Extracellular Matrix Protein 1 Gene Mutation in Turkish Patients with Lipoid Proteinosis.

BACKGROUND: Lipoid proteinosis (LP) is a rare autosomal recessive genodermatosis characterized by mucocutaneous lesions and hoarseness of voice that develop in early childhood. LP is caused by mutation in the extracellular matrix protein 1 (ECM1) gene, which is located on 1q21.2. AIMS: This study aimed to present the profile of ECM1 gene mutations and to identify possible novel mutations specific to Turkey.
MATERIALS AND METHODS: The ECM1 gene mutations of 19 LP patients from five families were evaluated using DNA isolated from peripheral blood samples. All ten exons in the ECM1 gene region were amplified by polymerase chain reaction (PCR). The PCR products were analyzed using a DNA sequencing analyzer. The results of DNA sequencing were analyzed with bioinformatics methods.
RESULTS: of the 19 LP patients evaluated in our study, we detected defects in exon 6 (c.507delT, 658T>G), exon 9 (157C>T, 727C>T), and exon 10 (c.93_94delGCinsTT) of the ECM1 gene.
CONCLUSIONS: Our results indicate that defects in exons 6, 9, and 10 of the ECM1 gene were responsible for LP in our country. The identification of these pathogenic mutations is valuable because it facilitates early diagnosis and genetic counseling. Copyright:

Introduction

Lipoid proteinosis (LP), also known as hyalinosis cutis et mucosae and Urbach–Wiethe disease, is a rare hereditary disorder transmitted by autosomal recessive inheritance. After Urbach and Wiethe provided the first clear description of the disease, more than 300 cases have been reported worldwide.[1]

Onset is usually in infancy, presenting with a hoarse cry, while skin lesions can manifest in early childhood or later. Yellowish infiltrated papules and nodules and verrucous hyperkeratosis appear on the elbows, knees, and buttocks. In addition, the skin may be fragile during childhood, resulting in trauma-induced vesicles and blisters with residual acneiform scars. Mucosal lesions always include vocal cord and laryngeal thickening, accompanied by variable tongue, palate, and lip infiltration. Extracutaneous signs may include epilepsy and neuropsychiatric disorders associated with cerebral calcifications.[12]

LP is caused by mutation in the extracellular matrix protein 1 (ECM1) gene, which has four major splice variants encoding isoforms of ECM1. ECM1 is a glycoprotein expressed in skin and other body tissues, which is involved in the structural organization of the dermis.[1234] The ECM1 protein has vital physiological and biological implications in epidermal differentiation, binding of dermal collagens and proteoglycans, and in angiogenesis.[3]

In 2002, LP was mapped to a locus on chromosome 1q21, and pathogenic mutations in the ECM1 gene were identified. Since then, a total of 52 distinct pathogenic ECM1 mutations have been reported, including missense, nonsense, frameshift, splice-site, and small and large deletions or insertions, with nearly 50% of the mutations occurring in exons 6 and 7 (The Human Gene Mutation Database; www.hgmb.cf.ac.uk; September 17, 2014).[4]

In the present study, we used polymerase chain reaction (PCR) and DNA sequencing to investigate the ECM1 gene mutation spectrum of a group of LP patients in Turkey to identify possible new mutations specific to our region.

Materials and Methods

Subjects

The study included 19 patients from five families who were diagnosed with LP based on clinical and histopathologic findings. The patients were examined at Harran University Hospital. Written informed consent was obtained from all patients before participation in the study.

Genetic analysis

DNA was extracted from whole blood samples using GeneJET Genomic DNA Purification Kit (Catalog number:K0721). Primers were designed for PCR amplification of the ten exons of the ECM1 gene [Table 1], and the amplification products were sequenced on an Applied Biosystems 3730xl automated sequencer.

Table 1

Primers and annealing temperature for the extracellular matrix protein 1 gene

Exon	Forward primer (5′→3′)	Reverse primer (5′→3′)	Annealing temperature (°C)
1	AGCTGGGACTGAGTCATGGC	TAAAGGCTCCACTGGCCTAG	62
2/3	TCCTACACTCTTGATCTCCA	GGTGTCAACAGGATCCATAG	60
4/5	CAGTGACCCTCCAGGTTTCT	CAGAGCCCACCGTCTTGTCT	60
6	AGCCTTGAGAAGCAGGAGGA	AGTGAACGGGACCTGAGGTT	60
7	TTATCTGCCTGCCCAGTGTC	ACATGGATGGATGGACTGGC	60
8	CACATCAACAGTTGCCTCCT	GGCATCTTCTGGCATCAGAT	60
9	AGTTGCCTAGTCCTTCCCCA	AGGCCAGGTCAGAGTGAAGA	60
10	AATCCAGCTGTGCAAGGCAG	GTAATGAGTGTTCAGATGGG	62

