or from lymphoid tissue pre-Tfh or Tfh GC cells or whether they comprise a distinct lineage. Understanding the relationship between Tfh and non-Tfh cell populations in the blood and lymphoid tissues is very important for human studies, which typically investigate only peripheral blood because of the practical, ethical, and consensual barriers to accessing lymphoid tissues. The T cell receptor (TCR) is a fixed marker of clonotype. In this study, donor-matched tonsils and peripheral blood were collected from adult volunteers undergoing tonsillectomy, and the TCR repertoires of Tfh and non-Tfh cell subsets were determined. Considerable overlap was found between peripheral and tonsillar Tfh cells and a complete disparity between Tfh cells and CXCR5− memory CD4+ T cells. In addition, memory Tfh and non-Tfh cells from blood reactive with the hemagglutinin (HA) protein from influenza virus were studied (Alam and Sant, 2011; Fazilleau et al., 2007; Sant et al., 2018). HA-specific CD4+ memory T cells were enriched in CXCR3+ cTfh cells, and HA-specific cTfh cell clones could be found in the tonsillar CXCR3+ Tfh population, confirming the clonotypic overlap between peripheral and tonsillar Tfh cell populations in an antigen-specific context. Thus, human blood samples, which are readily accessible, can be used to gain insight into the specificity of Tfh cell responses occurring in GCs, but only when cTfh cell populations are analyzed.

RESULTS

Identification of Tonsillar and Circulating Tfh Populations in Donor-Matched Samples

Matched peripheral blood and tonsil samples from adult donors were studied to compare cTfh and tonsillar Tfh (tTfh) cell populations. Multi-parameter flow cytometry-based characterization of CD4+ memory T cell populations in peripheral blood mononuclear cells (PBMCs) and mononuclear cells from tonsils (MNC-Ts) was performed (Figure 1). We refer to all antigen-experienced (CD4+CD45RA−) cells as memory cells, although this definition encompasses central memory and effector memory/effector T cells, which we did not distinguish in this study. Expression of the Tfh markers CXCR5, PD-1, and ICOS and the chemokine receptor CXCR3 on CD4+CD45RA− memory T cells (identified as shown in Figure S1A) was evaluated (Figure 1A). A population with high expression of PD-1 and CXCR5 was observed only in tonsils and was not present in appreciable numbers in peripheral blood samples. CXCR3 and ICOS were also differently expressed among blood and tonsil CD4+ memory T cells (Figure 1B). In tonsils, populations with lower expression of CXCR5 and PD-1 had the highest proportion of CXCR3+ cells, whereas in blood, no significant difference was observed between CXCR5+/− and PD-1+/− subsets. In contrast, ICOS was maximally expressed in tonsil and blood populations with high expression of CXCR5 and PD-1, and it decreased as these two markers declined.
Figure 1.

Identification of Tonsillar and Circulating Tfh Populations in Donor-Matched Samples

Matched PBMC and MNC-T from adult donors were stained ex vivo.

(A) Dot plot illustrating the expression of CXCR5, PD-1, CXCR3, and ICOS within the total CD4+CD45RA− cells in a representative matched blood and tonsil sample pair.

(B) Heatmaps showing the mean percentage of CXCR3+ and ICOS+ cells within populations expressing different combinations of CXCR5 and PD-1 in 12 donors. The white crossed boxes indicate the near-absence of the PD-1hiCXCR5hi population in peripheral blood.

(C) Dot plot illustrating the gating strategy used to define populations of circulating CXCR5+PD-1+Tfh (cTfh CXCR3+, cTfh CXCR3−) and CXCR5− non-Tfh memory cells (cNon-Tfh) and tonsillar CXCR5hiPD-1hi GC Tfh (tTfh GC), CXCR5intPD-1int (tTfh CXCR3+, tTfh CXCR3−) Tfh and CXCR5−PD-1− non-Tfh memory cells (tNon-Tfh) within the total CD4+CD45RA− T cell pool in one representative donor.

(D) The percentage of each Tfh/non-Tfh subset within the CD4+CD45RA− memory T cell population in blood and tonsils from the 12 donors.

(E–G) Production of IL-21 (E), IL-4 (F), and IFN-γ (G) after PMA and ionomycin stimulation by Tfh and non-Tfh populations in 10 donors. Non-analogous subsets were compared within tonsil and peripheral blood using the Kruskal-Wallis test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Boxes show means and quartiles, and whiskers show minima and maxima.

See also Figure S1.

Subsets of CD4+ memory T cells were chosen for comparison based on the phenotypic observations made here and in prior studies (Boswell et al., 2014; Morita et al., 2011; Figure 1C). Within the CD4+CD45RA− population, cTfh CXCR3+ and cTfh CXCR3− subsets of CXCR5+PD-1+ cells and cNon-Tfh cells (CXCR5−) were identified in peripheral blood. In tonsils, tTfh GC cells were identified as PD-1hiCXCR5hi, in contrast to the intermediate level PD-1intCXCR5int population, in which tTfh CXCR3+ and tTfh CXCR3− cells were characterized, and tNon-Tfh (CXCR5−PD-1−) cells were also studied. Gates were set based on the expression of PD-1, CXCR5, and CXCR3 in CD4+CD45RA+ naive-enriched T cells (Figure S1B). Because PD-1 is often expressed by exhausted peripheral T cells and in Th17 CD4+ cells (Aschenbrenner et al., 2018; Day et al., 2006), we did not include this marker to gate on cNon-Tfh cells from blood to ensure that we were examining the entire non-Tfh memory population. The percentage of each population within CD4+CD45RA− T cells was evaluated in samples collected from 12 donors (Figure 1D). The Tfh GC subset was not found in appreciable numbers in peripheral blood, and Tfh subsets were less frequent in peripheral blood than in tonsils, whereas non-Tfh cells were more abundant. To define the functionality of phenotypically distinct Tfh cell subsets, cytokine production from each subset was evaluated ex vivo after phorbol 12-myristate 13-acetate (PMA) and ionomycin stimulation, by flow cytometry. Data from 10 donors showed that Tfh GC cells were the major producers of IL-21 (Figure 1E) and IL-4 (Figure 1F), both crucial cytokines for Tfh cell differentiation and B cell survival (Nurieva et al., 2008; Reinhardt et al.,2009; Yusuf et al., 2010). Production of IL-21 was lower in the other Tfh cell subsets and minimal in non-Tfh cells (Figure 1E). No significant differences in IL-4 production were observed between Tfh CXCR3+, Tfh CXCR3−, and non-Tfh cells from both tonsils and blood (Figure 1F). In line with the low expression of CXCR3 in Tfh GC cells, this population also exhibited minimal production of IFN-γ (Figure 1G), consistent with published data (Ma et al., 2009; Ploquin et al., 2011). In contrast, the major producers of IFN-γ were Tfh CXCR3+ subsets from both tissues along with peripheral non-Tfh cells, which include canonical Th1 phenotype cells known to be the highest producers of anti-viral cytokines within CD4+ cell subsets (Djuretic et al., 2007; Morita et al., 2011). Examples of cytokine staining for each cell subset are illustrated in Figures S1C–S1F.

Clonotypic Overlap between Peripheral and Tonsillar Tfh Cell Populations

To gain insight into the relationship between cTfh and tTfh populations, a TCR repertoire analysis was performed. The TCR clonotype sequence identifies clonal populations of T cells in different tissues. To compare the TCR repertoire of CD4+ memory T cell populations, thawed PBMCs and MNC-Ts from 4 matched donors were stained, and tTfh GC, tTfh CXCR3+, tTfh CXCR3−, and tNon-Tfh cells from tonsils and cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh cells from blood were separated by fluorescence-activated cell sorting (FACS) (8,000–123,000 cells per subset). RNA was extracted, and 5′ (RACE) unique molecular identifiers (UMI)-controlled sequencing of the CDR3 region of the TCR Vβ chain repertoire was performed. Because fewer TCRs were sequenced from lower-frequency cell subsets, the frequency of each clonotype within its parent population was normalized, and subsequent analysis was performed on the most frequent 2,000 clonotypes (top2000) in each sample. This approach enabled insight to be gained into repertoire sharing between the most abundant clones in each of the analyzed populations. The network analysis in Figure 2 illustrates the clonotypes shared between each population of blood CD4+ T cells (cTfh CXCR3− [Figure 2A], cTfh CXCR3+ [Figure 2C], and cNon-Tfh [Figure 2E]) and the different populations of tonsil (tTfh GC, tTfh CXCR3+, tTfh CXCR3−, and tNon-Tfh) cells without showing the connections between the tonsillar populations. The cTfh CXCR3− population showed the greatest clonotype sharing with tTfh GC; a total of 6.45% of clonotypes were found to be shared between these populations overall. This contrasts with findings from a recent study where no clonal overlap was observed between tTfh GC and the blood cTfh populations studied here (Hill et al., 2019), but it is consistent with another recent report indicating that thoracic duct T cells with a CXCR5high and PD-1high phenotype show TCR sharing with cTfh (Vella et al., 2019). A total of 3.25% of clonotypes were uniquely shared between cTfh CXCR3− and tTfh GC, whereas others were also co-shared with the tTfh CXCR3− subset, with which cTfh CXCR3− also showed clonotype sharing; 2.05% of clonotypes were shared between all 3 of these populations, whereas a further 2.15% of clonotypes were uniquely shared between the cTfh CXCR3− and tTfh CXCR3− subsets (Figure 2A). In contrast, cTfh CXCR3+ and cNon-Tfh populations each showed extensive repertoire overlap only with the tonsil CD4+ population to which they were phenotypically most closely related; 12.8% of clonotypes were uniquely shared between the cTfh CXCR3+ and tTfh CXCR3+ populations (Figure 2C), whereas cNon-Tfh cells uniquely shared 19.2% with tNon-Tfh cells (Figure 2E). The data shown in Figures 2A, 2C, and 2E are from donor 1, who underwent tonsillectomy for sleep apnea, ruling out T cell clonal distortions driven by repeated tonsil infections. However, the results obtained with the other donors were similar, and analysis of the percentage of clonotypes shared between populations in each of the 4 donors (shown in Figures 2B, 2D, and 2F) confirms the overlap between cTfh CXCR3− and both tTfh GC and tTfh CXCR3− populations (Figure 2B) and the extensive clonotype sharing of cTfh CXCR3+ with tTfh CXCR3+ cells (Figure 2D) and of cNon-Tfh with tNon-Tfh cells (Figure 2F). The heatmap (Figure 2G) displays the number of clonotypes shared between populations for all 4 donors.
Figure 2.

