Literature DB >> 31894177

Molecular phylogenetics of slit-faced bats (Chiroptera: Nycteridae) reveal deeply divergent African lineages.

Terrence C Demos1, Paul W Webala2, Julian C Kerbis Peterhans1,3, Steven M Goodman1,4, Michael Bartonjo5, Bruce D Patterson1.   

Abstract

The bat family Nycteridae contains only the genus Nycteris, which comprises 13 currently recognized species from Africa and the Arabian Peninsula, one species from Madagascar, and two species restricted to Malaysia and Indonesia in South-East Asia. We investigated genetic variation, clade membership, and phylogenetic relationships in Nycteridae with broad sampling across Africa for most clades. We sequenced mitochondrial cytochrome b (cytb) and four independent nuclear introns (2,166 bp) from 253 individuals. Although our samples did not include all recognized species, we recovered at least 16 deeply divergent monophyletic lineages using independent mitochondrial and multilocus nuclear datasets in both gene tree and species tree analyses. Mean pairwise uncorrected genetic distances among species-ranked Nycteris clades (17% for cytb and 4% for concatenated introns) suggest high levels of phylogenetic diversity in Nycteridae. We found a large number of designated clades whose members are distributed wholly or partly in East Africa (10 of 16 clades), indicating that Nycteris diversity has been historically underestimated and raising the possibility that additional unsampled and/or undescribed Nycteris species occur in more poorly sampled Central and West Africa. Well-resolved mitochondrial, concatenated nuclear, and species trees strongly supported African ancestry for SE Asian species. Species tree analyses strongly support two deeply diverged subclades that have not previously been recognized, and these clades may warrant recognition as subgenera. Our analyses also strongly support four traditionally recognized species groups of Nycteris. Mitonuclear discordance regarding geographic population structure in Nycteris thebaica appears to result from male-biased dispersal in this species. Our analyses, almost wholly based on museum voucher specimens, serve to identify species-rank clades that can be tested with independent datasets, such as morphology, vocalizations, distributions, and ectoparasites. Our analyses highlight the need for a comprehensive revision of Nycteridae.
© 2019 The Authors Journal of Zoological Systematics and Evolutionary Research Published by Blackwell Verlag GmbH.

Entities:  

Keywords:  Africa; Nycteris; biodiversity; species tree; taxonomy

Year:  2019        PMID: 31894177      PMCID: PMC6919933          DOI: 10.1111/jzs.12313

Source DB:  PubMed          Journal:  J Zool Syst Evol Res        ISSN: 0947-5745            Impact factor:   2.288


INTRODUCTION

The Paleotropical slit‐faced bats, family Nycteridae, all belong to the genus Nycteris with 13 of 16 recognized species found in continental Africa and offshore islands, one species on Madagascar, and two species endemic to South‐East Asia (Mammal Diversity Database, 2019; Simmons, 2005). Members of the Nycteridae are readily recognizable by their nose leaves, which are divided by a deep median furrow running the length of the muzzle, the basis for their common name. They also possess a Y‐shaped terminal caudal vertebra that is unique among mammals. Systematic reviews of the family have not been informed by morphological or molecular phylogenetics, and the most recently named species in the family was described a half‐century ago (N. vinsoni, Dalquest, 1965). To put this taxonomic stasis in context, the number of recognized bat species globally has grown by 26.4% over the last 15 years. In the Paleotropics, this has included a 38% increase in the number of species of Rhinolophidae and a >50% increase in species in the genera Scotophilus and Miniopterus (cf. Simmons, 2005; Mammal Diversity Database, 2019). Here, we use a geographically extensive, multilocus dataset to assay the diversity and infer the evolutionary relationships of Nycteridae in order to establish the foundations for a fuller taxonomic revision. In the first systematic revision of Nycteridae, Andersen (1912) divided then‐known taxa into four species groups: javanica, hispida, aethiopica [now known as macrotis], and thebaica. Later, Aellen (1959) divided the javanica group into two based on tragus and dental characters: javanica (monotypic) and arge, which contained both African and Asian species. Using morphometrics and hyoid morphology, respectively, Van Cakenberghe and De Vree (1993a) and Griffiths (1997) later transferred the Asian member of the arge group, N. tragata, to the javanica group. This five‐group classification has been widely accepted (e.g., Simmons, 2005), but taxonomic membership in these groups has varied, owing to mosaic character variation. For example, the absence of biometrical differences in teeth measurements suggested the conspecificity of N. parisii with N. woodi (Van Cakenberghe & de Vree, 1985), but a subsequent study of bacula strongly supported the validity of both species and suggested their assignment to entirely different species groups (Thomas, Harrison, & Bates, 1994). Although qualitative and mensural characters have been used to characterize and differentiate species, external and skull characters are in conflict with other morphological characters (e.g., Happold, 2013a; Monadjem, Taylor, Cotterill, & Schoeman, 2010; Thomas et al., 1994; Van Cakenberghe & de Vree, 1985, 1993a, 1993b, 1998). Except for Griffiths’ (1997) analysis of the hyoid apparatus, the morphological characters of the species of Nycteridae have not been subjected to explicit phylogenetic analysis. Figure 1 shows the host of names available for Nycteris populations, many of them currently considered synonyms (cf. Simmons, 2005).
Figure 1

Named taxa of Nycteris, showing type localities for recognized species (filled circles) and subspecies or synonyms (open circles). Number codes are as follows: 1 – adana K. Andersen, 1912; 2 – aethiopica Dobson, 1878; 3 – affinis A. Smith, 1829; 4 –albiventer Wagner, 1840; 5 – angolensis Peters, 1871; 6 – arge Thomas, 1903; 7 – aurantiaca De Beaux, 1923; 8 – aurantiaca Monard, 1939; 9 – aurita K. Andersen, 1912; 10 – avakubia J. A. Allen, 1917; 11 – baikii Gray 1867; 12 – bastiani Bergmans & van Bree, 1986; 13 – benuensis Aellen, 1952; 14 – brockmani K. Andersen, 1912; 15 – capensis A. Smith, 1829; 16 – damarensis Peters, 1871; 17 – daubentonii. Geoffroy, 1813; 18 – discolor Wagner, 1840; 19 – fuliginosa Peters, 1852; 20 – gambiensis K. Andersen, 1912; 21 – geoffroyi Desmarest, 1820; 22 – grandis Peters, 1865; 23 – guineensis Monard, 1939; 24 – hispida Schreber, 1775; 25 – intermedia Aellen, 1959; 26 – javanica. Geoffroy, 1813; 27 – labiata Heuglin, 1861; 28 – luteola Thomas, 1901; 29 – macrotis Dobson, 1876; 30 – madagascariensis G. Grandidier, 1937; 31 – major K. Andersen, 1912; 32 – marica Kershaw, 1923; 33 – martini Fraser, 1843; 34 – media K. Andersen, 1912; 35 – najdiya Nader & Kock, 1982; 36 – nana K. Andersen, 1912; 37 – oriana Kershaw, 1922; 38 – pallida J. A. Allen, 1917; 39 – parisii De Beaux, 1924; 40 – proxima Lonnberg & Gyldenstolpe, 1925; 41 – revoilii Robin, 1881; 42 – sabiensis Roberts, 1946; 43 – senegalensis Hartmann, 1868; 44 – thebaica. Geoffroy, 1818; 45 – tragata K. Andersen, 1912; 46 – tristis G. M. Allen & Lawrence, 1936; 47 – villosa Peters, 1852; 48 – vinsoni Dalquest, 1965; and 49 – woodi K. Andersen, 1914. An additional name, pilosa Gray, 1866 from “Africa,” is not shown

