Wenbo Wang1, Jun Li1, Frank C Ko2, Xia Zhao1, Yusen Qiao1, Ronald S Lu1, D Rick Sumner1,2, Tingyu Wang1,3, Di Chen1. 1. Department of Orthopedic Surgery, Rush University Medical Center, Chicago, Illinois. 2. Department of Cell and Molecular Medicine, Rush University Medical Center, Chicago, Illinois. 3. Department of Pharmacy, Shanghai Ninth People's Hospital, Shanghai JiaoTong University School of Medicine, Shanghai, China.
Abstract
C terminus of Hsc70-interacting protein (CHIP) is a chaperone-dependent and U-box containing E3 ubiquitin ligase. In previous studies, we found that CHIP regulates the stability of multiple tumor necrosis factor receptor-associated factor proteins in bone cells. In Chip global knockout (KO) mice, nuclear factor-κB signaling is activated, osteoclast formation is increased, osteoblast differentiation is inhibited, and bone mass is decreased in postnatal Chip KO mice. To determine the role of Chip in different cell types at different developmental stages, we created Chipflox/flox mice. We then generated Chip conditional KO mice ChipCMV and ChipOsxER and demonstrated defects in skeletal development and postnatal bone growth in Chip conditional KO mice. Our findings indicate that Chip conditional KO mice could serve as a critical reagent for further investigations of functions of CHIP in bone cells and in other cell types.
C terminus of Hsc70-interacting protein (CHIP) is a chaperone-dependent and U-box containing E3 ubiquitin ligase. In previous studies, we found that CHIP regulates the stability of multiple tumornecrosis factor receptor-associated factor proteins in bone cells. In Chip global knockout (KO) mice, nuclear factor-κB signaling is activated, osteoclast formation is increased, osteoblast differentiation is inhibited, and bone mass is decreased in postnatal Chip KO mice. To determine the role of Chip in different cell types at different developmental stages, we created Chipflox/flox mice. We then generated Chip conditional KO mice ChipCMV and ChipOsxER and demonstrated defects in skeletal development and postnatal bone growth in Chip conditional KO mice. Our findings indicate that Chip conditional KO mice could serve as a critical reagent for further investigations of functions of CHIP in bone cells and in other cell types.
Skeletal development and endochondral bone formation is a complicated process involving chondrocyte proliferation, differentiation and hypertrophy, cartilage calcification, resorption of calcified cartilage, vascular invasion, and osteoblast differentiation. All of these steps are regulated precisely by multiple growth factors and signaling molecules. Nuclear factor‐κB (NF‐κB) signaling controls osteoclast formation (Boyce, Yao, & Xing, 2010) and is involved in the process of removal of calcified cartilage. In NF‐κB p50/p65 double knockout (KO) mice, osteoclast formation is severely impaired leading to defects in the resorption of calcified cartilage and largely expanded hypertrophic zone at the postnatal stage (Xing, Chen, & Boyce, 2013).NF‐κB signaling plays an important role in bone biology. C terminus of Hsc70‐interacting protein (CHIP) is a chaperone‐dependent and U‐box containing E3 ubiquitin ligase. It targets the degradation of proteins critical for multiple cellular functions and signaling pathways. In previous studies, we found that CHIP controls the degradation of multiple tumornecrosis factor receptor‐associated factor proteins and regulates NF‐κB signaling in both osteoclasts and osteoblasts and NF‐κB signaling is activated in Chip KO mice (Li et al., 2014; Wang et al., 2018). It is known that activation of NF‐κB signaling leads to stimulation of osteoclast formation and inhibition of osteoblast differentiation (Abu‐Amer, 2013; Boyce et al., 2010; Jimi et al., 2016; Otero, Chen, Zhang, & Abu‐Amer, 2012; Park et al., 2007; Swarnkar, Zhang, Mbalaviele, Long, & Abu‐Amer, 2014; Yao et al., 2014). However, the role of NF‐κB signaling in skeletal development remains unclear. In the present studies, we investigated changes in skeletal development in Chip conditional KO mice.To study the role of CHIP in bone remodeling and in aging in adult mice and to determine the tissue‐specific effects of Chip in bone and cartilage and other organs in the body, we have generated Chipmice. To demonstrate that Chipmice have been properly developed, we then created Chip
and Chip
conditional KO mice. We analyzed bone phenotype of Chip conditional KO mice and demonstrated that Chipmice could be used as an important tool to investigate functions of Chip in multiple tissues at different developmental stages.