Clonotypic Overlap between Peripheral and Tonsillar Tfh Cell Populations

The top2000 TCR CDR3β nucleotide sequences in each population were analyzed using Cytoscape networking.

(A, C, and E) As an example, illustrated is clonotype sharing between peripheral blood cTfh CXCR3− (A), cTfh CXCR3+ (C), and cNon-Tfh (E) and 4 tonsillar populations: tTfh CXCR3+ in yellow, tTfh CXCR3− in blue, tTfh GC in red, and tNon-Tfh in gray in one representative donor (donor 1). Each square represents a different clonotype; the size of the square is proportional to the clonotype’s normalized frequency within the parent population (for shared clonotypes, the highest normalized frequency is shown). The number of clonotypes shared between different populations is shown in bold, and the respective percentage is indicated below.

(B, D, and F) To compare the overlap between blood cTfh CXCR3− (B), cTfh CXCR3+ (D), and cNon-Tfh (F) subsets and tonsillar populations, the percentage of the top2000 most frequent clonotypes shared between populations was calculated in each of the 4 donors (mean ± SEM). Non-parametric Kruskal-Wallis and Dunn’s multiple comparison tests: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

(G) A heatmap depicting the average number of clonotypes shared.

For a deeper TCR repertoire comparison, it was important to also consider the size of each clonotype (weighted analysis) to gauge the repertoire overlap in terms of cell numbers. For each tonsil and blood comparison, the normalized F2 metric of VDJtools (Shugay et al., 2013) was calculated. The F2 is the sum of the geometric means between the frequencies of shared clonotypes, the greater the F2 value between two subsets, the higher the number of T cells bearing the shared TCR variants (Izraelson et al., 2018). This analysis confirmed the repertoire similarity of cTfh CXCR3− with tTfh GC and tTfh CXCR3− populations and identified a connection between cTfh CXCR3− and tTfh CXCR3+ cells (Figure 3A). Likewise, the F2 metric also validated the overlap of cTfh CXCR3+ with tTfh CXCR3+ cells (Figure 3B) and the extensive overlap of cNon-Tfh with tNon-Tfh cells and identified weaker connections with tTfh populations (Figure 3C).
Figure 3.

Size Similarities in Clonotypes Shared between cTfh and tTfh

(A–C) Overlap between TCR CDR3β nucleotide sequences of the top2000 most frequent clonotypes of blood cTfh CXCR3− (A), cTfh CXCR3+ (B), and cNon-Tfh (C) populations with each tonsil population, as represented by the normalized F2 metric (mean ± SEM). Non-parametric Kruskal-Wallis and Dunn’s multiple comparison test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

(D–H) Linear regression analysis of the correlation between the within-population frequency of the shared clonotypes in the two parent populations where clonotype sharing between populations was observed: cTfh CXCR3− with tTfh GC (D), tTfh CXCR3− with cTfh CXCR3− (E), cTfh CXCR3− with tTfh CXCR3+ (F), cTfh CXCR3+ with tTfh CXCR3+ (G), and cNon-Tfh with tNon-Tfh (H). Each graph illustrates a representative donor, and the tables show the number of shared clonotypes, the square of the Pearson correlation coefficient (R2), the slope value for each donor, and the p value of the significance of the difference in the slope from zero (ns, not significant).

To better visualize the similarity between these two compartments, where clonotype sharing was observed, the frequencies of each shared clonotype were analyzed by linear regression. Although there was consistent overlap between cTfh CXCR3− and tTfh GC cells (Figure 3D), comparison of the relative sizes of clonotypes shared by the two different compartments was significant in only 2 of the 4 donors, with a low Pearson correlation coefficient (R2; 0.08 and 0.14). In all cases, the slope of the correlation was less than 1, indicating that, in tonsils, most of the clonotypes are more expanded than in the blood. A similar scenario was observed for cTfh CXCR3− versus tTfh CXCR3− subsets (Figure 3E) and cTfh CXCR3− versus tTfh CXCR3+ populations (Figure 3F). The correspondence between cTfh CXCR3+ and tTfh CXCR3+ populations remained the strongest; the sizes of the clonotypes shared between these populations were also very similar, significant (p < 0.0001) in 3 of the 4 donors (Figure 3G). For the cNon-Tfh and tNon-Tfh comparison, despite the high number of clonotypes shared (124–386), the size of the clonotypes was very different between blood and tonsils, making the linear correlation significant in only 1 of the 4 donors (Figure 3H).

Repertoire Diversity Correlates with the Degree of Clonotypic Overlap from the In Silico Resampling Analysis

To compare the repertoire diversity of each population, the non-parametric Chao1 index (Figure 4A) was calculated to estimate the richness of the number of unobserved elements in the set considered (Colwell et al., 2012; Eren et al., 2012). The normalized Shannon-Wiener index was also calculated to measure the entropy of each TCR sequence population (Figure 4B) based on the uncertainty of predicting the next sequence in a string. The two parameters describe the repertoire diversity from different perspectives; Chao1 is based on relative distributions of low-frequency clonotypes, whereas Shannon-Wiener takes into account large clonal expansions (Izraelson et al., 2018). Notably, an increase of diversity was observed in blood from cTfh CXCR3+ to cTfh CXCR3− and cNon-Tfh cells; likewise, in tonsils, tTfh GC cells were less diverse than tNon-Tfh subsets, which showed the highest value of both Chao1 and normalized Shannon-Wiener index values.
Figure 4.

Repertoire Diversity Correlates with the Degree of Clonotypic Overlap from the In Silico Resampling Analysis

(A and B) Chao1 index (A) and normalized Shannon-Wiener index (B) of the top2000 frequencies for each population of cells analyzed in blood and tonsils from the 4 donors (mean ± SEM). Clonotypes of each subset were resampled using the bootstrap method.

(C and D) The percentage of the top2000 shared clonotypes and the normalized F2 metric (mean ± SEM) of the overlap between the two replicates of blood (C) cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh as well as tonsil (D) tTfh GC, tTfh CXCR3+, tTfh CXCR3−, and tNon-Tfh populations is shown for all 4 donors (mean ± SEM). Non-parametric Kruskal-Wallis and Dunn’s multiple comparison test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

(E and F) Unweighted (E) and weighted (F) analysis of the replicate overlap at increasing numbers of clonotypes considered from a representative population (cTfh CXCR3+ from donor 1).

(G) The graphs show the linear regression correlation between the repertoire overlap, expressed either as percentage of shared clonotypes or normalized F2 metric, with both diversity indexes (Chao1 and normalized Shannon-Wiener) in all blood and tonsil populations from the 4 donors analyzed.

See also Figure S2.

To improve our understanding of the magnitude of the overlap observed between CD4+ T cell subsets in blood and tonsils, which was based on analysis of a limited number of cells from each population, an in silico replication using the bootstrap method was applied to re-sample the clonotypes in each subset. When re-sampling the same subset twice, populations from the blood (Figures 4C and S2A) showed, on average, an overlap between sampling 1 and sampling 2 of 50%, with cTfh CXCR3+ cells slightly higher (60%–70%). In tonsil populations (Figures 4D and S2A), the highest reproducibility was reported for tTfh GC cells, with decreasing levels of overlap observed for tTfh CXCR3+ and tTfh CXCR3− populations and the lowest with tNon-Tfh cells. A similar trend was reported from the weighted analysis represented by the F2 metric analysis. When increasing the number of clonotypes considered, the prediction did not reach complete overlap but, rather, a plateau of 60% of unweighted (Figure 4E) and 0.8 weighted (Figure 4F) analysis, respectively. As expected, the degree of overlap was inversely related to population diversity (Figure 4G) and was more pronounced for tonsils compared with blood, confirming that, when a population is less diverse, the degree of overlap on in silico resampling is higher. The overlap of the same population was also assessed experimentally in non-Tfh (Figure S2B) and Tfh cells (Figure S2C) from 3 additional donors and was found to be less than 30% for non-Tfh and less than 52% for Tfh subsets. These results show that, even when re-sampling exactly the same set of sequences or sequencing two vials of the same sorted population, the repertoire overlap is never complete (100% and F2 = 1), and it changes depending on the diversity of the subset considered and the size of the sample (Shugay et al., 2013). This implies that the degree of overlap observed experimentally is an underestimate, reflecting the relatively small sample size and reinforcing the conclusion that there is substantial repertoire overlap between blood and tonsil Tfh populations.