Named taxa of Nycteris, showing type localities for recognized species (filled circles) and subspecies or synonyms (open circles). Number codes are as follows: 1 – adana K. Andersen, 1912; 2 – aethiopica Dobson, 1878; 3 – affinis A. Smith, 1829; 4 –albiventer Wagner, 1840; 5 – angolensis Peters, 1871; 6 – arge Thomas, 1903; 7 – aurantiaca De Beaux, 1923; 8 – aurantiaca Monard, 1939; 9 – aurita K. Andersen, 1912; 10 – avakubia J. A. Allen, 1917; 11 – baikii Gray 1867; 12 – bastiani Bergmans & van Bree, 1986; 13 – benuensis Aellen, 1952; 14 – brockmani K. Andersen, 1912; 15 – capensis A. Smith, 1829; 16 – damarensis Peters, 1871; 17 – daubentonii. Geoffroy, 1813; 18 – discolor Wagner, 1840; 19 – fuliginosa Peters, 1852; 20 – gambiensis K. Andersen, 1912; 21 – geoffroyi Desmarest, 1820; 22 – grandis Peters, 1865; 23 – guineensis Monard, 1939; 24 – hispida Schreber, 1775; 25 – intermedia Aellen, 1959; 26 – javanica. Geoffroy, 1813; 27 – labiata Heuglin, 1861; 28 – luteola Thomas, 1901; 29 – macrotis Dobson, 1876; 30 – madagascariensis G. Grandidier, 1937; 31 – major K. Andersen, 1912; 32 – marica Kershaw, 1923; 33 – martini Fraser, 1843; 34 – media K. Andersen, 1912; 35 – najdiya Nader & Kock, 1982; 36 – nana K. Andersen, 1912; 37 – oriana Kershaw, 1922; 38 – pallida J. A. Allen, 1917; 39 – parisii De Beaux, 1924; 40 – proxima Lonnberg & Gyldenstolpe, 1925; 41 – revoilii Robin, 1881; 42 – sabiensis Roberts, 1946; 43 – senegalensis Hartmann, 1868; 44 – thebaica. Geoffroy, 1818; 45 – tragata K. Andersen, 1912; 46 – tristis G. M. Allen & Lawrence, 1936; 47 – villosa Peters, 1852; 48 – vinsoni Dalquest, 1965; and 49 – woodi K. Andersen, 1914. An additional name, pilosa Gray, 1866 from “Africa,” is not shown Molecular phylogenetic analyses of the Nycteridae are likewise limited, as they included only a handful of species, each represented by a single sample. Shi and Rabosky (2015) used a concatenated supermatrix and included 7 of 16 Nycteris species in a time‐calibrated analysis of all Chiroptera. They found strong support for the traditional sister relationship between Nycteridae and Emballonuridae (the two families comprising the Emballonuridea of Koopman, 1993). The supermatrix analysis of Amador, Moyers Arévalo, Almeida, Catalano, and Giannini (2018), also based on the same seven Nycteris species, found inconsistent evidence for the endemic Malagasy Myzopodidae joining this group. Nevertheless, both studies recovered Nycteridae as monophyletic and a close relative of Emballonuridae, and both studies recovered the two Asian species, N. tragata and N. javanica, as well‐supported sisters. It should be noted, however, that both studies were based on incomplete supermatrices (71% missing data in Amador et al., 2018 and 83% missing in Shi & Rabosky, 2015). Thus, the diversity and phylogenetic relationships of species in Nycteridae remain largely unresolved and the evolutionary independence of Nycteris lineages has yet to be established. Bat surveys across Africa over the last two decades have provided substantial new material for the evaluation of phylogenetic relationships and species limits. In addition, recent studies (Demos, Webala, Bartonjo, & Patterson, 2018; Dool et al., 2016; Patterson et al., 2018) have shown that a multilocus intron system based on different chromosomes and enabling independent representation of the nuclear genome offers clear advantages over analyses based only on mitochondrial data. Advantages include better resolution of earlier divergences (e.g., Demos et al., 2019) and improved detection of instances of mitochondrial introgression (e.g., Dool et al., 2016; Hassanin et al., 2018). Here, we address three key aspects of Nycteridae evolution: (a) recognizing monophyletic lineages within Nycteris, focusing on Afrotropical species, and assessing their evolutionary independence using independent nuclear loci under a coalescent framework; (b) evaluating their phylogenetic relationships using both nuclear and mitochondrial data in gene tree, concatenated, and species tree analyses; and (c) assessing the species‐group relationships of Nycteris species that had been classified by morphology alone. This study highlights the need for a comprehensive revision of African Nycteridae. Our analyses and discussion serve to identify species‐rank clades that need to be tested with independent datasets including morphology, vocalizations, distributions, and ectoparasites.

MATERIALS AND METHODS

Selection of taxa and sampling

The bats newly sequenced for this study (n = 249) were collected during recent small mammal surveys across sub‐Saharan Africa, with relatively dense sampling in East Africa (see Figure S1 in Supporting Information). Initial assignment of individuals to species for East African specimens was determined using meristic, mensural, and qualitative characters presented in the bat keys of Thorn, Kerbis Peterhans, and Baranga (2009) and Patterson and Webala (2012). Field methods followed mammal collecting guidelines (Sikes, 2016) and were approved under Field Museum of Natural History IACUC #2012‐003. Tissues were taken from euthanized specimens in the course of preparing voucher specimens following IACUC protocols and the respective national collecting permits. Tissues were variously preserved in ethanol, saturated salt solution (EDTA‐DMSO‐NaCl), or liquid nitrogen and stored in liquid nitrogen dewars. Four additional cytochrome b gene (cytb) sequences of Nycteris were downloaded from GenBank. Coleura afra (Emballonuridae) was included as an out‐group. In total, 1–5 genes were analyzed in 253 individuals in this study (see Table S1 in Supporting Information for voucher numbers and locality data and Appendix 1 for GenBank accession numbers). To enable subsequent integrative taxonomic revisions, all but four of the individuals analyzed genetically in this study are accompanied by museum voucher specimens suitable for morphological analysis. In view of the large number of names (many of which are synonyms; Figure 1) and to avoid contributing to current taxonomic confusion in Nycteris, we utilized a conservative approach in labeling clades. Where a clade's taxonomic identity was ambiguous or unknown, we referred to it simply as a numbered clade. In some cases, even assignment to equivocal groupings was necessary (e.g., hispida/aurita and cf. hispida/aurita). Although used as explicit labels in our study, the validity of these names is provisional. Comprehensive morphological assessments of individual specimens making up these clades included in our analyses will be required in order to verify which, if any, existing names may apply to them.

Amplification and sequencing

We sequenced one mitochondrial protein‐coding gene cytochrome b (cytb) and the nuclear introns acyl‐CoA oxidase 2 intron 3 (ACOX2), COP9 signalosome subunit 7A intron 4 (COPS7A), rogdi atypical leucine zipper intron 7 (ROGDI), and signal transducer and activator of transcription 5A intron (STAT5A) for specimens of Nycteris and the close emballonurid out‐group Coleura afra. Primers, primer references, and thermocycler conditions are described in Table 1. General methods of DNA extraction, amplification, and sequencing follow Demos et al. (2018) and Patterson et al. (2018). DNA sequences were assembled, aligned, and edited using GENEIOUS PRO v.11.1.5 (Biomatters Ltd.). Alignments were inspected visually and determined to be unambiguous. Several gaps were introduced in the alignments of the four nuclear introns, but their positions were unambiguous. Sequences of cytb were translated to amino acids to confirm the absence of premature stop codons and indels. The cytb alignment was trimmed to 1,121 nucleotides to minimize missing data. Before phylogenetic analyses using mitochondrial data, we reduced the matrix of 253 individuals to the set of unique sequences, resulting in a final matrix of 164 individuals. The matrix used for calculating cytb distances between lineages comprised 250 individuals from the 253 individual alignments. We resolved nuclear DNA to haplotypes with the PHASE program (Stephens, Smith, & Donnelly, 2001) and set the probability threshold to 70%, following Garrick, Sunnucks, and Dyer (2010). PHASE files were formatted and assembled using SeqPhase (Flot, 2010).
Table 1

Primer information for genes amplified in the current study. References indicated by (a) Salicini, Ibáñez, & Juste, 2011; (b) Eick, Jacobs, & Matthee, 2005; (c) Trujillo, Patton, Schlitter, & Bickham, 2009)

GenePrimers (5’–3’)Amplicon lengthReferencesThermal profile
ACOX2

ACOX2f CCTSGGCTCDGAGGAGCAGAT

ACOX2r GGGCTGTGHAYCACAAACTCCT

717 bpa3 min at 95°C followed by 10 cycles of 15 s at 95°C, 30 s at 65°C in 1°C decrements from 65°C (64–56°C), and 1 min at 72°C, followed by 36 cycles of 15 s at 95°C, 30 s at 55°C, and 1 min at 72°C, and final 5 min extension at 70°C
COPS7A