MATERIALS AND METHODS
Chip KO Mice
Chipmice were generated in Nanjing Biomedical Research Institute (Nanjing University, Nanjing, China). In these mice the Chip gene was floxed at the flanking sites of exon 1 and exon 3. The primer sequences for genotyping Chipmice were: P1 (forward primer): 5′‐CATATCTCACCAGGCTCAT‐3′, P2 (reverse primer): 5′‐ACACACAATGACCCACAT‐3′ and P3 (reverse primer): 5′‐GGCCTACCCGCTTCCATTGCTC‐3′. The genotyping result was presented in Figure 1. CMV‐Cre and Osx‐CreER transgenic mice were obtained from the Jackson Laboratory (Bar Harbor, Maine).
Figure 1
Genotyping Chip‐flox mice. Chip‐flox mice were genotyped with specific primers P1 (forward primer): 5′‐CATATCTCACCAGGCTCAT‐3′, P2 (reverse primer): 5′‐ACACACAATGACCCACAT‐3′, and P3 (reverse primer): 5′‐GGCCTACCCGCTTCCATTGCTC‐3′. Primer set P1/P3 amplifies a 522‐bp band to detect Chip
allele and primer set P1/P2 amplifies a 328‐bp band to detect WT allele. Both 328‐ and 522‐bp bands were detected in Chip
mice. WT, wild‐type
Genotyping Chip‐flox mice. Chip‐flox mice were genotyped with specific primers P1 (forward primer): 5′‐CATATCTCACCAGGCTCAT‐3′, P2 (reverse primer): 5′‐ACACACAATGACCCACAT‐3′, and P3 (reverse primer): 5′‐GGCCTACCCGCTTCCATTGCTC‐3′. Primer set P1/P3 amplifies a 522‐bp band to detect Chip
allele and primer set P1/P2 amplifies a 328‐bp band to detect WT allele. Both 328‐ and 522‐bp bands were detected in Chipmice. WT, wild‐type
Whole embryo alizarin red/alcian blue staining
Embryos at E14.5 and E18.5 were collected and the skin, viscera, and adipose tissues were carefully removed. Whole skeletons were fixed in 95% ethanol for 2 days followed by fixation in acetone for an additional day, and stained with 0.015% alcian blue and 0.005% alizarin red for 3 days. Images of the skeletons were taken when most of the soft tissue was digested in 1% potassium chloride.
Microcomputed tomography analysis
We used a Scanco microcomputed tomography 35 scanner (Scanco Medical, Brüttisellen, Switzerland) with 55 kVp source and 145 μA current for formalin‐fixed mouse legs with a resolution of 10 μm. The scanned images from each group were evaluated at the same thresholds to allow three‐dimensional structural rendering of each sample.
Histology
Tibiae were harvested and fixed in 10% neutral‐buffered formalin for 3 days and decalcified for 14 days in 14% EDTA and then paraffin‐embedded. Three‐micrometer sections were cut and alcian blue/H&E orange G staining and tartrate‐resistant acid phosphatase (TRAP) staining were performed (Shu et al., 2013; B. Wang et al., 2014; Wang et al., 2017).
Statistical analysis
Data are presented as the mean ± standard deviation. For experiments comparing two groups of data, unpaired Student's t test was performed. A value of p < .05 was considered to be significant.
RESULTS
Skeletal development was delayed in Chip
conditional KO embryos
In previous studies, we investigated the role of CHIP in postnatal bone growth. To determine the role of CHIP in skeletal development, in the present studies, we generated Chipmice and Chip
conditional KO mice and analyzed changes in skeletal development in E14.5 and E18.5 Chip
KO embryos and Cre‐negative littermate embryos. Results of whole embryo alizarin red/alcian blue staining showed that sizes of Chip
KO embryos were smaller (Figure 2a). We also found that the mineralization in the supraoccipital bone and the distal phalanx of the limb were delayed in Chip
KO embryos (Figure 2b–d). Axial bone seems developed normally in Chip
KO mice (Figure 2e). Results of histological analysis showed that the width of limb of E14.5 embryos was reduced in Chip
KO embryos (Figure 2f) and the width and the length of the hypertrophic zones were also decreased in Chip
KO embryos (Figure 2g,h). The size of primary ossification center in the tibiae was smaller in Chip
KO embryos (Figure 2i). In addition, we also found that ColX expression was reduced in the hypertrophic zone of E18.5 Chip
KO embryos (Figure 2j).