Tfh Cell Subsets Are Clonotypically Distinct from Non-Tfh Cells

Whether Tfh cells make up a distinct population of CD4+ T cells with a unique program of differentiation or are a subset of the memory CD4+ T cell compartment in a transient activation state is still debated (Baumjohann et al., 2013; Crotty, 2014; Herati et al., 2017; Vinuesa et al., 2005; Weber et al., 2015). A cytoscape networking analysis revealed only a very low level of TCR Vβ repertoire overlap between cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh populations in the blood compartment (Figure 5A). This was true for both comparisons of cTfh CXCR3+ versus cTfh CXCR3− (0.8%) and cTfh subsets versus cNon-Tfh (0.3%–1%) populations. In addition, very few clonotypes were shared between all 3 populations (0.2%). These results were consistent across all 4 donors analyzed (Figure S3). Similarly, tTfh cells (either CXCR3+, CXCR3−, or GC) were also notably distinct from the tNon-Tfh population (Figure 5B), with very little repertoire overlap (0.1%–0.3%). In contrast, the 3 tTfh populations showed considerable overlap with each other: tTfh CXCR3+ with tTfh CXCR3− and Tfh GC (0.8%–3.1%), tTfh CXCR3+ with tTfh GC (3.6%–7.4%), tTfh CXCR3− with tTfh GC (4%–14.9%), and tTfh CXCR3+ with tTfh CXCR3− (2.7%–6.3%) (Figure 5C). Although the extent of the repertoire overlap between the tTfh populations was variable in different donors, clonotype sharing between the 3 tTfh cell populations was observed in all 4 donors, especially between the tTfh CXCR3− and tTfh GC subsets. A normalized F2 metric analysis confirmed the overlap between tTfh CXCR3− and tTfh GC subsets and the repertoire distance between all tTfh populations and tNon-Tfh (Figure 5D). Despite the numerous clonotypes shared between tTfh CXCR3+ and tTfh CXCR3− (70–172), tTfh CXCR3+ and tTfh GC (89–214), and tTfh CXCR3− and tTfh GC (96–360), the relative immunodominance of the shared clonotypes differed substantially; the correlations were R2 < 0.36 and, in the majority of cases, not significant (Figure 5E).
Figure 5.

Tfh Cell Subsets Are Clonotypically Distinct from Non-Tfh Cells

The top2000 TCR Vβ CDR3 nucleotide sequences of each population were analyzed by Cytoscape networking.

(A and B) Examples of (A) clonotype sharing between peripheral blood cTfh CXCR3+ (yellow), cTfh CXCR3− (blue), and cNon-Tfh (gray) populations and (B) clonotype sharing between tonsillar populations tTfh CXCR3+ (yellow), tTfh CXCR3− (blue), tTfh GC (red), and tNon-Tfh (gray) populations in one representative donor (donor 1). Results are expressed as in Figure 2.

(C) The percentage of the top2000 total shared clonotypes in addition to the uniquely shared clonotypes between tonsil populations was calculated in each of the 4 donors (mean ± SEM).

(D) The normalized F2 metric of the top2000 frequencies was also calculated for the overlap between tTfh CXCR3+ and tTfh CXCR3− subsets and each of the other populations analyzed in the 4 donors (mean ± SEM). Non-parametric Kruskal-Wallis and Dunn’s multiple comparison test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

(E) The table shows the number of shared clonotypes, the square of R2 in their size within populations, the slope value, and the p value of the difference in the slope from zero.

See also Figure S3.

Influenza Virus HA-Specific Clones Are Predominantly Found in cTfh CXCR3+ and cNon-Tfh Populations

To compare the repertoire of antigen-specific Tfh and non-Tfh cells in peripheral blood and their representation in tonsil populations, responses to the HA protein H3 from influenza virus A/Wisconsin/67/2005 were studied (Alam and Sant, 2011; Fazilleau et al., 2007; Sant et al., 2018). To assess the relative abundance of memory CD4+ T cells reactive with HA protein, the T cell library method (Geiger et al., 2009) was used to determine the precursor frequency of HA-reactive cells in isolated memory CD4+ T cell populations and to characterize the cTfh and cNon-Tfh CD4+ memory repertoire in 3 healthy donors, samples from whom were obtained from the National Health Service (NHS) Blood Transfusion Service (Figure 6A). All 3 donors showed enrichment of HA-specific T cells in the cTfh CXCR3+ and cNon-Tfh populations. Few responding HA-specific cTfh CXCR3− cells were found, and they were only detected in donor A. The precursor frequency of antigen-specific cells per million was calculated within each subset (Figure 6B). Donors A and B showed the highest HA-specific precursor frequency in both cTfh CXCR3+ and cNon-Tfh populations (530–550 and 280–150 antigen-specific cells/million). The differences observed in the 3 donors analyzed likely reflects the diverse prior antigenic exposure of each individual.
Figure 6.

Influenza Virus HA-Specific Clones Are Predominantly Found in cTfh CXCR3+ and cNon-Tfh Populations

(A) T cell libraries generated from Tfh and non-Tfh subsets sorted from three healthy blood donors from the National Health Service (NHS) Blood Transfusion Service were tested against the influenza H3/Wisconsin HA protein. The proliferation of each individual cell line (increase in counts above background, delta cpm) is shown (mean ± SEM). The red dotted line represents the cutoff used for identification of a positive response (defined as >3000 cpm, with a stimulation index >5).

(B) Calculated precursor frequency of HA-specific cells per 106 cells in each subset (mean ± SEM).

(C) Bar graph showing the number of influenza H1/California HA-specific T cell clones generated from each cell subset in the 4 further donors from whommatched tonsil samples were available. Non-parametric Kruskal-Wallis and Dunn’s multiple comparison test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

(D) Epitopes recognized by HA-specific cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh clones were mapped, and the frequency of clones recognizing each peptide, normalized to the total frequency of HA-specific clones in all donors (D1, D2, D3, and D4), is plotted in the heatmap. The solid arrows highlight the peptides recognized by 3 subsets and the dashed arrows the peptides recognized by 3 donors.

See also Figure S4.

Having shown that HA-specific cTfh cells were present in peripheral blood, the antigen-specific cTfh repertoires of 4 further donors, from whom tonsil samples were available in addition to peripheral blood samples (donors 1,2,3, and 4), were compared with the entire repertoire of T cells in tonsillar cell subsets from the same individual. To confirm influenza virus exposure, plasma samples from the 4 donors were screened for the presence of HA-specific antibodies, evaluating immunoglobulin G (IgG) reactivity with HA protein from influenza virus strain A/California/07/2009, H1N1 (Figure S4A) and IgG reactivity with trivalent (H1, H3, and B) influenza vaccine 2017 (TIV) (Figure S4B) by ELISA. IgG antibodies reactive with both HA protein and TIV were detected in all 4 donors. Tfh cell clones specific for HA protein (H1) were then generated from peripheral blood cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh populations of each donor. As shown in Figure 6C, the highest numbers of HA-specific clones were derived from either cTfh CXCR3+ or cNon-Tfh populations. These were the subsets in which antigen-specific cloning efficiency was greatest (Figure S4D). Based on the percentage of activated ICOS+CD25+ cells after 7 days of stimulation (Figure S4C) and the proportion of the clones generated from the activated populations that were subsequently confirmed to be HA-reactive by proliferation, it was possible to gain estimates of the number of HA-specific cells within each subset (Figure S4E) or within the CD4+ memory compartment (Figure S4F). The data confirmed that HA-specific T cells were enriched in the cTfh CXCR3+ and cNon-Tfh populations, whereas, as expected, only a few HA-specific cells were found in the cTfh CXCR3− compartment (Bentebibel et al., 2013; Pallikkuth et al., 2012). The epitopes recognized by HA-specific T cell clones were then mapped using a matrix of overlapping peptides from HA/California (H1). The data from cTfh CXCR3+ and cNon-Tfh clones highlighted the breadth of HA epitopes recognized in each donor and suggested a difference in the pattern of epitopes recognized by cTfh and cNon-Tfh subsets because only a few peptides per donor were recognized by all three types of cells (Figure 6D, solid arrows). Epitopes recognized by at least 3 donors are highlighted in Figure 6D with dashed arrows; peptide 433–450 was the most universally targeted, being recognized by cTfh CXCR3+ clones from donors 2, 3, and 4 and by cNon-Tfh clones from donors 1,2, and 3. The number of cTfh CXCR3− clones was low, and none of the clones recognized epitopes targeted in at least 3 donors, including peptides 433–450 and 441–458.