COPSf TACAGCATYGGRCGRGACATCCA

COPSr TCACYTGCTCCTCRATGCCKGACA

689 bpaSame as ACOX2 above
ROGDI

ROGDIf CTGATGGAYGCYGTGATGCTGCA

ROGDIr CACGGTGAGGCASAGCTTGTTGA

505 bpa3 min at 95°C followed by 10 cycles of 15 s at 95°C, 30 s at 60°C in 1°C decrements from 60°C (59–51°C), and 1 min at 72°C, followed by 36 cycles of 15 s at 95°C, 30 s at 50°C, and 1 min at 72°C, and final 5 min extension at 70°C
STAT5A

STAT5f CTGCTCATCAACAAGCCCGA

STAT5r GGCTTCAGGTTCCACAGGTTGC

530 bpbSame as ROGDI above
cytb

LGL−765f GAAAAACCAYCGTTGTWATTCAACT

LGL−766r GTTTAATTAGAATYTYAGCTTTGGG

c3 min at 95°C followed by 36 cycles of 45 s at 95°C, 30 s at 50°C, and 2.5 min at 70°C, and final 5 min extension at 70°C
Primer information for genes amplified in the current study. References indicated by (a) Salicini, Ibáñez, & Juste, 2011; (b) Eick, Jacobs, & Matthee, 2005; (c) Trujillo, Patton, Schlitter, & Bickham, 2009) ACOX2f CCTSGGCTCDGAGGAGCAGAT ACOX2r GGGCTGTGHAYCACAAACTCCT COPSf TACAGCATYGGRCGRGACATCCA COPSr TCACYTGCTCCTCRATGCCKGACA ROGDIf CTGATGGAYGCYGTGATGCTGCA ROGDIr CACGGTGAGGCASAGCTTGTTGA STAT5f CTGCTCATCAACAAGCCCGA STAT5r GGCTTCAGGTTCCACAGGTTGC LGL−765f GAAAAACCAYCGTTGTWATTCAACT LGL−766r GTTTAATTAGAATYTYAGCTTTGGG

Gene trees, networks, species trees, and summary statistics

PartitionFinder 2 (Lanfear, Frandsen, Wright, Senfeld, & Calcott, 2016) on CIPRES Science Gateway v.3.1 (Miller, Pfeiffer, & Schwartz, 2010) was used to determine the appropriate model of sequence evolution using the Bayesian information criterion (BIC) for cytb and the four nuclear introns. Interspecific uncorrected sequence divergences (p‐distances) for cytb were calculated for both positions 1, 2, and 3 and positions 1 and 2 only, and intraspecific distances were calculated using positions 1, 2, and 3 using MEGA X 10.0.5 (Kumar, Stecher, Li, Knyaz, & Tamura, 2018). Maximum‐likelihood (ML) inference of cytb gene trees and a concatenated alignment using four partitioned nuclear introns were made using the program IQ‐TREE version 1.6.0 (Nguyen, Schmidt, von Haeseler, & Minh, 2015) on the CIPRES portal. Gene tree analyses under a Bayesian inference (BI) framework were carried out in MRBAYES v.3.2.6 (Ronquist et al., 2012) on the CIPRES portal to infer gene trees for cytb and the partitioned alignment of four nuclear introns. Two replicates were run in MrBayes, and nucleotide substitution models were unlinked across partitions for each nuclear locus in the concatenated alignment. Four Markov chains were run for 1 × 107 generations using default heating values and sampled every 1000th generation. Stationarity of the MRBAYES results was assessed in Tracer v1.7 (Rambaut, Drummond, Xie, Baele, & Suchard, 2018). Majority‐rule consensus trees were inferred for each Bayesian analysis. PopART (Leigh & Bryant, 2015) was used to construct a median‐joining network of cytochrome b haplotypes for clades within Nycteris thebaica. Pie charts were used to visualize the relative frequencies and relationships of haplotypes in N. thebaica clades 1–6. Nycteris taxa were assigned to either species or named clades based on clade support in the analyses of the cytb and nuclear intron datasets. As in Demos et al. (2018), results from gene tree analyses were used to identify populations to be used as “candidate species” for the species tree approach implemented in StarBEAST2 (Ogilvie, Bouckaert, & Drummond, 2017), an extension of BEAST v.2.5.1 (Bouckaert et al., 2014). Species tree analyses were carried out using the four nuclear intron alignments with substitution, clock, and tree models unlinked among loci. The lognormal relaxed‐clock model was applied to each locus using a Yule tree prior and the linear with constant root population size model. Four replicates were carried out, and the analyses were run for 2 × 108 generations with 10% of each run discarded as burn‐in. We used Tracer v.1.7 to assess convergence and stationarity of model parameters based on ESS values and examination of trace files. Sequence alignments used in this study have been deposited on the Figshare data repository (https://doi.org/10.6084/m9.figshare.8081594.v1). All newly generated sequences are available on GenBank with accession numbers MK837076–MK837603 (see also Appendix 1).

RESULTS

Mitochondrial genetic diversity, gene trees, and haplotype network

Sequences were generated and aligned for cytb (1,121 bp, 99% coverage), ACOX2 (646 bp, 96% coverage), COPS7A (624 bp, 98% coverage), ROGDI (450 bp, 98% coverage), and STAT5A (523 bp, 98% coverage). The concatenated alignment of four introns for 70 individuals was 97.1% complete (mean sequence length 2,166 bp). Models of sequence evolution inferred by PartitionFinder 2 were as follows: cytb, GTR + I+G; ACOX2, TrN + G; COPS7A, TrN + G; ROGDI, TrN + G; and STAT5A, TrN + G. Uncorrected cytb distances for reciprocally monophyletic Nycteris lineages in the 250 sequence cytb alignment ranged from 3.6% to 22.2% for cytb positions 1 + 2 + 3 and 1.0%–8.0% for cytb positions 1 + 2 (Table 2). Within‐lineage variability for cytb positions 1 + 2 + 3 ranged from 0% to 4.9%.
Table 2

Uncorrected cytb p‐distances among clades of Nycteris: on and below diagonal based on positions 1, 2, and 3; above diagonal, positions 1 and 2. Clades represented by one individual (N. cf. thebaica 3, N. javanica, N. nana 1) not included