Figure 2
Skeletal development was delayed in Chip KO embryos. (a–e) Chip
mice were bred with CMV‐Cre mice and E18.5 Chip
KO embryos and Cre‐negative littermate embryos were analyzed by whole embryo alizarin red/alcian blue staining. (a) The size of Chip
KO embryo was smaller. The mineralization of the supraoccipital bone (a, blue arrowheads) and the digits (d, black arrowheads) was delayed in Chip
KO embryos. (f–i) Chip
mice were bred with CMV‐Cre mice and E14.5 and E18.5 Chip
KO embryos and Cre‐negative littermate embryos were analyzed by histology. (f) Analysis of E14.5 embryos showed that the size and width (red line) of the skeletal were significantly reduced in Chip
KO embryos. (g and h) Analysis of E18.5 embryos showed that the width (red lines) of the skeletal and the length of hypertrophic zone (yellow lines) were reduced in Chip
KO embryos. (i) The size of primary ossification center was smaller in E18.5 Chip
KO embryos. (j) Results of IHC staining showed that ColX expression (red arrowheads) was decreased in E18.5 Chip
KO embryos. IHC, immunohistochemistry; KO, knockout
Skeletal development was delayed in Chip KO embryos. (a–e) Chipmice were bred with CMV‐Cre mice and E18.5 Chip
KO embryos and Cre‐negative littermate embryos were analyzed by whole embryo alizarin red/alcian blue staining. (a) The size of Chip
KO embryo was smaller. The mineralization of the supraoccipital bone (a, blue arrowheads) and the digits (d, black arrowheads) was delayed in Chip
KO embryos. (f–i) Chipmice were bred with CMV‐Cre mice and E14.5 and E18.5 Chip
KO embryos and Cre‐negative littermate embryos were analyzed by histology. (f) Analysis of E14.5 embryos showed that the size and width (red line) of the skeletal were significantly reduced in Chip
KO embryos. (g and h) Analysis of E18.5 embryos showed that the width (red lines) of the skeletal and the length of hypertrophic zone (yellow lines) were reduced in Chip
KO embryos. (i) The size of primary ossification center was smaller in E18.5 Chip
KO embryos. (j) Results of IHC staining showed that ColX expression (red arrowheads) was decreased in E18.5 Chip
KO embryos. IHC, immunohistochemistry; KO, knockout
Bone mass was decreased in Chip
conditional KO mice
Our long‐term goal is to understand the specific roles of CHIP in bone remodeling and in aging in adult mice. To achieve this goal, we generated Chipmice. We have bred Chipmice with CMV‐Cre transgenic mice to determine if Chip
conditional KO mice mimic bone loss phenotype that we have observed in Chip
global KO mice. We analyzed 4‐week‐old Chip
KO mice and found that body weight and body length of Chip
KO mice were significantly reduced compared to the Cre‐negative littermates (Figure 3a–c). The μCT analysis showed that bone volume (bone volume/total volume, %) and bone mineral density (BMD) were significantly decreased in Chip
KO mice compared to the Cre‐negative littermates (Figure 3d–f). Consistent with the findings of bone mass reduction, the trabecular number was decreased and trabecular separation was increased in Chip
KO mice (Figure 3g,h). In contrast, the connectivity density was significantly decreased in Chip
KO mice (Figure 3i), suggesting that the bone quality were also reduced in Chip
KO mice. We then performed histological analysis and observed significant bone loss phenotype in Chip
KO mice (Figure 3j). In contrast, no significant changes in growth plate cartilage were found in Chip
KO mice (Figure 3k). In addition to the changes in bone mass, we also found defects in articular cartilage in Chip
KO mice, including loss of articular chondrocytes and reduced Alcian blue staining (Figure 3l,m), reflecting the loss of proteoglycan in articular cartilage in postnatal Chip
KO mice.
