Literature DB >> 31891351

Activity-dependent death of transient Cajal-Retzius neurons is required for functional cortical wiring.

Martina Riva1,2,3, Ioana Genescu4, Chloé Habermacher3,5, Sonia Garel4, Maria Cecilia Angulo3,5, Alessandra Pierani1,2,3, David Orduz5, Fanny Ledonne2, Filippo M Rijli6, Guillermina López-Bendito7, Eva Coppola1,2,3.   

Abstract

Programmed cell death and early activity contribute to the emergence of functional cortical circuits. While most neuronal populations are scaled-down by death, some subpopulations are entirely eliminated, raising the question of the importance of such demise for cortical wiring. Here, we addressed this issue by focusing on Cajal-Retzius neurons (CRs), key players in cortical development that are eliminated in postnatal mice in part via Bax-dependent apoptosis. Using Bax-conditional mutants and CR hyperpolarization, we show that the survival of electrically active subsets of CRs triggers an increase in both dendrite complexity and spine density of upper layer pyramidal neurons, leading to an excitation/inhibition imbalance. The survival of these CRs is induced by hyperpolarization, highlighting an interplay between early activity and neuronal elimination. Taken together, our study reveals a novel activity-dependent programmed cell death process required for the removal of transient immature neurons and the proper wiring of functional cortical circuits.
© 2019, Riva et al.

Entities:  

Keywords:  Cajal-Retzius neurons; apoptosis; cortical development; developmental biology; excitation/inhibition ratio; mouse; neuronal activity; neuroscience; transient

Mesh:

Substances:

Year:  2019        PMID: 31891351      PMCID: PMC6938399          DOI: 10.7554/eLife.50503

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

An emerging player in the assembly of neuronal networks is programmed cell death (PCD). In the nervous system, programmed cell death (PCD) fine-tunes the density of neuronal populations by eliminating 20–40% of overproduced neurons (Fuchs and Steller, 2011; Causeret et al., 2018; Wong and Marín, 2019). Only few populations of the mouse cerebral cortex almost completely disappear during the first two postnatal weeks. Amongst these, Cajal-Retzius cells (CRs), the first-born cortical neurons lying in the superficial Layer I (LI), undergo extensive cell death in the mouse during the second postnatal week (Ledonne et al., 2016). The persistence of CRs during postnatal life is increased in malformations of cortical development (MCDs) and epilepsies thereby opening the intriguing possibility that the maintenance of CRs contributes to the dysfunction of cortical circuits (for review see Luhmann, 2013). CR play pivotal roles at multiple steps of early cortical development, in addition to their best-known role in the control of radial migration (Ishii et al., 2016). They comprise three molecularly distinct subtypes which migrate from different sources that surround the cortical primordium: (i) septum and eminentia thalami-derived CRs of the ΔNp73/Dbx1 lineage (SE-CRs); (ii) hem-derived CRs of the ΔNp73/Wnt3a lineage (hem-CRs); (iii) pallial-subpallial boundary-derived CRs of the Dbx1 lineage (PSB-CRs) (Bielle et al., 2005; Yoshida et al., 2006; Tissir et al., 2009). Our previous work revealed that their specific embryonic distribution in distinct territories plays key functions in wiring of cortical circuits by controlling the size of functional areas, both primary and higher-order, as well as targeting of thalamocortical afferents (Griveau et al., 2010; Barber et al., 2015; Barber and Pierani, 2016). More recently, we showed that subtype-specific differences also exist in their elimination during early postnatal life, with SE- but not hem-derived CRs dying in a Bax-dependent manner, which is a critical player of the apoptotic pathway (Ledonne et al., 2016). Before their disappearance, CRs express ionotropic glutamatergic and GABAergic receptors and are embedded into immature circuits where they mainly receive GABAergic synaptic inputs, suggesting that these transient cells might have an activity-dependent role in the development of cortical networks (Kirischuk et al., 2014). Consistently, we found that CRs density shapes axonal and dendritic outgrowth in LI and impacts onto the excitation/inhibition (E/I) ratio in upper cortical layers (de Frutos et al., 2016). Conversely, activity was also proposed as one of the drive of CR demise. Studies from Del Río et al. (1996) first highlighted the role played by electrical activity on CR death in vitro. CRs were shown to display electrophysiological features of immature neurons (Kirischuk et al., 2014; Barber and Pierani, 2016), including the persistent depolarizing action of GABA which was suggested to depend on the maintenance of the chloride inward transporter NKCC1 and the absence of the outward transporter KCC2 (Mienville, 1998; Achilles et al., 2007; Pozas et al., 2008). Interestingly, pharmacological inhibition of activity and GABA signaling in vitro and global inactivation of NKCC1 in vivo were shown to reduce the death of CRs (Blanquie et al., 2017a; Blanquie et al., 2017b). However, very little is known on the role of electrical activity in CR subtype-specific death in vivo, as well as its contribution to the construction of functional and dysfunctional cortical circuits. Here we show that hyperpolarization of CR neurons by Kir2.1-dependent expression prevented cell death of ΔNp73- but not Wnt3a-derived CRs, corresponding to SE-CRs. By comparing two different mutants in which CR death was similarly rescued, we found that abnormal SE-CR survival promotes exuberance of dendrites and spine density in pyramidal neurons in an activity-dependent manner. This results in an E/I imbalance due to an increase in the excitatory drive of upper cortical neurons. Our findings show that neuronal activity is involved in CR subtype-specific death and argue in favor of an unappreciated role of the disappearance of these transient neurons in controlling the morphology of pyramidal neurons and the functional properties of their cortical excitatory networks at postnatal stages.