Taxon[1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18]
[1] arge 1 4.3 3.73.87.65.33.73.64.24.14.94.06.56.66.46.46.56.63.1
[2] arge 215.9 1.1 4.57.36.33.73.44.53.64.62.66.46.76.56.76.76.53.6
[3]cf. hispida/aurita 16.117.5 0.7 8.06.43.94.05.34.35.34.67.57.47.07.07.57.04.1
[4]cf. thebaica 119.319.219.5 2.6 6.27.47.78.07.16.97.96.77.27.36.87.37.06.0
[5]cf. thebaica 217.017.819.014.9 0.1 6.06.35.85.56.36.15.96.16.05.76.05.86.0
[6] grandis 16.316.317.220.318.2 1.6 3.73.94.24.94.47.17.27.27.27.07.13.6
[7] hispida/aurita 14.515.415.019.718.016.1 2.5 5.04.54.84.06.97.47.27.07.57.53.2
[8] macrotis 117.418.118.120.819.517.717.7 2.2 3.34.04.96.97.16.97.16.66.83.9
[9] macrotis 216.318.717.819.419.018.516.313.8 0.9 3.74.17.87.57.27.27.17.13.7
[10] macrotis 317.619.019.220.120.018.717.814.315.0 0.4 5.07.47.88.07.77.67.74.4
[11] nana 216.113.217.119.316.817.015.317.817.418.0 4.9 6.97.17.07.06.97.04.4
[12] thebaica 118.718.519.118.117.119.419.019.622.220.118.0 0.4 2.01.92.02.51.96.4
[13] thebaica 218.718.419.918.417.819.719.420.121.520.418.25.8 0.4 1.31.72.31.47.3
[14] thebaica 318.918.619.518.218.019.919.620.421.821.118.55.05.0 1.6 1.21.61.07.1
[15] thebaica 418.418.619.717.717.019.919.519.921.620.417.95.14.73.6 1.6 2.31.36.9
[16] thebaica 518.919.219.718.617.519.520.019.621.920.418.46.46.55.65.3 0.0 1.47.3
[17] thebaica 618.218.119.517.417.018.819.419.821.419.717.45.45.24.74.25.4 1.7 7.3
[18] tragata 14.417.717.218.618.715.816.318.217.916.317.017.018.117.917.918.317.2 1.3
Uncorrected cytb p‐distances among clades of Nycteris: on and below diagonal based on positions 1, 2, and 3; above diagonal, positions 1 and 2. Clades represented by one individual (N. cf. thebaica 3, N. javanica, N. nana 1) not included The ML phylogeny for Nycteridae based on cytb shows division of the family into four deeply diverged subclades (labeled as clades 1A, 1B, 2A, and 2B in Figure 2a). The topology of the maximum clade credibility tree is substantially similar in topology to the maximum‐likelihood tree presented here. The monophyly of all named clades was strongly supported with the exception of Nycteris thebaica clade 6. Relationships among clades were generally well supported with the exception of the position of (a) the relationships of the geographically delimited clades within N. thebaica, (b) N. cf. thebaica clade 3, and (c) the relationship of N. arge clade 1 and N. tragata + N. javanica. Two nodes had equivocal support (bootstrap (BS) ≥70%, posterior probability (PP) <0.95): the node uniting N. thebaica clades 1–6 and N. cf. thebaica clades 1 + 2 and the node uniting N. arge clade 2 and N. nana clade 1. Several clades with broad geographic sampling showed relatively high levels of within‐clade genetic variation (i.e., N. hispida/aurita, N. grandis, and N. macrotis clade 1). For those clades with limited geographic sampling, we recovered high levels of divergence among populations in N. cf. thebaica 1 and N. nana clade 2. Both ML and BI analyses strongly supported N. arge clade 1 (Central African Republic [CAR], Democratic Republic of Congo [DRC], Gabon, Uganda) + N. tragata (Malaysia) + N. javanica (Borneo) as nested well within the other African Nycteris clades. The ML and BI trees support multiple deeply divergent clades separated by >10% cytb distances. The number of deeply diverged clades that include individuals from East Africa (Kenya, Tanzania, and Uganda) is high: 10 of 16 clades in the trees include individuals from this region.
Figure 2

(a) Maximum‐likelihood phylogeny of 163 Nycteris specimens based on cytochrome b. The phylogeny was inferred in IQ‐TREE and its topology closely resembled the phylogeny calculated in MrBayes under a Bayesian framework. Filled circles on nodes denote bootstrap values (BS) ≥70% and Bayesian posterior probabilities (PP) ≥0.95, open circles outlined in black indicate BS ≥ 70% and PP < 0.95, and unmarked nodes indicate BS < 70% and PP < 0.95. Support values for most minor clades are not shown. Species names assigned on basis of preliminary field identifications or examination of museum specimens. (b–d) enlarged sections of the complete cytb tree showing individual relationships. Specimen localities include counties for densely sampled Kenya. CAR refers to Central African Republic and DRC to Democratic Republic of the Congo. Museum acronyms are defined in Appendix 1

(a) Maximum‐likelihood phylogeny of 163 Nycteris specimens based on cytochrome b. The phylogeny was inferred in IQ‐TREE and its topology closely resembled the phylogeny calculated in MrBayes under a Bayesian framework. Filled circles on nodes denote bootstrap values (BS) ≥70% and Bayesian posterior probabilities (PP) ≥0.95, open circles outlined in black indicate BS ≥ 70% and PP < 0.95, and unmarked nodes indicate BS < 70% and PP < 0.95. Support values for most minor clades are not shown. Species names assigned on basis of preliminary field identifications or examination of museum specimens. (b–d) enlarged sections of the complete cytb tree showing individual relationships. Specimen localities include counties for densely sampled Kenya. CAR refers to Central African Republic and DRC to Democratic Republic of the Congo. Museum acronyms are defined in Appendix 1 The median‐joining network of cytb haplotype diversity for the six allopatric populations within N. thebaica showed no shared alleles among clades (Figure 3). The haplotype network revealed the existence of six well‐differentiated clades (minimum separation of clades was 19 substitutions), although N. thebaica clade 4 (coastal Kenya) clusters ambiguously between N. thebaica clade 5 (Mozambique) and N. thebaica clade 2 (Tanzania and Zanzibar).
Figure 3

PopART network median‐joining analysis of cytochrome b haplotypes for 127 individuals representing Nycteris thebaica clades 1 to 6. Colored circles represent different sampled haplotypes, and black circles represent inferred missing or unsampled states. Hatch marks each denote a mutational step between haplotypes. CAR refers to Central African Republic, DRC to Democratic Republic of the Congo, and KE to Kenya

PopART network median‐joining analysis of cytochrome b haplotypes for 127 individuals representing Nycteris thebaica clades 1 to 6. Colored circles represent different sampled haplotypes, and black circles represent inferred missing or unsampled states. Hatch marks each denote a mutational step between haplotypes. CAR refers to Central African Republic, DRC to Democratic Republic of the Congo, and KE to Kenya

Concatenated nuclear gene trees

The ML gene tree inferred from the concatenated nuclear genes ACOX2, COPS7A, ROGDI, and STAT5A (70 individuals; matrix > 97% complete) is shown in Figure 4. This tree was similar to the BI tree with strong support for 22 of 25 major nodes. All of the named clades are strongly supported as monophyletic. Unlike the cytb gene trees, the position of N. arge clade 2 + N. nana clade 1 + N. nana clade 2 is ambiguous, while N. cf. thebaica clade 3 is strongly supported as part of the N. thebaica group. Nycteris tragata from SE Asia is strongly supported as nested within African Nycteris clades but is not sister to N. arge clade 1 as in the cytb gene trees. The most striking difference between the concatenated nuclear trees and the mitochondrial gene trees is the absence of support for genetic structure among the numbered lineages of N. thebaica. None of the clades named as N. thebaica 1–6 are supported as monophyletic, and relationships among individuals are poorly supported.
Figure 4

Concatenated Bayesian phylogeny of four independent nuclear introns of Nycteris. Filled circles at nodes denote ML bootstrap values (BS) ≥70% and Bayesian posterior probabilities (PP) ≥0.95, open circles outlined in black indicate BS ≥ 70% and PP < 0.95, and unmarked nodes indicate BS < 70% and PP < 0.95. Support values for most minor clades are not shown. Specimen localities include counties for Kenya. CAR refers to Central African Republic and DRC to Democratic Republic of the Congo. Museum acronyms are defined in Appendix 1

Concatenated Bayesian phylogeny of four independent nuclear introns of Nycteris. Filled circles at nodes denote ML bootstrap values (BS) ≥70% and Bayesian posterior probabilities (PP) ≥0.95, open circles outlined in black indicate BS ≥ 70% and PP < 0.95, and unmarked nodes indicate BS < 70% and PP < 0.95. Support values for most minor clades are not shown. Specimen localities include counties for Kenya. CAR refers to Central African Republic and DRC to Democratic Republic of the Congo. Museum acronyms are defined in Appendix 1

Species trees

Samples from parameter values of the four StarBEAST analyses had ESS values >200, with the exception of the five tree‐height parameters which all had values >100. We discarded the first 10% of each run, leaving 18,000 species trees in the posterior distributions that were then merged using LogCombiner. The topology of the maximum clade credibility tree (Figure 5) was identical across all four replicates. Species tree analysis using StarBEAST resulted in a topology that is strongly supported, with 12 of 13 nodes having PP ≥ 0.95. As in the concatenated nuclear gene trees, but unlike the cytb gene trees, Nycteris cf. thebaica 3 is strongly supported as sister to the other N. thebaica clades. There is strong support for the node uniting N. arge 2 + N. nana 1 + N. nana 2 with the N. thebaica clades, resolving a relationship that was poorly supported in all of the gene tree analyses. Most relationships among N. thebaica clades 1–6 are poorly supported and minimally diverged, consistent with the assignment of individuals from all six clades to N. thebaica (Supporting Information Figure S1). N. arge 1 is weakly supported as sister to the strongly supported grouping N. hispida/aurita + N. cf. hispida/aurita + N. grandis + N. tragata. Nycteris tragata, the only Asian species tested, is well supported within the African clades.
Figure 5