Figure 3
Bone mass was decreased in Chip
conditional KO mice. Chip
mice were bred with CMV‐Cre mice and Chip
conditional KO mice and Cre‐negative control mice were killed at 4 weeks of age. (a–c) The size, body weight, and body length of Chip
KO mice were significantly smaller than Cre‐negative controls. (d–i) Changes in bone mass were analyzed by µCT. (d) Bone mass, (e) bone volume, (f) bone mineral density (BMD), (g) trabecular number (Tb.N.), and (h) In contrast, trabecular separation (Tb.Sp.) was increased (did not reach the statistical significant) in Chip KO mice. (i) connectivity density (Conn.D.) was significantly reduced in Chip KO mice. (j–m) Changes in bone morphology were also analyzed by histology. (j) Bone mass was significantly decreased in Chip
KO mice (trabecular bone was indicated by yellow arrowheads). (k) No significant changes in the length of growth plate cartilage in Chip
KO mice. (l and m) In addition, histological analysis showed that the loss of articular chondrocytes and reduced alcian blue staining (blue arrowheads) was observed in Chip
KO mice. BV/TV, bone volume/total volume; KO, knockout; µCT, microcomputed tomography; WT, wild‐type
Bone mass was decreased in Chip
conditional KO mice. Chipmice were bred with CMV‐Cre mice and Chip
conditional KO mice and Cre‐negative control mice were killed at 4 weeks of age. (a–c) The size, body weight, and body length of Chip
KO mice were significantly smaller than Cre‐negative controls. (d–i) Changes in bone mass were analyzed by µCT. (d) Bone mass, (e) bone volume, (f) bone mineral density (BMD), (g) trabecular number (Tb.N.), and (h) In contrast, trabecular separation (Tb.Sp.) was increased (did not reach the statistical significant) in Chip KO mice. (i) connectivity density (Conn.D.) was significantly reduced in Chip KO mice. (j–m) Changes in bone morphology were also analyzed by histology. (j) Bone mass was significantly decreased in Chip
KO mice (trabecular bone was indicated by yellow arrowheads). (k) No significant changes in the length of growth plate cartilage in Chip
KO mice. (l and m) In addition, histological analysis showed that the loss of articular chondrocytes and reduced alcian blue staining (blue arrowheads) was observed in Chip
KO mice. BV/TV, bone volume/total volume; KO, knockout; µCT, microcomputed tomography; WT, wild‐typeIn previous studies, we found bone loss phenotype in Chip global KO mice. However, it is not known if CHIP exerts its effect directly through bone cells or CHIP acts on bone through an indirect mechanism. To determine the specific effect of Chip on postnatal bone growth, we generated Chip
conditional KO mice by breeding Chipmice with Osx‐CreER transgenic mice, which target osteoblast precursor cells (Maes et al., 2010). Tamoxifen was administered into 2‐week‐old Chipmice and Cre‐negative littermates (Chipmice). The results of a significant decrease in body weight and slightly reduced body size were found in Chip KO mice (Figure 4a–c). Results of μCT analysis showed that bone volume, BMD, trabecular numbers, and connectivity density were significantly reduced and trabecular separation was significantly increased in Chip
KO mice (Figure 4d–i). We also analyzed bone morphological changes with histological method in 4‐week‐old Chip
KO mice. Trabecular bone loss phenotype was found in Chip
KO mice (Figure 4j). These findings suggest that bone mass and bone quality were reduced in Chip
KO mice and indicate that local produced CHIP could directly regulate bone mass. In contrast, we did not observe significant changes in growth plate cartilage (Figure 4k). To further determine changes in bone formation in Chip
KO mice, we performed calcein/calcein double labeling assay. We found that mineral apposition rates and bone formation rates were significantly decreased in Chip
KO mice (Figure 4l–n). Consistent with these findings, results of von Kossa staining showed that mineralized trabecular bone volume was significantly reduced in Chip
KO mice (Figure 4o).