HA-Specific cTfh CXCR3+ T Cell Clonotypes Can Be Detected in the tTfh CXCR3+ Subset

To determine whether clones with the same peptide specificity also express the same TCR, the CDR3α and CDR3β gene transcripts of a subset of HA-specific clones from donors 1, 2, and 3 were sequenced (Figure 7A). These data showed that, when cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh cell clones were specific for the same peptide (for example, peptide 225–242 for donors 1 and 2 and peptide 177–194 for donor 3), they did not share the same CDR3 region and were therefore clonotypically distinct. In some cases, even when 2 clones were specific for the same peptide and belonged to two different lineages, they used TCRα or TCRβ chains from the same family. For instance, in donor 2, clones 49 (cTfh CXCR3+), 1 (cTfh CXCR3−), and 42 (cNon-Tfh) specific for peptide 225–242 exhibited different CDR3a sequences, but all three TCRα chains belonged to the same TRAV23/DV6 family. Also, in donor 3, clones 1 (cTfh CXCR3+) and 1 (cTfh- CXCR3−) specific for peptide 177–194, which again had different CDR3α sequences, possessed TCRβ chains belonging to the same family (TRBV2). Additional sequences from donor 1 are shown in Figure S5A.
Figure 7.

HA-Specific cTfh and cNon-Tfh Clones Do Not Overlap, and HA-Specific cTfh CXCR3+ T Cell Clonotypes Can Be Detected in the tTfh CXCR3+ Subset

(A) TCR CDR3α and CDR3β sequencing was performed on clones specific for the same HA H1/California peptide that had been generated from either the cTfh CXCR3+, cTfh CXCR3−, or cNon-Tfh subset in 3 donors. For each clone, the peptide specificity, the CDR3α and CDR3β amino acid (AA) sequences, and TRAV/TRAJ and TRBV/TRBJ gene usage are shown. Clones are grouped based on the peptide recognized.

(B and C) The TCR CDR3α and CDR3β region sequences of 75 HA-specific clones generated from the blood populations were determined, and the ex vivo Vα and Vβ repertoires of tonsil and blood Tfh and non-Tfh populations from the same subject were searched for matching sequences. Matches were detected only in donor 2. The frequency distributions of each of the individual clonotypes detected in the tonsil tTfh CXCR3+ (B) and peripheral blood cTfh CXCR3+ (C) repertoires are shown, with yellow circles indicating the sequences that matched those of the HA-specific cTfh CXCR3+ clones generated from the peripheral blood of the same donor.

See also Figure S5.

We next investigated whether the TCRα or TCRβ chain sequences identified in HA-specific T cell clones were detectable in the overall repertoire of CD4+ T cell subsets from both tonsils and peripheral blood, which had been evaluated by non-paired sequencing of αβ TCRs. Because both the TCRα and TCRβ chain of each HA-specific T cell clone were available, it was possible to determine the presence or absence of each clonotype on the basis of detection of both chains in the subsets analyzed. Although only 75 HA-specific clones were sequenced, 3 cTfh CXCR3+ clones from donor 2 were found in the tTfh CXCR3+ repertoire from the same donor (Figure 7B), and two clones, also from donor 2, were detected in the cTfh CXCR3+ subset (Figure 7C). The tables show the frequency of the clonotype of interest observed in tonsils (Figure S5B) and in blood (Figure S5C) for both TCR chains. The presence of HA-specific Tfh clones initially derived from PBMCs in the tTfh CXCR3+ repertoire of the same donor confirmed the direct relationship between antigen-specific circulating and tTfh cells.

DISCUSSION

This work analyses the clonotypic overlap of Tfh cell subsets from peripheral blood and tonsillar cell populations. Repertoire sharing was selectively detected between blood and tonsillar populations with similar phenotypic characteristics, defined as cTfh CXCR3+ and tTfh CXCR3+, cTfh CXCR3− and tTfh GC/tTfh CXCR3−, and cNon-Tfh and tNon-Tfh subsets. These results suggest that, in a steady-state condition, the clonal composition of the CXCR5+PD-1+ circulating cTfh population reflects that of tonsil-resident tTfh cells. The TCR repertoire analysis also provided evidence of a clear distinction between Tfh and non-Tfh cell populations. These observations were confirmed by a parallel analysis of antigen-specific T cell clones recognizing HA from influenza virus. Therefore, separation of Tfh cells from the total memory CD4+ T cell pool is necessary to investigate the specificity of the follicular T cell response. In line with previous observations, Tfh GC cells (CXCR5hiPD-1hi) were the major sources of IL-21 and IL-4 and were only present in tonsils (Dan et al., 2019; He et al., 2013; Heit et al., 2017; Locci et al., 2013). The presence of effector Tfh GC cells in tonsils suggested a probable ongoing immune response in this tissue (Baumjohann et al., 2013; Hansen et al., 2017; Havenar-Daughton et al., 2016), which was likely driven by residual antigen from prior infections because antigen can persist for months or years on follicular dendritic cells in draining lymph nodes (Tew and Mandel, 1979; Tew et al., 1984), We showed that Tfh GC cells are enriched in CXCR3− cells and produced little IFN-γ (Maet al., 2009; Ploquin et al., 2011). The lack of CXCR3 expression by Tfh GC cells is consistent with their specific effector function inside the GC, where they do not need to directly face inflammation but actively participate in formation of neutralizing antibodies (Djuretic et al., 2007; He et al.,2013). Phenotypic features highlighted similarities, in particular between tTfh CXCR3+ and cTfh CXCR3+ subsets, but also heterogeneity between blood and tonsil populations (Chevalier et al., 2011; He et al., 2013). These differences may be driven by stimuli present in the respective local environments (Wong et al., 2016) and reflect selective recruitment, retention, or differentiation of populations at particular sites (Durand et al., 2019). To better determine the relationship between circulating and tTfh cell populations, we explored TCR repertoires, given that a cell’s TCR does not change with cellular location or differentiation. The vast TCR diversity within each individual (estimated at 108) and the number of cells sequenced per sample (103–105) always constrains TCR repertoire studies and poses caveats requiring the use of technical or in silico replicates to confirm the primary observations. However, TCR deep sequencing highlighted correlations between tonsil and blood Tfh and non-Tfh populations. Although RNA-based TCR sequencing provides relatively good repertoire coverage, it is not possible to calculate the absolute frequency of each clonotype with the analyzed populations (Heather et al., 2018; Rosati et al., 2017). However, we combined both weighted (the F2 metric) and unweighted (percentage of shared clonotypes) analyses and observed similar trends, validating the repertoire overlap observed between populations. Effector Tfh GC cells from tonsils and tTfh CXCR3− cells showed a moderate repertoire overlap with cTfh CXCR3− cells from peripheral blood. Although a Tfh GC/cTfh CXCR3− relationship between tonsils and blood has been demonstrated previously in terms of gene expression (Locci et al., 2013), our analysis of donor-matched tissues directly demonstrates that the same Tfh clones are present in both tonsils and the blood CXCR5+PD-1+ cTfh compartment. The relatively modest overlap might be explained by the specific and localized role of Tfh GC cells during their effector phase in the GC (Groom and Luster, 2011). Consistent with this, we observed that shared clonotypes are more expanded in tonsils than in blood, suggesting selective retention of a locally expanded Tfh population. The clonotype sharing between tTfh GC and tTfh CXCR3− cells may reflect the fact that both are enriched for cells recognizing locally presented antigens, with Tfh GC potentially originating from or sharing common precursors with Tfh CXCR3− (Crotty, 2018; Locci et al., 2013). In contrast, the cTfh CXCR3− population probably has a much more promiscuous origin because it is likely to contain antigen-experienced Tfh cells that have exited from lymphoid tissues before or after becoming effector Tfh GC cells during both the ongoing and prior immune responses. It is also possible that cTfh cells are recruited from the periphery in response to local chronic infection in the tonsils. This study does not address the differentiation and generation of Tfh CXCR3+ cells, but the convergence in clonotypic repertoire observed between peripheral blood and tonsils was striking. This suggests high mobility of these types of cells from secondary lymphoid organs to the peripheral circulation or vice versa. The minor but consistent repertoire sharing between Tfh CXCR3+ and Tfh CXCR3− cells in tonsils may result from tTfh cell differentiation from one phenotype to the other or plasticity among CXCR3+ and CXCR3− phenotypes, observed previously in canonical T helper subsets (Becattini et al., 2014; Hegazy et al., 2010). The repertoire sharing observed between non-Tfh cells in tonsils and blood confirms communication between the two tissues and suggests that, after priming, CD4+ T cells from secondary lymphoid organs may exit into the peripheral circulation to pursue their effector function but also that circulating non-Tfh cells may be recruited to the tonsils to react to ongoing chronic infection. Despite the consistent overlap, the weighted analysis showed that the size of clonotypes differed between the two compartments, indicating that these populations have a different clonotypic distribution, which probably reflects differing retention and expansion in different locations. To better understand the magnitude of the observed repertoire overlaps, it is necessary to consider the size of the analyzed samples (103–105 cells) in comparison with the entire CD4+ T cell repertoire (108 cells) in the human body, with the caveat of considering a fixed number of the most abundant clones in each subset. Importantly, it was observed that, when re-sampling exactly the same set of sequences in silico or by experimentally sequencing cells independently sorted from the same tissue sample, the repertoire overlap is never complete, and it decreases with increasing population diversity. These quantitative results suggest that the degree of overlap observed experimentally between separately sampled populations provides an underestimate of the considerable repertoire overlap between circulating and tTfh populations. Extending the analysis to antigen-specific populations, we showed, using the T cell library technique (Geiger et al., 2009), that HA-specific CD4+ T cells were enriched in the cTfh CXCR3+ subset and the cNon-Tfh population, which contains the canonical CD4+ Th1 subsets. The number of HA-specific clones generated from the cTfh CXCR3+ and cNon-Tfh compartments was also much higher than that generated from the cTfh CXCR3− pool. The CD4+CXCR3+ bias in the HA-specific response is in line with previous reports (Palladino et al., 1991; Pedersen et al., 2014; Valkenburg et al., 2018; Velu et al., 2016; Yang et al., 2013; Yoon et al., 2018; Zielinski et al., 2011). Notably, in one of the 3 donors studied, the TCR sequences of blood-derived HA-specific cTfh CXCR3+ clones were found in the tTfh CXCR3+ repertoire, supporting a common clonal origin of antigen-specific Tfh cells in tonsils and the circulation. These results from analysis of antigen-specific cells provide strong support for the conclusions drawn from TCR deep sequencing: that the repertoires of cTfh and tTfh cells are very similar to each other but distinct from non-Tfh populations. Our observation of some repertoire sharing between Tfh GC and tTfh CXCR3+ populations is consistent with the hypothesis that some of the cells participating in a GC reaction originate from the tTfh CXCR3+ pool (Crotty, 2018; He et al., 2013). Whether a few Tfh GC cells, originally primed in a Th1 environment, are surviving to become memory Tfh Th1-like (or CXCR3+) cells in the lymphoid organs and later in the periphery is not clear (Crotty, 2018). Tfh GC cells may revert, via a tTfh CXCR3− stage, to a tTfh CXCR3+ phenotype because we observed some modest repertoire overlap between all three of these tTfh populations as well as repertoire overlap unique to the tTfh CXCR3− and tTfh CXCR3+ populations. These observations may apply to other Tfh cells with different phenotypes, similar to canonical Th cell subsets, but future work focusing on different pathogens that drive Th2 orTh17 responses is needed to elucidate this further. Our TCR repertoire analysis also indicated very little overlap between antigen-experienced Tfh and non-Tfh cell populations in blood and tonsil tissues under steady-state conditions. This may suggest that these memory cells are derived from distinct clonal lineages, although it does not exclude the possibility that memory CD4+ T cells, which are known to exhibit plasticity (Becattini et al., 2014; Caza and Landas, 2015; Hegazyet al., 2010; O’Shea et al., 2010), may alter their phenotype and become Tfh cells during an acute immune response (Boyden et al., 2012; Pepper et al., 2011). However, given that only the top2000 most abundant clonotypes in each population were compared, we cannot preclude that clones that were more highly expanded in the Tfh compartment were not also present at low frequency in the non-Tfh compartment and vice versa. Nonetheless, there were substantial differences in the TCR repertoires of antigen-experienced Tfh and non-Tfh populations. Furthermore, when studying influenza virus-specific cells (in the absence of a current influenza infection), we found that the peptides recognized by HA-specific CD4+ T cell clones showed a wide diversity of specificities, and there was a surprisingly small overlap in the peptides recognized by Tfh and non-Tfh subsets. The distinction between Tfh and non-Tfh subsets in peripheral blood was uniquely confirmed by the combination of TCR sequencing and peptide specificity testing for cTfh CXCR3+, cTfh CXCR3−, and cNon-Tfh HA-reactive T cell clones; the results indicated that these cells were generated from different naive clones. Future studies should explore the differences between repertoires of Tfh and non-Tfh cells in blood and GC over the course of acute responses to infection or vaccination. Non-Tfh cells constitute the majority of the CD4+ T cell population in the blood (PD-1+CXCR5+ cTfh cells comprise only 15% of memory and 6% of total blood CD4+ T cells), and, for many years, measurement of total CD4+ T cell responses in PBMCs has been used to assess the magnitude of helper T cell responses in the context of B cell and antibody responses. Our findings show that evaluation of the overall antigen-specific CD4+ T cell response will not give an accurate picture of the response in the Tfh compartment. There was very little clonal overlap between bona fide helper Tfh cells, particularly Tfh GC cells, and CXCR5−CD4+ memory T cells in the blood or tonsils, and there were marked differences in the epitope specificity of HA-reactive cTfh and cNon-Tfh cells. However, there were significant overlaps between the CXCR5+ Tfh populations in the blood and Tfh cells in lymphoid tissues. Therefore, to investigate the specificity of true Tfh responses, it will be necessary to identify circulating Tfh cells and to study their antigen reactivity. These findings have important implications for evaluating the breadth and specificity of immune responses in clinical trials of vaccines aimed at stimulating protective antibody responses.