Results

Subsets of CRs die in an activity-dependent manner

The ΔNp73cre/+ mouse line targets approximately 80% of CRs, namely hem-CRs (Wnt3a lineage) and SE-CRs (Tissir et al., 2009; Griveau et al., 2010; Yoshida et al., 2006). ΔNp73-CRs, but not Wnt3a-derived hem-CRs, were shown to be eliminated postnatally via Bax-dependent death, indicating that SE-CRs undergo apoptosis. However, the trigger of such apoptosis or the mechanisms regulating the death of other CR populations are still unknown (Ledonne et al., 2016). To decipher whether activity might regulate the death of specific subsets of CRs in vivo, we first overexpressed the hyperpolarizing channel Kir2.1 (R26Kir2.1mcherry/+) (Moreno-Juan et al., 2017) using the ΔNp73cre/+ line. Tracing of CRs at several postnatal stages in control and Kir2.1-expressing mice was performed using DsRed immunostainings to visualize tdTomato and mcherry reporters, respectively. We found that the density of CRs in the somatosensory barrel cortex was unchanged in these animals at postnatal day 7 (P7), that is before CRs undergo massive cell death (Figure 1A and B). In contrast, Kir2.1 channel overexpression in ΔNp73-CRs resulted in an increase of CRs with respect to controls in the somatosensory cortex at P15 and P25 (Figure 1A and B). Importantly, using whole-cell recording, we checked that rescued CRs were, as expected, hyperpolarized and displayed a decrease in the input resistance without exhibiting changes in action potential properties at both P15 and P25 (Figure 1—figure supplement 1A-C). Biocytin-filling and immunostaining further revealed that most morphological properties were preserved in Kir2.1-expressing CRs, apart from a reduced soma at P25 (Figure 1—figure supplement 1D). In particular, rescued CRs displayed similar branching length in LI (Figure 1—figure supplement 1B and E) and co-expressed Reelin (Reln) from P7 to P25 (Figure 1—figure supplement 1F and G). Taken together, these experiments show that hyperpolarization of ΔNp73-CRs does not drastically alter cardinal morphological features of CRs but prevents their complete elimination.
Figure 1.

Hyperpolarization induces the survival of SE-CRs.

(A) Confocal images of cortical sections from P7, P15 and P25 ΔNp73cre/+;R26mT/+ controls (left) and ΔNp73cre/+;R26Kir2.1/+ mutants (right) stained for DsRed (red) and Hoechst (blue). Arrowheads indicate DsRed+ CRs at P15 and P25. (B) Quantification of CR density (CRs/mm3) at the pial surface in the somatosensory (S1) cortex (P7: n = 6 for controls and n = 4 for mutants, p=0.716; P15: n = 4 for controls and n = 10 for mutants, p=0.001; P25: n = 3 for controls and n = 8 for mutants, p=0.006). (C) Confocal images of cortical sections from P7, P15 and P25 Wnt3acre/+;R26mT/+ controls (left) and Wnt3acre/+;R26Kir2.1/+ mutants (right) stained for DsRed (red) and Hoechst (blue). Arrowheads indicate DsRed+ CRs at P15 and P25. For simplicity, arrowheads were not displayed at P7, as there are too many CRs at this stage. (D) Quantification of CR density (CRs/mm3) at the pial surface in the somatosensory (S1) cortex (P7: n = 5 for controls and n = 6 for mutants, p=0.2251; P15: n = 4 for controls and n = 3 for mutants, p=0.771; P25: n = 3 for controls and n = 3 for mutants, p=0.813). Mann-Whitney U Test. Scale bar represents 200 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 1—figure supplement 1—source data 1.