Figure 4
Bone mass was decreased in Chip
conditional KO mice. Chip
mice were bred with Osx‐CreER transgenic mice and resultant Chip
mice were administered with tamoxifen (1 mg/10 g body weight, i.p. injection, x 5 days) in 2‐week‐old Chip
(Cre‐negative control) mice and Chip
mice. Chip
KO mice were then killed at 4 weeks of age. (a and b) Changes in body size and body weight were observed in Chip
KO mice. (c) In contrast, the body length was not significantly changed. (d–i) Bone mass was analyzed by µCT. The μCT images of bone structure and bone morphology showed reduced (d) bone mass, (e) bone volume, (f) bone mineral density (BMD), (g) trabecular number (Tb.N.), and (i) connectivity density (Conn.D.) were significantly reduced in Chip
KO mice. (h) In contrast, trabecular separation (Tb.Sp.) was significantly increased in Chip
KO mice. (j and k) Consistent with µCT analysis, histological results showed bone mass decrease in Chip
KO mice (trabecular bone is indicated by yellow arrowheads). In contrast, no obvious changes in growth plate cartilage morphology were observed in Chip
KO mice. (l–n) We also performed calcein/calcein double labeling assay and results showed that mineral apposition rates (MAR) and bone formation rates (BFR) were significantly reduced Chip
KO mice. (o) Results of von Kossa staining showed that the mineralized bone formation was also reduced in Chip
KO mice. BV/TV, bone volume/total volume; KO, knockout; µCT, microcomputed tomography
Bone mass was decreased in Chip
conditional KO mice. Chipmice were bred with Osx‐CreER transgenic mice and resultant Chipmice were administered with tamoxifen (1 mg/10 g body weight, i.p. injection, x 5 days) in 2‐week‐old Chip
(Cre‐negative control) mice and Chipmice. Chip
KO mice were then killed at 4 weeks of age. (a and b) Changes in body size and body weight were observed in Chip
KO mice. (c) In contrast, the body length was not significantly changed. (d–i) Bone mass was analyzed by µCT. The μCT images of bone structure and bone morphology showed reduced (d) bone mass, (e) bone volume, (f) bone mineral density (BMD), (g) trabecular number (Tb.N.), and (i) connectivity density (Conn.D.) were significantly reduced in Chip
KO mice. (h) In contrast, trabecular separation (Tb.Sp.) was significantly increased in Chip
KO mice. (j and k) Consistent with µCT analysis, histological results showed bone mass decrease in Chip
KO mice (trabecular bone is indicated by yellow arrowheads). In contrast, no obvious changes in growth plate cartilage morphology were observed in Chip
KO mice. (l–n) We also performed calcein/calcein double labeling assay and results showed that mineral apposition rates (MAR) and bone formation rates (BFR) were significantly reduced Chip
KO mice. (o) Results of von Kossa staining showed that the mineralized bone formation was also reduced in Chip
KO mice. BV/TV, bone volume/total volume; KO, knockout; µCT, microcomputed tomographyIn previous studies, we demonstrated that NF‐κB signaling is activated in Chip global KO mice (Wang et al., 2018). In this study, we performed TRAP staining in subchondral bone areas and in trabecular bone areas underneath the growth plate. We found that osteoclast formation was significantly increased in Chip
KO mice (Figure 5a–c), suggesting that osteoclast formation was also affected by Chip
KO mice.