STAR★METHODS

LEAD CONTACT AND MATERIALS AVAILABILITY

This study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Andrew J. McMichael (andrew.mcmichael@ndm.ox.ac.uk).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Human studies

Volunteer adult donors (16–50 years old) admitted for elective tonsillectomy at the John Radcliffe Hospital in Oxford because of a history of recurrent tonsillitis or sleep apnea consented to donate peripheral blood (80–100 mL) on the day of the surgery (Table S6). Tonsillectomy was performed in the absence of acute infection. Patients were excluded from the study if they were affected by immunodeficiency, serious ongoing infection (e.g., hepatitis B, hepatitis C or HIV infection or other infections deemed by the investigators to impact on the study), lymphoid malignancy, cytogenetic disorders, history of cancer, any pre-existing heart disease ora blood clotting disorder. The existing LABFLU002 clinical protocol was amended to cover these studies and was ethically approved by the Oxford B Research Ethics Committee (13/SC/0152). Written informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. Peripheral blood samples for T cell library interrogations were collected from healthy donors via the UK National Blood Service.

METHOD DETAILS

Human sample processing

Tonsil nodules from adult donors were collected within 4 h of surgery into RPMI 1640 glutamine [-] medium (Invitrogen) supplemented with non-essential amino acids (1%, Invitrogen), sodium pyruvate (1%, Invitrogen), glutamine (1%, Invitrogen), pooled AB human sera (5%, UK National Blood Service), β-mercaptoethanol (0.1%, Invitrogen) and penicillin/streptomycin (1%, Invitrogen). All samples were kept on ice during transportation. Tonsillar tissues were cleared from fatty and necrotic areas and cut into sections at a thickness of 2–3 mm using scalpels and scissors. The sections were then passed through a 70 μm cell strainer and filtered through a 40 μm cell strainer (Grivel and Margolis, 2009). Manually processed tonsils and peripheral blood samples were diluted 1:2 with Hank’s Balanced Salt Solution (Sigma-Aldrich) and layered over 20 mL of Histopaque-1077 (Sigma-Aldrich). Mononuclear cells were isolated via density gradient centrifugation (800 g for 30 min). Flow cytometric analyses of phenotypic markers were performed directly ex vivo. CD14+ cells were enriched from PBMCs via magnetic separation using CD14 MicroBeads (Miltenyi Biotec).

Phenotypic analysis and intracellular cytokine staining

Mononuclear cells from tonsil and blood samples were washed in Dulbecco’s PBS (Sigma-Aldrich). For phenotypic analyses, cells were labeled with Live/Dead Fixable Aqua and surface stained with anti-CD4–APC-Cy7, anti-CD45RA–PE-TxRed, anti-CXCR3–PE-Cy5, anti-CXCR5–AF488, anti-ICOS–BV711, anti-PD-1–BV421 and the dump markers anti-CD8, anti-CD14, anti-CD16, anti-CD19, anti-CD25 and anti-CD56 (all conjugated to PE-Cy7) for 15 min at 37°C (reagent details in Key Resources Table). For cytokine production, cells were stimulated with phorbol 12-myristate 13-acetate (2 × 10−7 M, Sigma-Aldrich) and ionomycin (1 μg/mL, Sigma-Aldrich) for 5 hr at 37°C. Brefeldin A was added after 2 hr (10 μg/mL, Sigma-Aldrich). Cells were then surface stained as described above, fixed/permeabilized with Cytofix/Cytoperm 1X Solution (BD PharMingen), and stained in Permwash 1X Solution (BD PharMingen) with anti-CD4–APC-Cy7, anti-IFN-γ–AF700, anti-IL-4–PE and anti-IL-21–AF647 for 20 min on ice (reagent details in Key Resources Table). The flow cytometry panel was internally validated using individually stained CompBeads (BD Biosciences). Stained samples were acquired using an LSR Fortessa (BD Biosciences) and analyzed using FlowJo software v10.3 (Tree Star).