Species tree for Nycteris inferred using four nuclear loci in StarBEAST. Nodes are labeled with posterior probabilities

Species tree for Nycteris inferred using four nuclear loci in StarBEAST. Nodes are labeled with posterior probabilities

DISCUSSION

Multiple deeply diverged lineages

The monogeneric Nycteridae has been estimated to have diverged from Emballonuridae 51–53 Mya (Amador et al., 2018; Shi & Rabosky, 2015), and the most recent common ancestor age for the family has been placed variously at 18 mya (Shi & Rabosky, 2015) to 33.9 mya (Amador et al., 2018); Nycteridae ranks as a relatively ancient lineage among Chiroptera. Ours is the most taxonomically and geographically comprehensive phylogenetic study of Nycteridae to date. We recovered multiple instances of deep lineage divergence at both the inter‐ and intra‐clade levels. Mean pairwise uncorrected genetic distances among species‐ranked Nycteris clades for cytb were 0.17. In comparison, and in equivalent systematic surveys, overall cytb distances in Scotophilus (0.10; Demos et al., 2018) and Rhinolophus (0.10; Demos et al., 2019) were less than that of Nycteris. Overall mean genetic distances for concatenated intron datasets showed parallel variation: The mean distance of Nycteris was 0.04, Rhinolophus was 0.02, and Scotophilus was 0.01. As elaborated below, two deeply diverged multispecies clades are apparent in all of the phylogenetic analyses that we executed. One of the most striking contrasts between the cytb gene tree (Figure 2d) and both the concatenated nuclear tree and species tree (Figure 4 and Supporting Information Figure S2) is the pattern of fine‐scale geographic structure for N. thebaica apparent only in the mitochondrial tree: There is strong support for monophyly of 5 of 6 labeled N. thebaica clades. Population‐level sampling recovered well‐supported and geographically restricted clades in (1) Kenya + Rwanda, (2) Tanzania. (3) Kenya + Uganda, (4) Kenya, and (5) Mozambique (Figure 3). The most divergent of these clades, N. thebaica clade 5 from Mozambique, is >5% cytb diverged from sister N. thebaica clades (Figure 2a, d). However, little population structure is present in either the concatenated nuclear analyses (Figure 4) or in the alternate species tree analysis where individuals were assigned to “species” based on clade membership in the mitochondrial tree (Supporting Information Figure S2). Although incomplete lineage sorting may be expected to play a role in mitonuclear discordance at this phylogenetic level, we note that other haplogroups did not exhibit such discordance at similar levels of divergence (e.g., N. arge 1 with subclades in West‐Central vs. East‐Central Africa, and N. tragata + N. javanica). This raises the possibility that the pattern results from sex‐biased dispersal within the N. thebaica species group. Monadjem (2005) longitudinal study of N. thebaica survivorship in Swaziland offers robust evidence for female philopatry and male‐biased dispersal. Of 39 females he banded as adults, nearly a quarter were living in the same culverts 4.5 years later, whereas only one of the 29 banded males was recaptured. Although other Nycteris dispersal studies are lacking, his observations are compatible with the strongly contrasting mitochondrial and nuclear population structures inferred here and warrant further life‐history studies of other Nycteris species. However, analyses using microsatellites or SNPs to exclude other possible explanations for this mitonuclear discordance would be necessary to establish this.

Phylogenetic relationships

Our analyses conflict with earlier efforts to resolve the phylogenetic relationships of Nycteris. The tree of Shi and Rabosky (2015) recovered the pair N. hispida and N. thebaica as sister to all Nycteris species; the remainder were arranged as N. javanica + N. tragata as sister to N. grandis + N. arge, with N. macrotis subtending this group. In contrast, Amador et al. (2018) recovered N. macrotis as the earliest diverging lineage of Nycteris, which was sister to a pair of clades, one containing the Asian species N. tragata and N. javanica and the other containing the African species N. grandis and N. arge as sisters, joined successively by N. hispida and N. thebaica. The two studies used the same 7 Nycteris species (arge, grandis, hispida, javanica, macrotis, thebaica, and tragata), but Amador et al. (2018) partitioned cytb and the two nuclear genes included in their analysis (vWF and BRCA) by codon position, whereas Shi and Rabosky partitioned their dataset by gene. All 7 Nycteris species in the concatenated ML analysis of Shi and Rabosky had BS support ≥70%, whereas the concatenated ML tree of Amador et al. (2018) more weakly supported N. macrotis as sister to the remaining Nycteris clades at 60%. In contrast to both studies, we found strong support (PP 1.0) for two major subclades within the genus (Figures 4 and 5), each comprised of two groups of species. In the first subclade, N. thebaica and the three N. cf. thebaica clades form one group (Clade 1A), while N. arge clade 2 and the two N. nana clades comprise their sister (Clade 1B). In the second subclade, three N. macrotis clades comprise one group (Clade 2B) and N. tragata, N. grandis, N. hispida/aurita, and N. cf. hispida/aurita comprise the other (Clade 2A). Less securely placed in the latter group is N. arge 1 (PP = 0.84). Additional highly informative nuclear markers for bats (e.g., Dool et al., 2016; Demos et al., 2018) are likely responsible for improved resolution although better taxonomic and geographic sampling in this study may also contribute. To some extent, comparisons with these earlier investigations are limited by our conservative approach in withholding species assignment for specimens deemed cryptic and/or subtly differentiated from named taxa. That said, expanded taxonomic coverage alone, regardless of names assigned to terminals in the study, could be expected to result in conflicting topologies, as would possible incorrect species identifications from previous studies that relied on GenBank data. Comparing the mitochondrial (Figure 2a), concatenated nuclear (Figure 4), and species trees (Figure 5) in our analyses, the only major inconsistency concerns the position of N. arge 2 + N. nana 1 + N. nana 2. The cytb gene tree analyses strongly support this clade as sister to N. macrotis, but the high genetic distances in this dataset raise the specter of substitutional saturation. In turn, the concatenated gene tree analyses infer poor support for the clade as sister to N. thebaica, whereas the species tree analyses strongly support the clade as sister to the N. thebaica group (PP = 1.0). Examination of relationships in both the concatenated nuclear and species trees, along with their substantial branch lengths, provide strong support for two major and four subordinate clades of species within Nycteris. The subordinate groupings represent species groups, as discussed below. The major clades have not previously been recognized, and the use of subgenera for these clades may be appropriate. As discussed by Teta (2019), there are several advantages of applying the category of subgenus to well‐supported clades. The category is recognized in zoological nomenclature at a rank intermediate between genus and species and regulated by the zoological code. Its use preserves binomial usage, and thus nomenclatural stability, and by joining closely related species it can be used to generate phylogenetic predictions (e.g., Teta, Cañón, Patterson, & Pardiñas, 2017; Voss, Gutiérrez, Solari, Rossi, & Jansa, 2014). Proposals to formally name these groups of Nycteris species should include the compilation of comprehensive morphological diagnoses, which is outside the purview of this study.

