| Literature DB >> 31911896 |
Akshay Datey1,2,3, C S Adeeb Thaha4, Sudhir R Patil4, Jagadeesh Gopalan2,3, Dipshikha Chakravortty1,3.
Abstract
Biofilms are ubiquitous in nature and are invariably associated with health and diseases of all living beings. Periodontal diseases & dental caries are the most prevalent conditions in which biofilm has established as a primary causative factor. Managing poly-microbial biofilm is the mainstay of periodontal therapy. Plethora of antimicrobials have been used till date to combat biofilm, but the emergence of antibiotic tolerance and resistance in biofilms is a major cause of concern. Apart from use of antimicrobials, various anti-biofilm strategies have evolved which include the use of mechanical, and chemical means to disrupt biofilms. However, none of these approaches have led to desired or optimal biofilm control and hence search for novel approach continues. Shockwaves are used in medical practice for various therapeutic purposes and in local drug delivery, gene therapy, wound healing & regeneration. With this background, a study was designed with an attempt to explore the possibility of using the shockwave for their effect on multispecies oral biofilm development from subgingival plaque samples obtained from chronic periodontitis patients. Plaque samples from 25 patients were used to derive multispecies biofilm which were used to check the efficacy of shockwaves and antibacterial efficacy of four clinically relevant antimicrobials. Biofilms were analyzed by scanning electron microscope; atomic force microscope and their biomass was quantitated by crystal violet staining. Further, a humanized rat model of periodontitis was developed. Patient derived plaque was used to establish periodontitis in healthy rats. The model was validated by performing colony forming unit (CFU) analysis of the infected tissue. The animals were subjected to low intensity shockwaves using a hand-held shockwave generator at the site of infection. Shockwave treatment was done with or without antimicrobial application. The animals were monitored for clearance of infection and for mortality. The results show that shockwave treatment in combination with antimicrobials is significantly effective in clearing a multispecies biofilm. This also brings out the possibility of application of shockwaves in the management of oral biofilms either alone or in combination with established antimicrobial agents. With further research, safety profile validation and clinical trials, shockwaves can be an effective, novel approach in management of biofilm associated periodontal disease.Entities:
Keywords: biofilms; humanized rat model; patient sample; periodontitis; shock waves
Year: 2019 PMID: 31911896 PMCID: PMC6923175 DOI: 10.3389/fbioe.2019.00382
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Figure 1Design and working principle of shockwave-based device for dental applications. (A) Oxyhydrogen driven miniature 6 mm shock tube assembly. (B) Handheld assembly used for dental application. The device consists of driver and driven sections, battery operated glow plug and a gas inlet. The flexible driven section enables the user to conviniently position shockwave exposure. (C) Working principle of the device. (D) Typical pressure vs. time profile generated using the device depicting shockwave formation.
Figure 2Experimental approach and outline. (A) Dentine disc preperation from excised tooth using a diamond cutter. (B) Initiating a polymicrobial biofilm in a 24-well plate on dentine discs. (C) Mature 7 day-old biofilm formed on dentine discs. (D,E) Biofilm biomas qunatification using crystal violet staining.
Figure 3Validation of polymicrobial biofilm formation by atomic force microscopy. Biofilms formed on the dentine discs were analyzed by atomic force microscopy. (A) Control fully formed biofilm depicting its polymicrobial nature. (B) Effect of shockwave treatment on polymicrobial biofilm. (C–F) Effect of antimicrobial agents alone on the biofilm. (G–J) Combinatorial effect of shockwaves and antimicrobials on the biofilms grown on dentine discs. The images highlight the disruption of biofilms as well as the reduction of extracellular polymeric substance (EPS) upon various treatments.
Figure 4Effect of shockwave therapy on the efficacy of antimicrobials. Scanning electron micrographs of (a) Control bilofilm, (b) Shockwave treated biofilm, (c–f) Biofilms treated with antimicrobials alone and (g–j) Biofilms treated with shock waves followed by respective antimicrobial treatment. (k) Combined data of 25 patient samples subjected to the above scheme of treatments. Shockwave followed by amoxicillin treatment yields the best biofilm disruption and clearance. *P < 0.05.
Figure 5Establishing a humanized model of periodontitis in rats. (A) Sprague Dawley rats were injected with pooled plaque samples from 5 chronic periodontitis patients. To establish a humanozed model of periodontitis, they were incubated for 21 days with normal food and water. (B) Post-incubation, the total CFU from the site of infection was ennumerated to confirm the disease establishment. **P < 0.005.
Results of student t-test comparing antimicrobials alone with the Shockwave antimicrobial group.
| AM 1 v/s SW-AM 1 | 0.17 ± 0.52 0.03 ± 0.02 | 7.305 | 22 | ||
| AM 2 v/s SW-AM 2 | 0.12 ± 0.33 0.05 ± 0.04 | 4.808 | |||
| AM 3 v/s SW-AM 3 | 0.15 ± 0.03 0.07 ± 0.06 | 4.262 | |||
| AM 4 v/s SW-AM 4 | 0.09 ± 0.009 0.02 ± 0.003 | 28.343 |
P < 0.0005.
Results of post-hoc (Tukey) test comparing control group with the other test groups.
| SW | 0.109 (0.03–0.18) | <0.0001 |
| AM 1 | 0.088 (0.01–0.16) | 0.001 |
| AM 2 | 0.136 (0.05–0.21) | <0.0001 |
| AM 3 | 0.105 (0.02–0.18) | 0.002 |
| AM 4 | 0.166 (0.08–0.24) | <0.0001 |
| SW AM1 | 0.234 (0.15–0.31) | <0.0001 |
| SW AM2 | 0.214 (0.13–0.29) | <0.0001 |
| SW AM3 | 0.195 (0.11–0.27) | <0.0001 |
| SW AM4 | 0.243 (0.16–0.32) | <0.0001 |
P < 0.005,
P < 0.0005.
Figure 6Evaluating the effect of shockwave treatment in a chronic periodontitis rat model. (A–D) Infected animals were exposed to a local shockwave at the rate of 1 shot per day for 7 days. They were treated either with shockwaves alone, antimicrobials alone or a combination of both. The control animal was left untreated. The shockwave and animicrobial alone treated animal showed disease progression whereas the animal treated with shockwaves followed by antimicrobial agent showed complete cure after the course of treatment. (E) The total CFU at the site of infection was also estimated. (F) An independent set of animals were tested for their survival post infection and treatment. Shockwave and antimicrobial treated animals survived whereas all the other treatment groups succummed to infection at different times. ***P < 0.0005.
| F: AAACCCATCTCTGAGTTCTTCTTC | |
| F: CGCCCTTTTTTGGTGTTTTTGG | |
| F: AGGCAGCTTGCCATACTGC | |
| F: TCCCGGTCAGCAAACTTCAGCC | |
| F: GTAACAAAGGTGTCGTTTCTCG | |
| F: CGCAGAAGGTGAAAGTCCTGTAT |