Statistical analysis

After DNA sequencing, chromatogram files (.ab1 extension) were enhanced with Chromas software (Technelysium Pvt Ltd, South Brisbane, Australia), Human chromosomal sequence (Genome Reference Consortium Human Build 38) was aligned with ECM1 multi-RNA (mRNA) sequence (NM_004425.3) using Blast2 (NCBI/NLM/NIH, Bethesda, MD) and T-Coffee (CRG, Barcelona, Spain) software. Perl scripts were implemented to scan each of the alignments against the existing nine Single Nucleotide Polymorphisms (SNPs) already associated with the disease in ClinVar. The nine ClinVar identifiers used in this analysis were 7472, 7475, 7476, 222944, 222945, 222946, 222947, 222948, 222949. We found five of these nine ClinVar SNPs in our samples. The analysis was repeated with the Magic-BLAST program, which was recently introduced by the NCBI.

Results

Clinical

In total, 19 diagnosed LP patients from five unrelated families (parents and children) were studied. All the patients had second-degree consanguinity in their family history. The patient group included 9 (47%) females and 10 (53%) males. The youngest patient was 8 month old and the oldest was 60 year old. Physical and dermatological examinations of the patients showed that they all had typical cutaneous signs and hoarseness.

The common features of the patients were hoarseness, acneiform scars after trauma, a thick, short lingual frenulum, and limited tongue movement [Figures 1 and 2]. Most of the patients had yellow-colored infiltration on the lower lip and sides of the tongue and thickened and coarsened uvula and tonsil [Figure 3]. Plantar hyperkeratosis and eyelid papules were also observed in most of the patients. Less common features were warty papules, palmar hyperkeratosis, and hair loss [Figure 4]. Histopathologic examination of 11 patients showed minimal hyperkeratosis and acanthosis in the epidermis and diastase-resistant, amyloid-negative material accumulation with positive eosinophilic periodic acid–Schiff staining in the papillary dermis, blood vessel walls, adnexa epithelium, and eccrine glands. Ophthalmological examinations of the patients were normal, except for blepharitis in two patients. Neurological examination results showed that all the patients had normal reflexes and gait, as well as normal cognitive and motor development. Psychiatric examinations of all the patients were normal and revealed no additional symptoms such as depression.

Figure 1

Clinical examination of a patient with lipoid proteinosis shows areas of acneiform scars after trauma on elbow and scarring on the dorsal surface of the forearm

Figure 2

Acneiform scars on the face and forehead and erosions on lip edges. Thickening and hardening of the cheek skin

Figure 3

Patients had a yellow-colored infiltration on the face, eyelid papules, and acneiform scars

Figure 4

Hypopharyngeal and laryngeal mucosa showed yellow-white infiltrates

Of the 19 patients included, defects in exons 6, 9, and 10 of the ECM1 gene were detected in seven patients. Figure 5 shows our results in the form of pedigree charts of the five families. No ECM1 mutations were detected in family 1. In family 2, exon 6 c.507delT mutations were found in two patients, one of whom also carried a 658T>G mutation. Exon 9 157C>T mutation was detected in one patient in family 3. In family 4, exon 9 727C>T mutation was detected in the mother, while two daughters were found to carry exon 6 c.507delT mutations. Exon 10 (c.93_94delGCinsTT) mutation was detected in one patient in family 5.

Figure 5

Pedigree charts showing the extracellular matrix protein 1 mutations detected in the five families with lipoid proteinosis patients

Discussion

LP is a rare autosomal recessive disease characterized by deposition of hyaline material in the skin and mucosa. The disease has a stable or slowly progressive course, and early manifestations are predictive of outcome.[2] More than 300 cases of LP have been reported in the global literature.[3] Its incidence is relatively high in the Southeastern Anatolia Region of Turkey due to cultural acceptance of consanguineous marriage.[5]

Except for a few missense mutations, nearly all of the ECM1 mutations documented in LP are predicted to lead to low or absent mRNA or protein expression.[2] Clinical variability between siblings carrying the same homozygous mutation indicates that genotype is not the only factor determining phenotype.[5] Genetic, epigenetic, and environmental factors likely play role in the clinical expression of LP.[2]