(A) Schematic representation of the electrophysiological recordings from ΔNp73cre/+ CRs. (B) Biocytin-filled CRs in ΔNp73cre/+;R26mT/+ at P17 and ΔNp73cre/+;R26Kir2.1/+ at P15 and P28 displayed a similar characteristic morphology of CRs. (C) Electrophysiological properties of control and rescued CRs expressing Kir2.1. Note that rescued CRs expressing Kir2.1 are hyperpolarized (resting potential, Vrest) at both P15-P17 (n = 16 for controls and n = 17 for mutants, p=0.0001) and P25-29 (n = 11 for mutants, p=0.002; Kruskal-Wallis test followed by a Bonferroni multiple comparison). Moreover, Kir2.1 expression modifies input resistance (Rin), without showing modifications of the amplitudes and durations of the first and second spikes or the afterhyperpolarization (AHP) (n = 12 for controls and n = 15 for mutants at P15-P17 and n = 7–8 for mutants at P25-P29; p<0.0001 for both ages; ANOVA test followed by a Bonferroni multiple comparison). (D) Quantifications of soma diameter of rescued ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 8 for mutants at P15-P17, p=0.075; n = 9 for mutants at P25-P29, p=0.004, compared to P13-P17 controls; one-way ANOVA test followed by a Bonferroni multiple comparison). (E) Quantifications of filament length of ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 7 for mutants at P15-P17, p=0.636; n = 8 for mutants at P25-P29, p=0.964, compared to P13-P17 controls). (F) Merged and single channel confocal images of P7 and P25 mutant and control brains stained for DsRed (red), Reelin (Reln, green) and Hoechst (blue), showing that DsRed positive cells express Reln. Scale bars represent 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 1—figure supplement 1—source data 1.

Figure 1—figure supplement 1.

Electrophysiological properties and morphology of rescued CRs in ΔNp73cre/+; R26Kir2.1/+ mice.

(A) Schematic representation of the electrophysiological recordings from ΔNp73cre/+ CRs. (B) Biocytin-filled CRs in ΔNp73cre/+;R26mT/+ at P17 and ΔNp73cre/+;R26Kir2.1/+ at P15 and P28 displayed a similar characteristic morphology of CRs. (C) Electrophysiological properties of control and rescued CRs expressing Kir2.1. Note that rescued CRs expressing Kir2.1 are hyperpolarized (resting potential, Vrest) at both P15-P17 (n = 16 for controls and n = 17 for mutants, p=0.0001) and P25-29 (n = 11 for mutants, p=0.002; Kruskal-Wallis test followed by a Bonferroni multiple comparison). Moreover, Kir2.1 expression modifies input resistance (Rin), without showing modifications of the amplitudes and durations of the first and second spikes or the afterhyperpolarization (AHP) (n = 12 for controls and n = 15 for mutants at P15-P17 and n = 7–8 for mutants at P25-P29; p<0.0001 for both ages; ANOVA test followed by a Bonferroni multiple comparison). (D) Quantifications of soma diameter of rescued ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 8 for mutants at P15-P17, p=0.075; n = 9 for mutants at P25-P29, p=0.004, compared to P13-P17 controls; one-way ANOVA test followed by a Bonferroni multiple comparison). (E) Quantifications of filament length of ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 7 for mutants at P15-P17, p=0.636; n = 8 for mutants at P25-P29, p=0.964, compared to P13-P17 controls). (F) Merged and single channel confocal images of P7 and P25 mutant and control brains stained for DsRed (red), Reelin (Reln, green) and Hoechst (blue), showing that DsRed positive cells express Reln. Scale bars represent 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 1—figure supplement 1—source data 1.

Hyperpolarization induces the survival of SE-CRs.