Species groups of Nycteris

The four subordinate clusters in the two subclades have been recognized since Andersen's (1912) first generic synopsis. Except for the position of the Asian taxa, they roughly correspond to his four species groups as they are currently defined (e.g., Happold, 2013b). All are separated by cytb distances of at least 16%, and their clade membership is strongly supported in the species tree. First, the cluster comprising Nycteris thebaica + N. cf. thebaica 1–3 (Clade 1A) is strongly supported as monophyletic in the species tree and is >17% cytb diverged from its sister. This group is distributed in northeastern, eastern, and southern Africa and, by definition, corresponds to the N. thebaica species group, although other assigned group members N. gambiensis and N. vinsoni were not explicitly included in our analyses. Second, and sister to the N. thebaica species group, is a cluster comprising N. arge 2 + N. nana 1 and 2 (Clade 1B), which is strongly supported as monophyletic and genetically distant (>17% cytb) from all other Nycteris. Distributed across western, Central, and eastern Africa, this grouping corresponds to the arge species group, although our analyses failed to include other group members N. intermedia and N. major (unless the former is in fact represented but mislabeled as N. nana 1 or N. nana 2). Third, the cluster comprising N. hispida/aurita, N. cf. hispida/aurita, N. grandis, and N. tragata (Clade 2A) is strongly supported as monophyletic and is >16% cytb diverged from the N. macrotis lineages that comprise its sister. This group is widely distributed; its African members correspond to the N. hispida species group but there is strong support for the additional membership of N. tragata from SE Asia. Although we did not sequence N. javanica for nuclear loci, the close relationship of N. javanica to N. tragata is well established (Amador et al., 2018; Shi & Rabosky, 2015; Figure 2a). Previous morphological indications that N. javanica and N. tragata were sister to the N. thebaica, N. hispida, and N. macrotis species groups (Griffiths, 1997) were clearly homoplasious. The relationship of N. arge 1 is uncertain, although it is weakly supported as sister to clade 2A in the species tree. Fourth, a final cluster comprises N. macrotis clades 1–3 (Clade 2B) and is strongly supported as monophyletic. It is >16% cytb diverged from its sister clade and includes members from South Sudan to Malawi and Mozambique east of the Albertine Rift and Congo Basin. It corresponds to the macrotis group, although our samples did not include identified representatives of N. madagascariensis, N. parisii, and N. woodi. The fact that every newly sequenced Nycteris is associated with an identifiable museum voucher specimen means that forging linkages between genetic and morphological patterns is possible and because Nycteris taxa were all proposed on morphological grounds, this linkage enables sound nomenclature. Had the same genetic work been accomplished with biopsies from bats that were subsequently released, which is now technically possible, it would be impossible to confirm the identities and characterize the distinctive features of these lineages. As a case in point, lineages designated N. arge clades 1 and 2 (Figures 4 and 5) were each identified as N. arge in the field but clearly represent distinct lineages that likely belong to different species groups. Resolving the relationships of cryptic lineages is greatly expedited by comprehensive voucher material that preserves a broad array of biological characters, in the case of bats including skeletal and soft‐part anatomy, genitalia, vocalizations, and parasites, in addition to their genetic attributes (Gippoliti, 2018). Currently, 16 species of Nycteris are accepted as valid species, but several of these lack tissue samples in repositories or GenBank accessions and many lack vouchers with genetic material from near their type localities, hindering efforts to specify names (see Figure S1 in Supporting Information). Based on the number of well‐supported and deeply diverged lineages inferred here using multiple datasets and phylogenetic inference methods, it is likely that our analyses have uncovered several undescribed taxa. The next steps in elucidating Nycteridae relationships will be in reconciling the phylogenetic patterns described in this paper with the extensive morphological analyses developed around Nycteris types and throughout their geographic distributions by Van Cakenberghe and de Vree (1985, 1993a, 1993b, 1998). Only then will it be possible to replace the various annotations on our figures with a robust binomial nomenclature. Table S1. List of locality data for specimens used in genetic analyses of Nycteris. Figure S1. Geographic sampling of genetic data used in this study. Plotting symbols denote the locations of one or more individuals represented by mitochondrial sequence (cytb) downloaded from GenBank (+), those represented only by cytb data newly generated for this study (open circles), and those where both mitochondrial and nuclear sequences were newly generated (filled circles). Taxon, localities, and coordinates for these points are included in Supporting Information Table S1. Figure S2. Species tree inferred in StarBEAST for Nycteris for 21 clades, including Nycteris thebaica clades 1 to 6. Nodes are labeled with posterior probabilities. Click here for additional data file.
TaxonVoucher No. cytb ACOX2 COPS7A ROGDI STAT5A
Coleura afra FMNH 220403 MK837103 MK837325 MK837394 MK837464 MK837534
Nycteris arge 1FMNH 167763 MK837079 MK837329 MK837398 MK837468 MK837538
Nycteris arge 1FMNH 222429 MK837077 MK837327 MK837396 MK837466 MK837536
Nycteris arge 1FMNH 226934 MK837078 MK837328 MK837397 MK837467 MK837537
Nycteris arge 1FMNH 227433 MK837076 MK837326 MK837395 MK837465 MK837535
Nycteris arge 1FMNH 232918 MK837080
Nycteris arge 2FMNH 149405 MK837081 MK837330 MK837399 MK837469 MK837539
Nycteris arge 2FMNH 215539 MK837083
Nycteris arge 2FMNH 215540 MK837084
Nycteris arge 2FMNH 222430 MK837082
Nycteris arge 2FMNH 224102 MK837088 MK837332 MK837401 MK837471 MK837541
Nycteris arge 2FMNH 224103 MK837089
Nycteris arge 2FMNH 224104 MK837090
Nycteris arge 2NMK 184961 MK837085 MK837331 MK837400 MK837470 MK837540
Nycteris arge 2NMK 184967 MK837086
Nycteris arge 2NMK 187405 MK837087
Nycteris cf. hispida/aurita FMNH 187139 MK837094 MK837335 MK837404 MK837474 MK837544
Nycteris cf. hispida/aurita FMNH 220978 MK837091 MK837333 MK837402 MK837472 MK837542
Nycteris cf. hispida/aurita FMNH 220979 MK837092 MK837334 MK837403 MK837473 MK837543
Nycteris cf. hispida/aurita FMNH 220982 MK837093
Nycteris cf. thebaica 1FMNH 195603 MK837096 MK837337 MK837406 MK837476 MK837546
Nycteris cf. thebaica 1FMNH 195604 MK837097
Nycteris cf. thebaica 1FMNH 195605 MK837098 MK837338 MK837407 MK837477 MK837547
Nycteris cf. thebaica 1FMNH 195606 MK837099
Nycteris cf. thebaica 1FMNH 226239 MK837095 MK837336 MK837405 MK837475 MK837545
Nycteris cf. thebaica 2NMK 184231 MK837100 MK837339 MK837408 MK837478 MK837548
Nycteris cf. thebaica 2NMK 184384 MK837101 MK837340 MK837409 MK837479 MK837549
Nycteris cf. thebaica 3FMNH 158336 MK837102 MK837341 MK837410 MK837480 MK837550
Nycteris grandis FMNH 150065 MK837111
Nycteris grandis FMNH 151187 MK837112 MK837346 MK837415 MK837485 MK837555
Nycteris grandis FMNH 151188 MK837113
Nycteris grandis FMNH 151189 MK837114
Nycteris grandis FMNH 151190 MK837115
Nycteris grandis FMNH 151416 MK837116
Nycteris grandis FMNH 168092 MK837117
Nycteris grandis FMNH 192814 MK837118
Nycteris grandis FMNH 192815 MK837119
Nycteris grandis FMNH 192816 MK837120
Nycteris grandis FMNH 192882 MK837121
Nycteris grandis FMNH 192883 MK837122 MK837347 MK837416 MK837486 MK837556
Nycteris grandis FMNH 192884 MK837123
Nycteris grandis FMNH 192885 MK837124
Nycteris grandis FMNH 192936 MK837125
Nycteris grandis FMNH 213625 MK837110 MK837345 MK837414 MK837484 MK837554
Nycteris grandis FMNH 219603 MK837107 MK837343 MK837412 MK837482 MK837552
Nycteris grandis FMNH 222427 MK837108 MK837344 MK837413 MK837483 MK837553
Nycteris grandis FMNH 222428 MK837109
Nycteris grandis FMNH 227439 MK837104
Nycteris grandis FMNH 227441 MK837105 MK837342 MK837411 MK837481 MK837551
Nycteris grandis FMNH 227442 MK837106
Nycteris hispida/aurita FMNH 137625 MK837140
Nycteris hispida/aurita FMNH 137626 MK837141
Nycteris hispida/aurita FMNH 151191 MK837139 MK837352 MK837421 MK837491 MK837561
Nycteris hispida/aurita FMNH 165131 MK837142
Nycteris hispida/aurita FMNH 195607 MK837138 MK837351 MK837420 MK837490 MK837560
Nycteris hispida/aurita FMNH 215546 MK837130
Nycteris hispida/aurita FMNH 215547 MK837131
Nycteris hispida/aurita FMNH 215548 MK837132
Nycteris hispida/aurita FMNH 220746 MK837133
Nycteris hispida/aurita FMNH 220980 MK837127
Nycteris hispida/aurita FMNH 225217 MK837135
Nycteris hispida/aurita FMNH 225218 MK837136
Nycteris hispida/aurita FMNH 225240 MK837137 MK837350 MK837419 MK837489 MK837559
Nycteris hispida/aurita FMNH 225445 MK837134
Nycteris hispida/aurita FMNH 227445 MK837126 MK837348 MK837417 MK837487 MK837557