KEY RESOURCES TABLE

REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
Anti-human CD3 Brilliant Violet 605Becton DickinsonCat#742623; RRID: AB_2740919
Live/Dead Fixable AquaInvitrogenCat#L34957
Anti-human CD4 APC-Cy7Becton DickinsonCat#557871; RRID: AB_396913
Anti-human CD45RA PE-TexasRedInvitrogenCat#MHCD45RA17; RRID: AB_1476948
Anti-human CXCR3 PE-Cy5Becton DickinsonCat#551128; RRID: AB_394061
Anti-human CXCR5 Alexa Fluor 488Becton DickinsonCat#558112; RRID: AB_397034
Anti-human ICOS Brilliant Violet 711Becton DickinsonCat#563833; RRID: AB_2738440
Anti-human ICOS PEBioLegendCat#313508; RRID: AB_416332
Anti-human PD-1 Brilliant Violet 421Becton DickinsonCat#562516; RRID: AB_11153482
Anti-human CD8 PE-Cy7Becton DickinsonCat#335822
Anti-human CD14 FITCBecton DickinsonCat#555397; RRID: AB_395798
Anti-human CD14 PE-Cy7Becton DickinsonCat#557742; RRID: AB_396848
Anti-human CD16 PE-Cy7Becton DickinsonCat#557744; RRID: AB_396850
Anti-human CD19 PE-Cy7Becton DickinsonCat#557835; RRID: AB_396893
Anti-human CD25 PE-Cy7Becton DickinsonCat#335824
Anti-human CD56 PE-Cy7Becton DickinsonCat#557747; RRID: AB_396853
Anti-human IFN-gamma Alexa Fluor 700Becton DickinsonCat#557995; RRID: AB_396977
Anti-human IL-4 PEBecton DickinsonCat#554485; RRID: AB_395424
Anti-human IL-21 Alexa Fluor 647Becton DickinsonCat#560493; RRID: AB_1645421
Biological Samples
Peripheral blood of adults individual undergoing tonsillectomyJR Hospital, Oxford, UKLABFLU002
Tonsil samples of adultsJR Hospital, Oxford, UKLABFLU002
Cone samples from peripheral blood of healthy individualsUK National Blood ServiceN/A
Chemicals, Peptides, and Recombinant Proteins
Haemagglutinin proteinProf Stephen Harrison (Harvard Medical School, MA)Influenza A Wisconsin/67/2005
Overlapping peptides of Haemagglutinin proteinGenScriptInfluenza A California/04/2009
Haemagglutinin proteinBEI ResourcesInfluenza A/California/04/2009
Commercial Trivalent Influenza VaccineSanofi PasteurSplit Virion, Inactivated
Phytohemagglutinin purifiedRemelR30852801
Critical Commercial Assays
Human TCR Profiling KitMiLaboratory LLCN/A
NextSeq 500/550 High Output Kit v2.5 (300 Cycles)Illumina20024908
RNeasy micro kitQIAGEN74004
Deposited Data
TCR sequencing dataMendely Datahttps://doi.org/10.17632/wry2ddh8zx.1
Oligonucleotides
Primer MAC2 GGAACTTTCTGGGCTGGGGAAGAAGGTGTCTTCTGGQuigley et al., 2011N/A
Primer MBC2 TGCTTCTGATGGCTCAAACACAGCGACCTQuigley et al., 2011N/A
Primer M13 Forward: TTTTCCCAGTCACGACInvitrogenN/A
Primer M13 Reverse: CAGGAAACAGCTATGACInvitrogenN/A
Software and Algorithms
MIGEChttps://milaboratory.com/software/MiLaboratory LLC
MiXCRhttps://milaboratory.com/software/MiLaboratory LLC
VDJtoolshttps://milaboratory.com/software/MiLaboratory LLC
Cytoscapehttps://cytoscape.org/Cytoscape Version 3.6.1
Open Gen5BioTekN/A

CD4+ T cell library

CD4+ and CD14+ cells were enriched from the PBMCs of 3 healthy donors via magnetic separation using the corresponding MicroBeads (Miltenyi Biotec). The CD14+ fraction was cryopreserved in liquid nitrogen. CD4+ T cells were stained with Live/Dead Fixable Aqua, anti-CD3–BV605, anti-CD4–APC-Cy7, anti-CD45RA–PE-TxRed, anti-CXCR3–PE-Cy5, anti-CXCR5–AF488, anti-PD-1–BV421 and the dump markers anti-CD8, anti-CD14, anti-CD16, anti-CD19, anti-CD25 and anti-CD56 (all conjugated to PE-Cy7) for 15 min at 37°C (reagent details in Key Resources Table). Circulating live CD3+CD4+CD45RA− cells were sorted into cTfh CXCR3+ (CXCR3+CXCR5+PD-1+), cTfh CXCR3− (CXCR3−CXCR5+PD-1+) and cNon-Tfh (CXCR5−) subsets using a FACSAria III (BD Biosciences). Sorting was performed using a 4-way purity to obtain 3–5x105 cells per subset at a minimum purity of 92%. Sorted CD4+ T cells were seeded at a limiting dilution of 1 × 104 cells/mL in RPMI 1640 glutamine [-] medium (Invitrogen) supplemented with non-essential amino acids (1%, Invitrogen), sodium pyruvate (1%, Invitrogen), glutamine (1%, Invitrogen), pooled AB human sera (5%, UK National Blood Service), β-mercaptoethanol (0.1%, Invitrogen), penicillin/streptomycin (1%, Invitrogen) and IL-2 (500 U/mL, University of Oxford). Cells were expanded with 1 μg/mL phytohemagglutinin (Remel) in the presence of irradiated (45 Gy) allogeneic feeder cells from 3 different healthy blood donors (106 feeder cells/mL). After 20 days, each line was screened for the capacity to proliferate in response to HA protein. Autologous CD14+ monocytes were irradiated at 45 Gy and incubated (3 × 105 cells/mL) for 5 hr at 37°C with HA protein (5 μg/mL) from Influenza A Wisconsin/67/2005 (a gift from Professor Stephen Harrison, Harvard Medical School). Negative control wells incorporated dimethyl sulfoxide (0.045%, Sigma-Aldrich), and positive control wells incorporated IL-2 (500 U/mL, University of Oxford). An aliquot of 2.5 × 106 cells/mL from each expanded CD4+T cell line was added to the monocytes after washing and resting in fresh culture medium without IL-2 for 5 hr. After 3 days, 1 μCi/mL [3H]-thymidine was added to the cultures, and proliferation was measured after 16 hr using a MicroBeta2 Counter (Perkin Elmer) (Campion et al., 2014; Geiger et al., 2009; Lindestam Arlehamn et al., 2013; Mele et al., 2017).

Antigen-specific CD4+ T cell clones

Frozen CD14-depleted PBMCs were defrosted and rested overnight at 37°C in RPMI 1640 glutamine [-] medium (Invitrogen) supplemented with non-essential amino acids (1%, Invitrogen), sodium pyruvate (1%, Invitrogen), glutamine (1%, Invitrogen), pooled AB human sera (10%, UK National Blood Service), β-mercaptoethanol (0.1%, Invitrogen) and penicillin/streptomycin (1%, Invitrogen). CD4+ cells were enriched via magnetic separation using CD4 MicroBeads (Miltenyi Biotec) and surface stained as described above. Among live lymphocytes, circulating CD3+CD4+CD45RA− cells were sorted into cTfh CXCR3+ (CXCR3+CXCR5+PD-1+), cTfh CXCR3− (CXCR3−CXCR5+PD-1+) and cNon-Tfh (CXCR5−) subsets using a FACS Aria III (BD Biosciences). Sorted subsets (3x106 cells/mL) were stimulated at a 3:1 ratio with irradiated (45 Gy) autologous CD14+ monocytes loaded as described above with overlapping HA peptides (2 μg/mL) corresponding to Influenza A California/04/2009 (GenScript). Peptides were 14–18 amino acids long with a 12 residue overlap spanning the entire length of HA. After 7 days, cells were stained with Live/Dead Fixable Aqua, anti-CD3–BV605, anti-CD4–APC-Cy7, anti-CD25–PE-Cy7, anti-CD45RA–PE-TxRed, anti-ICOS–PE and the dump marker anti-CD14 (conjugated to FITC) for 15 min at 37°C (reagent details in Key Resources Table). Activated CD4+ T cells (CD3+CD4+CD14−CD25+ICOS+) were sorted using a FACSAria III (BD Biosciences) and seeded at 0.4 cells/well into 384-well plates (Corning). Cells were expanded with phytohemagglutinin (1 μg/mL, Remel) in the presence of irradiated (45 Gy) allogeneic feeder cells from 3 different healthy blood donors (106 feeder cells/mL) in RPMI 1640 glutamine [-] medium (Invitrogen) supplemented with non-essential amino acids (1%, Invitrogen), sodium pyruvate (1%, Invitrogen), glutamine (1%, Invitrogen), pooled AB human sera (10%, UK National Blood Service), β-mercaptoethanol (0.1%, Invitrogen), penicillin/streptomycin (1%, Invitrogen) and IL-2 (500 U/mL, University of Oxford). After 14 days, T cell clones were identified and transferred into 96-well round-bottom plates (Corning). To confirm specificity, an aliquot of each clone (1 × 106 cells/mL) was stimulated with the relevant overlapping peptide pool (2 μg/mL) after washing and resting in fresh culture medium without IL-2 for 5 hr. After 3 days, 1 μCi/mL [3H]-thymidine was added to the cultures, and proliferation was measured after 16 hr using a MicroBeta2 Counter (Perkin Elmer). Positive responses were defined as >1,000 counts per min (cpm) with a stimulation index >5 after background subtraction (cpm in wells lacking peptide). Clones were excluded from the analysis if the background count was >1,000 cpm.

Peptide-mapping of antigen-specific CD4+ T cell clones

Antigen-specific CD4+ T cell clones were mapped using a matrix of overlapping HA peptides corresponding to Influenza A California/04/2009, designed using “Deconvolute This!” (Precopio et al., 2008). The matrix consisted of 12 pools with 18 peptides per pool and a coverage of 3. An aliquot of each clone (1.5 × 106 cells/mL) was added to the peptide matrix (2 μg/mL) after washing and resting in fresh culture medium without IL-2 for 5 hr. After 3 days, 1 μCi/mL [3H]-thymidine was added to the cultures, and proliferation was measured after 16 hr using a MicroBeta2 Counter (Perkin Elmer). Positive responses were defined as >1,000 cpm with a stimulation index >5 after background subtraction (cpm in wells lacking peptide). Peptide specificity was confirmed similarly using single peptides identified from the matrix responses.