(A) Confocal images of cortical sections from P7, P15 and P25 ΔNp73cre/+;R26mT/+ controls (left) and ΔNp73cre/+;R26Kir2.1/+ mutants (right) stained for DsRed (red) and Hoechst (blue). Arrowheads indicate DsRed+ CRs at P15 and P25. (B) Quantification of CR density (CRs/mm3) at the pial surface in the somatosensory (S1) cortex (P7: n = 6 for controls and n = 4 for mutants, p=0.716; P15: n = 4 for controls and n = 10 for mutants, p=0.001; P25: n = 3 for controls and n = 8 for mutants, p=0.006). (C) Confocal images of cortical sections from P7, P15 and P25 Wnt3acre/+;R26mT/+ controls (left) and Wnt3acre/+;R26Kir2.1/+ mutants (right) stained for DsRed (red) and Hoechst (blue). Arrowheads indicate DsRed+ CRs at P15 and P25. For simplicity, arrowheads were not displayed at P7, as there are too many CRs at this stage. (D) Quantification of CR density (CRs/mm3) at the pial surface in the somatosensory (S1) cortex (P7: n = 5 for controls and n = 6 for mutants, p=0.2251; P15: n = 4 for controls and n = 3 for mutants, p=0.771; P25: n = 3 for controls and n = 3 for mutants, p=0.813). Mann-Whitney U Test. Scale bar represents 200 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 1—figure supplement 1—source data 1.

Electrophysiological properties and morphology of rescued CRs in ΔNp73cre/+; R26Kir2.1/+ mice.

(A) Schematic representation of the electrophysiological recordings from ΔNp73cre/+ CRs. (B) Biocytin-filled CRs in ΔNp73cre/+;R26mT/+ at P17 and ΔNp73cre/+;R26Kir2.1/+ at P15 and P28 displayed a similar characteristic morphology of CRs. (C) Electrophysiological properties of control and rescued CRs expressing Kir2.1. Note that rescued CRs expressing Kir2.1 are hyperpolarized (resting potential, Vrest) at both P15-P17 (n = 16 for controls and n = 17 for mutants, p=0.0001) and P25-29 (n = 11 for mutants, p=0.002; Kruskal-Wallis test followed by a Bonferroni multiple comparison). Moreover, Kir2.1 expression modifies input resistance (Rin), without showing modifications of the amplitudes and durations of the first and second spikes or the afterhyperpolarization (AHP) (n = 12 for controls and n = 15 for mutants at P15-P17 and n = 7–8 for mutants at P25-P29; p<0.0001 for both ages; ANOVA test followed by a Bonferroni multiple comparison). (D) Quantifications of soma diameter of rescued ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 8 for mutants at P15-P17, p=0.075; n = 9 for mutants at P25-P29, p=0.004, compared to P13-P17 controls; one-way ANOVA test followed by a Bonferroni multiple comparison). (E) Quantifications of filament length of ΔNp73cre/+;R26Kir2.1/+ CRs at P15-P17 and P25-P29 compared to control ΔNp73cre/+;R26mT/+ CRs at P13-P17 (n = 8 for controls and n = 7 for mutants at P15-P17, p=0.636; n = 8 for mutants at P25-P29, p=0.964, compared to P13-P17 controls). (F) Merged and single channel confocal images of P7 and P25 mutant and control brains stained for DsRed (red), Reelin (Reln, green) and Hoechst (blue), showing that DsRed positive cells express Reln. Scale bars represent 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 1—figure supplement 1—source data 1. A similar proportion of CRs were rescued either by hyperpolarization (Figure 1A and B) or by preventing apoptosis (Ledonne et al., 2016), raising the intriguing possibility that the same subpopulation of CRs, SE-CRs, might be preserved in both conditions. Since hem-CRs are not eliminated via a Bax-dependent process (Ledonne et al., 2016), we investigated whether their survival is sensitive to hyperpolarization. We thus overexpressed Kir2.1 specifically in hem-CRs using the Wnt3acre/+, which corresponds to about 70% of the ΔNp73-CRs at early postnatal stages (Figure 1C and D). We found that hem-CR death was unaffected in this mouse line (Figure 1C and D). Moreover, taking into account cortical growth, the proportions of rescued cells in the somatosensory cortex at P25 was evaluated to approximately 30% of the initial pool of ΔNp73-CRs, which corresponds to the expected number of SE-CRs (Bielle et al., 2005; Yoshida et al., 2006; Tissir et al., 2009). Collectively, these results show that the death of a specific subset of ΔNp73cre/+ SE-CRs is both Bax-dependent and activity-dependent.