Nycteris hispida/aurita FMNH 232892 MK837143
Nycteris hispida/aurita FMNH 232893 MK837144
Nycteris hispida/aurita FMNH 232902 MK837145
Nycteris hispida/aurita FMNH 232903 MK837146 MK837353 MK837422 MK837492 MK837562
Nycteris hispida/aurita FMNH 232904 MK837317
Nycteris hispida/aurita FMNH 232905 MK837147
Nycteris hispida/aurita FMNH 232906 MK837148
Nycteris hispida/aurita FMNH 232908 MK837149
Nycteris hispida/aurita MHNG 1971.039 HQ693722
Nycteris hispida/aurita MHNG 1971.04 HQ693723
Nycteris hispida/aurita NMK 184937 MK837128
Nycteris hispida/aurita NMK 184976 MK837129 MK837349 MK837418 MK837488 MK837558
Nycteris javanica ROM 101970 EF584225
Nycteris macrotis 1FMNH 192937 MK837170
Nycteris macrotis 1FMNH 215541 MK837150 MK837354 MK837423 MK837493 MK837563
Nycteris macrotis 1FMNH 216029 MK837151
Nycteris macrotis 1FMNH 216030 MK837152 MK837355 MK837424 MK837494 MK837564
Nycteris macrotis 1FMNH 216031 MK837153
Nycteris macrotis 1FMNH 216032 MK837154
Nycteris macrotis 1FMNH 216033 MK837155
Nycteris macrotis 1FMNH 216034 MK837160
Nycteris macrotis 1FMNH 216035 MK837161 MK837356 MK837425 MK837495 MK837565
Nycteris macrotis 1FMNH 216036 MK837158
Nycteris macrotis 1FMNH 219068 MK837171
Nycteris macrotis 1FMNH 219069 MK837172 MK837359 MK837428 MK837498 MK837568
Nycteris macrotis 1FMNH 219239 MK837173
Nycteris macrotis 1FMNH 220492 MK837156
Nycteris macrotis 1FMNH 220494 MK837157
Nycteris macrotis 1FMNH 220742 MK837318
Nycteris macrotis 1FMNH 220744 MK837162
Nycteris macrotis 1FMNH 220745 MK837319
Nycteris macrotis 1FMNH 220977 MK837163 MK837357 MK837426 MK837496 MK837566
Nycteris macrotis 1FMNH 220981 MK837159
Nycteris macrotis 1FMNH 223200 MK837174
Nycteris macrotis 1FMNH 223660 MK837175
Nycteris macrotis 1FMNH 232911 MK837176
Nycteris macrotis 1FMNH 232912 MK837177 MK837360 MK837429 MK837499 MK837569
Nycteris macrotis 1FMNH 232913 MK837178
Nycteris macrotis 1FMNH 232914 MK837179
Nycteris macrotis 1FMNH 232915 MK837180
Nycteris macrotis 1FMNH 232916 MK837320
Nycteris macrotis 1FMNH 232917 MK837181 MK837361 MK837430 MK837500 MK837570
Nycteris macrotis 1FMNH HB115 MK837166 MK837358 MK837427 MK837497 MK837567
Nycteris macrotis 1FMNH HB121 MK837167
Nycteris macrotis 1FMNH HB122 MK837168
Nycteris macrotis 1FMNH HB124 MK837169
Nycteris macrotis 1FMNH HB61 MK837164
Nycteris macrotis 1FMNH HB62 MK837165
Nycteris macrotis 2FMNH 220739 MK837182
Nycteris macrotis 2FMNH 220740 MK837321 MK837362 MK837431 MK837501 MK837571
Nycteris macrotis 3FMNH 226237 MK837183 MK837363 MK837432 MK837502 MK837572
Nycteris macrotis 3FMNH 228897 MK837184 MK837364 MK837433 MK837503 MK837573
Nycteris macrotis 3FMNH 228898 MK837185 MK837365 MK837434 MK837504 MK837574
Nycteris macrotis 3FMNH 228899 MK837186
Nycteris macrotis 3FMNH 228900 MK837187
Nycteris macrotis 3FMNH 228901 MK837188
Nycteris nana 1FMNH 227448 MK837189 MK837366 MK837435 MK837505 MK837575
Nycteris nana 2FMNH 167764 MK837191 MK837368 MK837437 MK837507 MK837577
Nycteris nana 2FMNH 227446 MK837190 MK837367 MK837436 MK837506 MK837576
Nycteris thebaica 1FMNH 225210 MK837236
Nycteris thebaica 1FMNH 225241 MK837237 MK837372 MK837441 MK837511 MK837581
Nycteris thebaica 1FMNH 225242 MK837238 MK837373 MK837442 MK837512 MK837582
Nycteris thebaica 1FMNH 225243 MK837239
Nycteris thebaica 1FMNH 225244 MK837240
Nycteris thebaica 1FMNH 225245 MK837241 MK837374 MK837443 MK837513 MK837583
Nycteris thebaica 1FMNH 225406 MK837192
Nycteris thebaica 1FMNH 225407 MK837193
Nycteris thebaica 1FMNH 225408 MK837194
Nycteris thebaica 1FMNH 225409 MK837195
Nycteris thebaica 1FMNH 225410 MK837196
Nycteris thebaica 1FMNH 225411 MK837197
Nycteris thebaica 1FMNH 225412 MK837198
Nycteris thebaica 1FMNH 225413 MK837199
Nycteris thebaica 1FMNH 225420 MK837200
Nycteris thebaica 1FMNH 225421 MK837201
Nycteris thebaica 1FMNH 225423 MK837202
Nycteris thebaica 1FMNH 225424 MK837203
Nycteris thebaica 1FMNH 225425 MK837204
Nycteris thebaica 1FMNH 225426 MK837205
Nycteris thebaica 1FMNH 225442 MK837206 MK837369 MK837438 MK837508 MK837578
Nycteris thebaica 1FMNH 225443 MK837207
Nycteris thebaica 1FMNH 225444 MK837208
Nycteris thebaica 1FMNH 225446 MK837209
Nycteris thebaica 1FMNH 225447 MK837210
Nycteris thebaica 1FMNH 225448 MK837211
Nycteris thebaica 1FMNH 225449 MK837212
Nycteris thebaica 1FMNH 225450 MK837213
Nycteris thebaica 1FMNH 225451 MK837214
Nycteris thebaica 1FMNH 225452 MK837215
Nycteris thebaica 1FMNH 225453 MK837216
Nycteris thebaica 1FMNH 225454 MK837217
Nycteris thebaica 1FMNH 225455 MK837218
Nycteris thebaica 1FMNH 225456 MK837219
Nycteris thebaica 1FMNH 225457 MK837220
Nycteris thebaica 1FMNH 225458 MK837221 MK837370 MK837439 MK837509 MK837579
Nycteris thebaica 1FMNH 225459 MK837222
Nycteris thebaica 1FMNH 225460 MK837223
Nycteris thebaica 1FMNH 225461 MK837224
Nycteris thebaica 1FMNH 225462 MK837225
Nycteris thebaica 1FMNH 225463 MK837226
Nycteris thebaica 1FMNH 225464 MK837227
Nycteris thebaica 1FMNH 225465 MK837322
Nycteris thebaica 1FMNH 225466 MK837228
Nycteris thebaica 1FMNH 225467 MK837229
Nycteris thebaica 1FMNH 225468 MK837230
Nycteris thebaica 1FMNH 225469 MK837323
Nycteris thebaica 1FMNH 225470 MK837231
Nycteris thebaica 1FMNH 225471 MK837232
Nycteris thebaica 1FMNH 225472 MK837233 MK837371 MK837440 MK837510 MK837580
Nycteris thebaica 1FMNH 225473 MK837234
Nycteris thebaica 1FMNH 225474 MK837235
Nycteris thebaica 2FMNH 147220 MK837242 MK837375 MK837444 MK837514 MK837584
Nycteris thebaica 2FMNH 198085 MK837243 MK837376 MK837445 MK837515 MK837585
Nycteris thebaica 2FMNH 198086 MK837244
Nycteris thebaica 2FMNH 198087 MK837245
Nycteris thebaica 2FMNH 198088 MK837246 MK837377 MK837446 MK837516 MK837586
Nycteris thebaica 2FMNH 198089 MK837247
Nycteris thebaica 3FMNH 215536 MK837324
Nycteris thebaica 3FMNH 215537 MK837249
Nycteris thebaica 3FMNH 215538 MK837250 MK837378 MK837447 MK837517 MK837587
Nycteris thebaica 3FMNH 215542 MK837259
Nycteris thebaica 3FMNH 215543 MK837260
Nycteris thebaica 3FMNH 215544 MK837261
Nycteris thebaica 3FMNH 215545 MK837262
Nycteris thebaica 3FMNH 220741 MK837258
Nycteris thebaica 3FMNH 225400 MK837263
Nycteris thebaica 3FMNH 225401 MK837264
Nycteris thebaica 3FMNH 225402 MK837265
Nycteris thebaica 3FMNH 225403 MK837266 MK837381 MK837450 MK837520 MK837590
Nycteris thebaica 3FMNH 225404 MK837267
Nycteris thebaica 3FMNH 225405 MK837268
Nycteris thebaica 3FMNH 232109 MK837277
Nycteris thebaica 3FMNH 232429 MK837278 MK837383 MK837452 MK837522 MK837592
Nycteris thebaica 3FMNH 232430 MK837279
Nycteris thebaica 3FMNH 232431 MK837280
Nycteris thebaica 3FMNH 232919 MK837281
Nycteris thebaica 3NMK 184407 MK837253 MK837379 MK837448 MK837518 MK837588
Nycteris thebaica 3NMK 184520 MK837254 MK837380 MK837449 MK837519 MK837589
Nycteris thebaica 3NMK 184521 MK837255
Nycteris thebaica 3NMK 184522 MK837256
Nycteris thebaica 3NMK 184636 MK837257
Nycteris thebaica 3NMK 184658 MK837248
Nycteris thebaica 3NMK 184759 MK837269
Nycteris thebaica 3NMK 184854 MK837270
Nycteris thebaica 3NMK 184855 MK837271
Nycteris thebaica 3NMK 185133 MK837252
Nycteris thebaica 3NMK 187337 MK837272 MK837382 MK837451 MK837521 MK837591
Nycteris thebaica 3NMK 187338 MK837273
Nycteris thebaica 3NMK 187339 MK837274
Nycteris thebaica 3NMK 187340 MK837275
Nycteris thebaica 3NMK 187341 MK837276
Nycteris thebaica 3NMK 187450 MK837251
Nycteris thebaica 4FMNH 216037 MK837282 MK837386 MK837455 MK837525 MK837595
Nycteris thebaica 4FMNH 216039 MK837283 MK837456 MK837526 MK837596
Nycteris thebaica 4FMNH 216040 MK837284
Nycteris thebaica 4FMNH 216042 MK837285
Nycteris thebaica 4FMNH 216043 MK837286
Nycteris thebaica 4FMNH 220446 MK837288
Nycteris thebaica 4FMNH 220447 MK837287
Nycteris thebaica 4FMNH 220448 MK837289
Nycteris thebaica 4FMNH 220449 MK837290
Nycteris thebaica 4FMNH 220450 MK837291
Nycteris thebaica 4FMNH 220451 MK837292
Nycteris thebaica 4FMNH 220452 MK837293
Nycteris thebaica 4FMNH 220453 MK837294 MK837384 MK837453 MK837523 MK837593
Nycteris thebaica 4FMNH 220455 MK837295
Nycteris thebaica 4FMNH 220484 MK837296 MK837385 MK837454 MK837524 MK837594
Nycteris thebaica 4FMNH 220485 MK837297
Nycteris thebaica 4FMNH 220486 MK837298
Nycteris thebaica 4FMNH 220487 MK837299
Nycteris thebaica 4FMNH 220488 MK837300
Nycteris thebaica 5FMNH 213626 MK837301 MK837387 MK837457 MK837527 MK837597
Nycteris thebaica 5FMNH 213627 MK837302 MK837388 MK837458 MK837528 MK837598
Nycteris thebaica 5FMNH 213628 MK837303 MK837389 MK837459 MK837529 MK837599
Nycteris thebaica 5FMNH 213629 MK837304
Nycteris thebaica 5FMNH 213630 MK837305
Nycteris thebaica 5FMNH 213631 MK837306
Nycteris thebaica 5FMNH 213632 MK837307
Nycteris thebaica 6FMNH 187360 MK837310
Nycteris thebaica 6FMNH 187361 MK837311 MK837391 MK837461 MK837531 MK837601
Nycteris thebaica 6FMNH 187412 MK837312
Nycteris thebaica 6FMNH 193210 MK837313
Nycteris thebaica 6FMNH 219066 MK837314
Nycteris thebaica 6FMNH 219067 MK837315 MK837392 MK837462 MK837532 MK837602
Nycteris thebaica 6FMNH 226238 MK837308 MK837390 MK837460 MK837530 MK837600
Nycteris thebaica 6FMNH 226240 MK837309
Nycteris tragata LSUMZ 4413 MK837316 MK837393 MK837463 MK837533 MK837603
Nycteris tragata TTU 108180 EU21624
  17 in total