TCR deep-sequencing

Mononuclear cells from matched tonsil and peripheral blood samples were defrosted and rested overnight at 37°C in RPMI 1640 glutamine [-] medium (Invitrogen) supplemented with non-essential amino acids (1%, Invitrogen), sodium pyruvate (1%, Invitrogen), glutamine (1%, Invitrogen), pooled AB human sera (10%, UK National Blood Service), β-mercaptoethanol (0.1%, Invitrogen) and penicillin/streptomycin (1%, Invitrogen). Cells were then surface stained as described above. Among live CD3+CD4+CD45RA− lymphocytes, circulating cells were sorted into cTfh CXCR3+ (CXCR3+CXCR5+PD-1+), cTfh CXCR3− (CXCR3−CXCR5+PD-1+) and cNon-Tfh (CXCR5−) subsets, and cells from tonsils were sorted into tTfh GC (CXCR5hiPD-1hi), tTfh CXCR3+ (CXCR3+CXCR5intPD-1int), tTfh CXCR3− (CXCR3−CXCR5intPD-1int) and tNon-Tfh (CXCR5−PD-1−) subsets. A maximum of 1.2x105 cells per subset was sorted using a FACSAria III (BD Biosciences) into RLT buffer (QIAGEN) containing β-mercaptoethanol (10%, Sigma-Aldrich). Sorted cells were stored at −80°C. Each subset from donors 5, 6 and 7 was sorted into two vials for technical replicates (Table S7). Total RNA was isolated using an RNeasy Mini Kit (QIAGEN). Unique molecular identifier (UMI)-labeled 5′-RACE TCRβ cDNA libraries were prepared using a Human TCR Profiling Kit (MiLaboratory LLC). All extracted RNA was used for cDNA synthesis, and all synthesized cDNA was used for PCR amplification. Libraries were prepared in parallel using the same number of PCR cycles and sequenced in parallel using a 150+150 bp NextSeq (Illumina). The total number of reads per subset is shown in Table S8.

TCR sequencing of antigen-specific CD4+ T cell clones

Antigen-specific CD4+ T cell clones were stained as described above for viability and surface expression of CD3 and CD4 (reagent details in Key Resources Table). A maximum of 5 × 103 live CD3+CD4+ T cells was sorted into 100 μL of RNAlater (Ambion) using a FACSAria III (BD Biosciences). Sorted cells were stored at −80°C. All expressed TRA and TRB gene transcripts were amplified using an unbiased template-switch anchored RT-PCR (Quigley et al., 2011). Pure mRNA was isolated from sorted cells using μMACS Oligo(dT) MicroBeads (Miltenyi Biotec), and cDNA was generated using a SmarterRACE Kit (Takara) with Superscript II (Invitrogen). Transcripts were amplified using an Advantage 2 PCR Kit (Takara) with the relevant constant region primers (reagent details in Key Resources Table). Amplicons were separated on agarose gels and extracted using a NucleoSpin Extract II Gel Extraction Kit (Macherey-Nagel). Subclones were generated using a TOPO TA Cloning Kit (Invitrogen) and One Shot Max Efficiency DH5α-T1 Competent Cells (Invitrogen). Conventional sequencing was performed as described previously (Price et al., 2005). Gene use was assigned using the ImMunoGeneTics (IMGT) nomenclature (Lefranc, 2003).

Quantification of influenza-specific IgG

ELISA plates were coated with a commercial Trivalent Influenza Vaccine (0.75 μg/mL, Sanofi Pasteur) or HA protein from Influenza A/California/2009 (2 μg/mL, BEI Research Resources Repository). After overnight incubation at 4°C, plates were washed six times with PBS containing 0.05% Tween-20, blocked with casein (Pierce) for 2 hr at room temperature, and washed again with PBS containing 0.05% Tween-20. Diluted plasma samples (1:500, 1:1,000, 1:2,000 and 1:4,000) were then added in duplicate. After incubation for 2 hr at room temperature, plates were washed again six times with PBS containing 0.05% Tween-20, incubated with alkaline phosphatase-conjugated goat anti-human IgG (1 μg/mL, Sigma-Aldrich) for 1 hr at room temperature, and washed again with PBS containing 0.05% Tween-20. Para-nitrophenylphosphate (Sigma-Aldrich) dissolved at a concentration of 1 mg/mL in diethanolamine buffer (Pierce) was then added for 10 min, and absorbance was read at 405 nm using a Microplate Reader (BioTek) with Open Gen5 software (BioTek). Results were plotted as arbitrary units and standardized against a pool of four plasma samples (Miura et al., 2008).

QUANTIFICATION AND STATISTICAL ANALYSIS

Flow cytometry data

A stop gate was set during acquisition to ensure that the same number of events was acquired and for each sample. Gates were set on the data to determine the frequencies of the different subsets. Analogous subsets were compared between tonsil and peripheral blood using the Wilcoxon matched pairs test. Non-analogous subsets were compared within tonsil and peripheral blood using the Kruskal-Wallis test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Boxes show means and quartiles, and whiskers show minima and maxima.

TCR deep-sequencing analysis

A total of 93 × 106TCRβ sequencing reads (up to 8 × 106 reads per library) were obtained, from which 1.55 × 106 unique UMI-labeled TCRβ cDNA molecules (up to 1.5 × 105 molecules per library) were assembled using MIGEC software (Shugay et al., 2014), using a threshold of at least four sequencing reads per UMI. In-frame CDR3β repertoires were extracted using MiXCR software (Bolotin et al., 2015). Each library contained from 500 to 3.5 × 104 functional (in-frame, no stop-codons) CDR3b nucleotide clonotypes. Averaged TCR repertoire characteristics weighted by clonotype size (normalized Shannon-Wiener index) were calculated using VDJtools software (Shugay et al., 2015). As the number of cells in the populations sorted from different donors was variable as well as the total reads, the frequency of each clonotype was normalized before analysis to allow an unbiased comparison between diverse subsets. Network analysis was performed using Cytoscape software (https://cytoscape.org). The F2 metric for overlap between two populations was calculated as the sum of the geometric means between the frequencies of shared clonotypes, considering the top2000 clonotypes for each subset. This value was then standardized with the two maximum F2 metrics calculated for the top2000 clonotypes for each of the two populations. F2 metric, % shared clonotypes and diversity indices were analyzed with non-parametric Kruskal-Wallis and Dunn’s multiple comparison tests. For each test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Linear regression correlations were calculated using the square of the Pearson correlation coefficient (R2), the slope and the p value of the significance of the difference in the slope from zero (ns = not significant).

Bootstrap method

The complete set of clonotypes was randomly resampled with replacement to obtain two in silico replicates of each set of sequences. Using this method, the replicates and the original set had similar distributions, but likely different absolute numbers, for each clonotype. All downstream analyses were performed using the two resampled sets. Linear regression correlations between in silico replicates and diversity were calculated using the p value of the difference in the slope from zero.

T cell library analysis

Positive responses were defined as >3,000 counts per min (cpm) with a stimulation index >5 after background subtraction (cpm in the negative control wells). Because CD4+ T cells were seeded at limiting dilution, it was possible to calculate the precursor frequency of responding cells per million according to the Poisson distribution (Campion et al., 2014; Geiger et al., 2009; Lindestam Arlehamn et al., 2013; Mele et al., 2017). The 95% confidence intervals were determined according to the modified Wald method (Harrell, 2001).

Antigen-specific CD4+ T cell frequencies

The frequencies of expanded antigen-specific CD4+ T cell clones were calculated based on the number of clones with confirmed specificity after expansion. Significantly diverse enrichments were identified using Kruskal-Wallis and Dunn’s multiple comparison tests were performed. For each test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

DATA AND CODE AVAILABILITY

MIGEC, MiXCR and VDJtools software are available from MiLaboratory LLC (https://milaboratory.com/software/). The TCR sequencing dataset supporting the current study has been deposited in the Mendeley Dataset repository (https://doi.org/10.17632/wry2ddh8zx.1).
  88 in total

1.  CXCR5 expressing human central memory CD4 T cells and their relevance for humoral immune responses.

Authors:  Nina Chevalier; David Jarrossay; Edwin Ho; Danielle T Avery; Cindy S Ma; Di Yu; Federica Sallusto; Stuart G Tangye; Charles R Mackay
Journal:  J Immunol       Date:  2011-04-06       Impact factor: 5.422

Review 2.  Do Memory CD4 T Cells Keep Their Cell-Type Programming: Plasticity versus Fate Commitment? Complexities of Interpretation due to the Heterogeneity of Memory CD4 T Cells, Including T Follicular Helper Cells.

Authors:  Shane Crotty
Journal:  Cold Spring Harb Perspect Biol       Date:  2018-03-01       Impact factor: 10.005

3.  Germinal center T follicular helper cell IL-4 production is dependent on signaling lymphocytic activation molecule receptor (CD150).