Figure 5
TRAP‐positive osteoclast formation was increased in Chip
conditional KO mice. Chip
mice were bred with Osx‐CreER transgenic mice and resultant Chip
KO mice were administered with tamoxifen in 2‐week‐old Chip
(Cre‐negative control) mice and Chip
mice and the mice were killed at 4 weeks of age. TRAP staining was performed. Significant increases in the numbers of TRAP‐positive cells were detected in subchondral bone areas (a) and in trabecular bone areas underneath the growth plate (b and c) in Chip
KO mice. KO, knockout; TRAP, tartrate‐resistant acid phosphatase
TRAP‐positive osteoclast formation was increased in Chip
conditional KO mice. Chipmice were bred with Osx‐CreER transgenic mice and resultant Chip
KO mice were administered with tamoxifen in 2‐week‐old Chip
(Cre‐negative control) mice and Chipmice and the mice were killed at 4 weeks of age. TRAP staining was performed. Significant increases in the numbers of TRAP‐positive cells were detected in subchondral bone areas (a) and in trabecular bone areas underneath the growth plate (b and c) in Chip
KO mice. KO, knockout; TRAP, tartrate‐resistant acid phosphatase
DISCUSSION
In previous studies, we demonstrated that CHIP controls NF‐κB signaling and regulates postnatal bone growth. In Chip global KO mice, osteoclast formation and bone resorption were increased and osteoblast differentiation was decreased (Li et al., 2014; Wang et al., 2018). In the present studies, we generated Chipmice and then created Chip
and Chip
conditional KO mice. We analyzed changes in skeletal development in Chip
KO embryos and we also analyzed changes in postnatal bone growth and bone mass in 1‐month‐old Chip
and Chip
conditional KO mice. Our findings suggest that CHIP plays an important role in skeletal development and postnatal bone growth and regulates bone mass. Our findings indicate that we have successfully generated Chip conditional KO mice and confirmed that Chip is expressed in Osx‐expressing osteoblast precursor cells and plays a specific role in the regulation of bone mass.Our previous study demonstrated that CHIP regulates NF‐κB signaling through inducing the degradation of multiple TRAF proteins, including TRAF2, TRAF5, and TRAF6 (Li et al., 2014; Wang et al., 2018). It is known that NF‐κB controls growth plate cartilage development. In NF‐κB p50/p65 double KO mice, osteoclast formation is severely impaired leading to defects in the resorption of calcified cartilage and largely expanded hypertrophic cartilage zone at the postnatal stage (Xing et al., 2013). In this study, we found that growth plate cartilage development relatively normal in postnatal Chip
and Chip
KO mice. These findings suggest that the activation of NF‐κB signaling may not be able to significantly affect postnatal growth plate cartilage development although osteoclast formation is increased in Chip KO mice.Bone is an endocrine organ and bone remodeling is a dynamic process that is active throughout the entire life. To determine the specific role of CHIP at different cell populations and at the different developmental stages of life, it requires the generation of inducible Chip conditional KO mice. As a long‐term goal of this project, we will determine the roles of Chip in osteoclast and osteoblast lineage cells at different developmental stages. We have recently generated Chipmice and Chip conditional KO mice which allow us to perform tissue‐specific and longitudinal studies to investigate the role of CHIP in bone remodeling.CHIP may play an important role in aging. Sirtuin 6 (SirT6) is a stress‐responsive protein deacetylase and mono‐ADP ribosyltransferase enzyme encoded by the SirT6 gene (Min et al., 2008). Studies in mice have revealed that Sirt6 is essential for postnatal development and survival. SirT6 functions in multiple molecular pathways related to aging, including DNA repair, telomere maintenance, glycolysis, and inflammation (Frye, 2000). SirT6 promotes resistance to DNA damage and oxidative stress, the defects closely related to age‐associated diseases (Beauharmois, Bolivar, & Welch, 2013). CHIP prevents proteasome‐dependent degradation of SirT6 and SirT6 stability is increased in Chip‐deficient cells. These results suggest that CHIP protects proteasomal degradation of SirT6. To study the roles of CHIP in SirT6 and other proteins associated with aging, we need to create Chipmice and Chip conditional KO mice since Chip global KO mice died at postnatal or early adult stages. We have recently generated Chip
and Chip
conditional KO mice, which showed bone loss phenotype as we observed in Chip global KO mice (Li et al., 2014; Wang et al., 2018), suggesting that Chipmice could be used for long‐term and longitudinal studies.The roles of CHIP in physiological functions and disease initiation and progression have been extensively investigated in recent years. For example, CHIP plays a critical role in neurodegenerative diseases, inflammation, and cardiovascular diseases. Generation and making the availability of Chipmice to other fields will make studies of CHIP functions in other organ systems easier.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
W. W., J. L., F. C. K., X. Z., Y. Q., and R. S. L. carried out experiments. T. W. and D. C. prepared the manuscript, contributed to the experimental design, data interpretation, and finalized the manuscript. D. R. S. revised the manuscript.
ETHICS STATEMENT
The animal protocol of this study has been approved by the IACUC of the Rush University Medical Center and all experimental methods and procedures were carried out in accordance with the approved guidelines.
Authors: Jin-Na Min; Ryan A Whaley; Norman E Sharpless; Pamela Lockyer; Andrea L Portbury; Cam Patterson Journal: Mol Cell Biol Date: 2008-04-14 Impact factor: 4.272