1.  A new statistical method for haplotype reconstruction from population data.

Authors:  M Stephens; N J Smith; P Donnelly
Journal:  Am J Hum Genet       Date:  2001-03-09       Impact factor: 11.025

2.  A nuclear DNA phylogenetic perspective on the evolution of echolocation and historical biogeography of extant bats (chiroptera).

Authors:  Geeta N Eick; David S Jacobs; Conrad A Matthee
Journal:  Mol Biol Evol       Date:  2005-06-01       Impact factor: 16.240

3.  seqphase: a web tool for interconverting phase input/output files and fasta sequence alignments.

Authors:  J-F Flot
Journal:  Mol Ecol Resour       Date:  2009-06-15       Impact factor: 7.090

4.  Speciation dynamics during the global radiation of extant bats.

Authors:  Jeff J Shi; Daniel L Rabosky
Journal:  Evolution       Date:  2015-06-09       Impact factor: 3.694

5.  2016 Guidelines of the American Society of Mammalogists for the use of wild mammals in research and education.

Authors:  Robert S Sikes
Journal:  J Mammal       Date:  2016-05-28       Impact factor: 2.416

6.  Nuclear gene phylogeography using PHASE: dealing with unresolved genotypes, lost alleles, and systematic bias in parameter estimation.

Authors:  Ryan C Garrick; Paul Sunnucks; Rodney J Dyer
Journal:  BMC Evol Biol       Date:  2010-04-30       Impact factor: 3.260

7.  Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7.

Authors:  Andrew Rambaut; Alexei J Drummond; Dong Xie; Guy Baele; Marc A Suchard
Journal:  Syst Biol       Date:  2018-09-01       Impact factor: 15.683

8.  IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies.

Authors:  Lam-Tung Nguyen; Heiko A Schmidt; Arndt von Haeseler; Bui Quang Minh
Journal:  Mol Biol Evol       Date:  2014-11-03       Impact factor: 16.240

9.  On the taxonomic status and distribution of African species of Otomops (Chiroptera: Molossidae).

Authors:  Bruce D Patterson; Paul W Webala; Michael Bartonjo; Julius Nziza; Carl W Dick; Terrence C Demos
Journal:  PeerJ       Date:  2018-05-24       Impact factor: 2.984

10.  Molecular phylogenetics of the African horseshoe bats (Chiroptera: Rhinolophidae): expanded geographic and taxonomic sampling of the Afrotropics.

Authors:  Terrence C Demos; Paul W Webala; Steven M Goodman; Julian C Kerbis Peterhans; Michael Bartonjo; Bruce D Patterson
Journal:  BMC Evol Biol       Date:  2019-08-22       Impact factor: 3.260

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.