Authors:  Isharat Yusuf; Robin Kageyama; Laurel Monticelli; Robert J Johnston; Daniel Ditoro; Kyle Hansen; Burton Barnett; Shane Crotty
Journal:  J Immunol       Date:  2010-06-04       Impact factor: 5.422

4.  Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells.

Authors:  Ivana M Djuretic; Ditsa Levanon; Varda Negreanu; Yoram Groner; Anjana Rao; K Mark Ansel
Journal:  Nat Immunol       Date:  2006-12-31       Impact factor: 25.606

5.  Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages.

Authors:  Roza I Nurieva; Yeonseok Chung; Daehee Hwang; Xuexian O Yang; Hong Soon Kang; Li Ma; Yi-hong Wang; Stephanie S Watowich; Anton M Jetten; Qiang Tian; Chen Dong
Journal:  Immunity       Date:  2008-07-03       Impact factor: 31.745

6.  Direct Probing of Germinal Center Responses Reveals Immunological Features and Bottlenecks for Neutralizing Antibody Responses to HIV Env Trimer.

Authors:  Colin Havenar-Daughton; Diane G Carnathan; Alba Torrents de la Peña; Matthias Pauthner; Bryan Briney; Samantha M Reiss; Jennifer S Wood; Kirti Kaushik; Marit J van Gils; Sandy L Rosales; Patricia van der Woude; Michela Locci; Khoa M Le; Steven W de Taeye; Devin Sok; Ata Ur Rasheed Mohammed; Jessica Huang; Sanjeev Gumber; AnaPatricia Garcia; Sudhir P Kasturi; Bali Pulendran; John P Moore; Rafi Ahmed; Grégory Seumois; Dennis R Burton; Rogier W Sanders; Guido Silvestri; Shane Crotty
Journal:  Cell Rep       Date:  2016-11-22       Impact factor: 9.423

7.  Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses.

Authors:  David A Price; Jason M Brenchley; Laura E Ruff; Michael R Betts; Brenna J Hill; Mario Roederer; Richard A Koup; Steven A Migueles; Emma Gostick; Linda Wooldridge; Andrew K Sewell; Mark Connors; Daniel C Douek
Journal:  J Exp Med       Date:  2005-11-14       Impact factor: 14.307

8.  Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production.

Authors:  D Breitfeld; L Ohl; E Kremmer; J Ellwart; F Sallusto; M Lipp; R Förster
Journal:  J Exp Med       Date:  2000-12-04       Impact factor: 14.307

9.  High-throughput sequencing of the T-cell receptor repertoire: pitfalls and opportunities.

Authors:  James M Heather; Mazlina Ismail; Theres Oakes; Benny Chain
Journal:  Brief Bioinform       Date:  2018-07-20       Impact factor: 11.622

10.  Pulmonary infection with influenza A virus induces site-specific germinal center and T follicular helper cell responses.

Authors:  Alexander W Boyden; Kevin L Legge; Thomas J Waldschmidt
Journal:  PLoS One       Date:  2012-07-11       Impact factor: 3.240

View more
  31 in total

1.  Circulating follicular helper T cells and subsets are associated with immune response to hepatitis B vaccination.

Authors:  Mingjuan Yin; Yongzhen Xiong; Lingfeng Huang; Gang Liu; Zuwei Yu; Yi Zhao; Jie Zhao; Yan Zhang; Tingyu Lian; Jingxiao Huang; DongMei Liang; JinMei Zeng; Jindong Ni
Journal:  Hum Vaccin Immunother       Date:  2020-07-02       Impact factor: 3.452

2.  Humoral and circulating follicular helper T cell responses in recovered patients with COVID-19.

Authors:  Jennifer A Juno; Hyon-Xhi Tan; Stephen J Kent; Adam K Wheatley; Wen Shi Lee; Arnold Reynaldi; Hannah G Kelly; Kathleen Wragg; Robyn Esterbauer; Helen E Kent; C Jane Batten; Francesca L Mordant; Nicholas A Gherardin; Phillip Pymm; Melanie H Dietrich; Nichollas E Scott; Wai-Hong Tham; Dale I Godfrey; Kanta Subbarao; Miles P Davenport
Journal:  Nat Med       Date:  2020-07-13       Impact factor: 53.440

3.  Transcriptome and TCR Repertoire Measurements of CXCR3+ T Follicular Helper Cells Within HIV-Infected Human Lymph Nodes.

Authors:  Chenfeng He; Michael J Malone; Ben S Wendel; Ke-Yue Ma; Daniel Del Alcazar; David B Weiner; Philip L De Jager; Perla M Del Río-Estrada; Yuria Ablanedo-Terrazas; Gustavo Reyes-Terán; Laura F Su; Ning Jiang
Journal:  Front Immunol       Date:  2022-05-06       Impact factor: 8.786

4.  Immune cellular networks underlying recovery from influenza virus infection in acute hospitalized patients.

Authors:  Thi H O Nguyen; Marios Koutsakos; Carolien E van de Sandt; Jeremy Chase Crawford; Liyen Loh; Sneha Sant; Ludivine Grzelak; Emma K Allen; Tim Brahm; E Bridie Clemens; Maria Auladell; Luca Hensen; Zhongfang Wang; Simone Nüssing; Xiaoxiao Jia; Patrick Günther; Adam K Wheatley; Stephen J Kent; Malet Aban; Yi-Mo Deng; Karen L Laurie; Aeron C Hurt; Stephanie Gras; Jamie Rossjohn; Jane Crowe; Jianqing Xu; David Jackson; Lorena E Brown; Nicole La Gruta; Weisan Chen; Peter C Doherty; Stephen J Turner; Tom C Kotsimbos; Paul G Thomas; Allen C Cheng; Katherine Kedzierska
Journal:  Nat Commun       Date:  2021-05-11       Impact factor: 14.919

5.  T cell immune discriminants of HIV reservoir size in a pediatric cohort of perinatally infected individuals.

Authors:  Stefano Rinaldi; Lesley de Armas; Sara Dominguez-Rodríguez; Suresh Pallikkuth; Vinh Dinh; Li Pan; Kathleen Gӓrtner; Rajendra Pahwa; Nicola Cotugno; Pablo Rojo; Eleni Nastouli; Nigel Klein; Caroline Foster; Anita De Rossi; Carlo Giaquinto; Paolo Rossi; Paolo Palma; Savita Pahwa
Journal:  PLoS Pathog       Date:  2021-04-26       Impact factor: 6.823

6.  Single cell analysis of host response to helminth infection reveals the clonal breadth, heterogeneity, and tissue-specific programming of the responding CD4+ T cell repertoire.

Authors:  Ivy K Brown; Nathan Dyjack; Mindy M Miller; Harsha Krovi; Cydney Rios; Rachel Woolaver; Laura Harmacek; Ting-Hui Tu; Brian P O'Connor; Thomas Danhorn; Brian Vestal; Laurent Gapin; Clemencia Pinilla; Max A Seibold; James Scott-Browne; Radleigh G Santos; R Lee Reinhardt
Journal:  PLoS Pathog       Date:  2021-06-09       Impact factor: 6.823

7.  Adaptive immunity to human coronaviruses is widespread but low in magnitude.

Authors:  Hyon-Xhi Tan; Wen Shi Lee; Kathleen M Wragg; Christina Nelson; Robyn Esterbauer; Hannah G Kelly; Thakshila Amarasena; Robert Jones; Graham Starkey; Bao Zhong Wang; Osamu Yoshino; Thomas Tiang; Michael Lindsay Grayson; Helen Opdam; Rohit D'Costa; Angela Vago; Laura K Mackay; Claire L Gordon; Adam K Wheatley; Stephen J Kent; Jennifer A Juno
Journal:  Clin Transl Immunology       Date:  2021-03-17

Review 8.  CD4+ T cells that help B cells - a proposal for uniform nomenclature.

Authors:  Stephanie C Eisenbarth; Dirk Baumjohann; Joe Craft; Nicolas Fazilleau; Cindy S Ma; Stuart G Tangye; Carola G Vinuesa; Michelle A Linterman
Journal:  Trends Immunol       Date:  2021-07-06       Impact factor: 19.709

9.  Intratumoral follicular regulatory T cells curtail anti-PD-1 treatment efficacy.

Authors:  Simon Eschweiler; James Clarke; Ciro Ramírez-Suástegui; Bharat Panwar; Ariel Madrigal; Serena J Chee; Ioannis Karydis; Edwin Woo; Aiman Alzetani; Somaia Elsheikh; C J Hanley; G J Thomas; Peter S Friedmann; Tilman Sanchez-Elsner; Ferhat Ay; Christian H Ottensmeier; Pandurangan Vijayanand
Journal:  Nat Immunol       Date:  2021-06-24       Impact factor: 25.606

10.  Dynamic changes in circulating T follicular helper cell composition predict neutralising antibody responses after yellow fever vaccination.

Authors:  Johanna E Huber; Julia Ahlfeld; Magdalena K Scheck; Magdalena Zaucha; Klaus Witter; Lisa Lehmann; Hadi Karimzadeh; Michael Pritsch; Michael Hoelscher; Frank von Sonnenburg; Andrea Dick; Giovanna Barba-Spaeth; Anne B Krug; Simon Rothenfußer; Dirk Baumjohann
Journal:  Clin Transl Immunology       Date:  2020-05-13
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.