Since Hamada first identified the ECM1 gene in 2002, a total of 56 distinct pathogenic mutations have been reported, and nearly 50% of the mutations occur in exons 6 and 7 of the gene.[6] Only three mutations have been described either in the first 2 exons or in the first intron of ECM1.[6] A missense mutation in the first exon of ECM1, p. Val10Gly, was previously discovered in a Polish family with splicing mutation IVS1+1G>A. Another mutation at the same locus, IVS1+1G>C, was documented in a large family of Arabian origin in Israel with relatively severe skin involvement. In addition, homozygous nonsense mutations in exon 10 were detected in Indian LP patients.[6]

ECM1 mutations associated with LP consist primarily of nonsense and missense mutations. In addition, a few splice mutations have also been reported. In 2016, a 26-year-old female LP patient from a Turkish consanguineous family carrying a novel homozygous splice-site mutation in intron 8 of the ECM1 gene was reported. In another study in 2017, a homozygous splice-site mutation (c.1393–1G>T) was documented, which was the eighth splice-site mutation reported in ECM1 and the first splice-site mutation in intron 9.[7]

In addition to the mutations detected in different exons and introns, a mutation has been reported to cause changes in the signal peptide sequence of ECM1.[68]

A study reported in Egypt in 2017 was performed on 12 patients from 10 families.[2] All parents were consanguineous. All patients exhibited hoarseness and skin changes while 75% had beaded eyelid papules. There was thickening of the skin on the elbows and knees in all patients. Some of the patients also had yellow-white papules and ulcers on the oral mucosa. In that study, five novel ECM1 mutations were reported in exon 1 (c.10_11insC), exon 6 (c.690_691delAG), exon 7 (c.734G>A), exon 8 (c.1286_1287delAA), and intron 9 (c.1393–1G>T).

A 25-year-old male patient with LP was reported in a publication from China in 2016. The patient had skin lesions since early childhood. He had a younger brother who was not affected, and there was no evidence of consanguinity in his family. An ECM1 sequence analysis revealed a novel compound heterozygous mutation in exons 3 and 8.[9]

In a report from Pakistan, exon 6 of ECM1 showed a novel homozygous mutation (c.616C>T), which was predicted to replace glutamine with stop codon (P. Q206X) at amino acid position 206.[10]

In 2016, a study was conducted to investigate the ECM1 mutation spectrum in nine Iranian families with twelve suspected LP patients, along with their parents and children. A homozygous G>A transition at nucleotide c.806 in exon 7 was detected in only one patient. Most of the patients carried a G>A substitution at nucleotide 1243 in exon 8, which changes glycine guanine (GGT) to serine (AGT). Other mutations detected included an A>T transition in nucleotide 4307 in intron 8 in one patient and a C (4249) deletion in intron 8 in two patients. Their results indicate that although ECM1 mutations are associated with LP, it is likely that ECM1 is not the only gene causing this disease, and other genes may be involved in LP pathogenesis.[11]

In a study conducted in 2015,[4] the clinical and genetic characteristics of 12 LP patients from three Iranian families were evaluated. Seven of the twelve patients had consanguineous parents. Among the patients, seven were female and five were male. While all patients demonstrated diagnostic features of LP such as hoarseness, there was considerable variability in the expression and severity of features associated with LP. Significant phenotypic variability in this multisystem disorder was noted, including the presence of convulsions and epilepsy in about half of the patients. In most cases, this was associated with calcification in the brain detected by magnetic resonance imaging/computed tomography scans. Interestingly, despite the highly heterogeneous phenotypes, all of the patients in that study shared the same homozygous ECM1 mutation, c.507delT in exon 6.

In the present study, our genetic analysis of 19 LP patients revealed a total of seven ECM1 mutations, including c.507delT 658T>G in exon 6, c.507delT in exon 6, 157C>T in exon 9, 727C>T in exon 9, c.507delT in exon 6, c.507delT in exon 6, and c.93_94delGCinsTT in exon 10.

Although it is a rare condition, the prevalence of LP is much higher in Turkey compared to the rest of the world. To date, about 100 LP cases have been reported from different regions of Turkey, accounting for a very large proportion of the total number of cases reported globally. Therefore, as the first analysis of ECM1 mutations in Turkish LP patients, this study is an important contribution to the literature. However, further clinical and genetic studies are needed to better the understanding of the genetic causes and determinants of phenotypic variability in LP.[5]

Conclusions

Herein, we investigated the ECM1 gene mutation spectrum of a group of LP patients in Turkey and presented our region-specific results together with a discussion of several LP cases with ECM1 mutation reported from various other countries. We identified various ECM1 mutations, including c.507delT 658T>G in exon 6, c.507delT in exon 6, 157C>T in exon 9, 727C>T in exon 9, c.507delT in exon 6, c.507delT in exon 6, and c.93_94delGCinsTT in exon 10 in our patients. The present study is important because it is the first to report LP gene mutation in our country.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.