CRs rescued by hyperpolarization or blocking Bax-dependent apoptosis are integrated in neuronal circuits

It has been established that CRs are integrated in functional circuits early in the developing postnatal neocortex (Kilb and Luhmann, 2001; Soda et al., 2003; Sava et al., 2010; Cocas et al., 2016). CRs receive GABAergic synaptic inputs and, despite the expression of NMDA receptors (NMDARs) on CR membranes, the presence of NMDAR-mediated synaptic responses is still under debate (Kilb and Luhmann, 2001; Soda et al., 2003; Sava et al., 2010; Schwartz et al., 1998; Mienville and Pesold, 1999; Radnikow et al., 2002; Anstötz et al., 2014). To test whether CRs harbored functional GABAergic and/or glutamatergic synapses during the cell death period and after their rescue, we recorded spontaneous (sPSCs) and evoked postsynaptic currents (ePSCs) of fluorescent CRs with a KCl-based intracellular solution. First, at P9-11 in control ΔNp73cre/+;R26mt/+ mice, sPSCs sensitive to the GABAA receptor (GABAAR) antagonist SR95531 (10 µM) were observed in CRs held at −60 mV, confirming that CRs are innervated mainly by functional GABAergic synaptic inputs (Figure 2—figure supplement 1A–B; data not shown for SR95531 application; n = 7). Low-frequency stimulations in LI easily elicited ePSCs that were also completely blocked by SR95531 application (Figure 2—figure supplement 1C–D), even in 0 mM Mg2+ condition, which relieves the Mg2+ block of NMDA receptors. Taken together, these results indicate that ePSCs were mediated by GABAARs and not by AMPA or NMDA receptors. In agreement with previous studies (Sun et al., 2019), the presence of GABAergic synaptic inputs on CRs was confirmed by immunostainings against the presynaptic marker GAD65/67 and the postsynaptic marker Gephyrin (Figure 2—figure supplement 1E). Since the depolarizing action of GABA in CRs was proposed to be partly due to the lack of expression of KCC2, the chloride transporter responsible for maintaining a low intracellular chloride concentration (Mienville, 1998; Achilles et al., 2007; Pozas et al., 2008; Blanquie et al., 2017a; Blanquie et al., 2017b), we also checked for the protein expression of this transporter. In agreement with previous reports (Achilles et al., 2007; Pozas et al., 2008), control GFP+ CRs in ΔNp73cre/+;TauGFP/+ mice expressed very low to undetectable levels of KCC2 (Figure 2—figure supplement 1F). Thus, during the timeperiod of their activity-dependent death, CR cells receive solely GABAergic synaptic inputs.
Figure 2—figure supplement 1.

Pure GABAergic sPSCs and ePSCs in control CRs during early postnatal development.

(A) Spontaneous PSCs (sPSCs) recorded in a control CR from ΔNp73cre/+;R26mt/+ at P10. (B) Plots of the frequency and amplitude of sPSCs (n = 8) (p=0.0025 and p=0.0022 for the frequency of sPSCs of controls compared to rescued CRs of both ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+ mice (Figure 2A); one-way ANOVA followed by a Bonferroni post hoc test). (C) Mean evoked PSCs (ePSCs) for a control CR at P9-11 upon stimulation of LI neuronal fibers in control conditions (top), with SR95531 (middle) and SR95531 in Mg2+-free solution (bottom). Note that ePSCs completely disappeared after bath application of SR95531. Stimulation artefacts were blanked for visibility. The stimulation time is indicated (arrowheads). (D) Amplitudes of ePSCs in control conditions (p=0.0027 and p=0.0067 for the amplitude of ePSCs in controls compared to rescued CRs of ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+mice, (Figure 2D); one-way ANOVA followed by a Bonferroni post hoc test), in the presence of SR95531 and with SR95531 in Mg2+-free solution (ncontrol = 8, nSR95531 = 7 and nSR95531/Mg2+free=7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (E) Confocal images of a control CR at P10 in ΔNp73cre/+;TauGFP/+ mice expressing GFP (green), Gephyrin (red) and contacted by GABAergic GAD65/67-positive presynaptic terminals (blue; objective 93×; stack of 109 Z sections, each 0.07 µm, n = 11). Arrowheads show GABAergic synapses onto the CR. Note the partial co-localization of GAD65/67 and Gephyrin on the GFP+ membrane of the CR (Inset). Scale bars: 5 µm and 1 µm (inset). (F) Confocal images of a Layer I CR in the cortex and non-CR in the hypothalamus at P10 stained for DAPI (blue), KCC2 (red) and GFP (green) in ΔNp73cre/+; TauGFP/+ mice (objective 93×; single plane of 0.07 µm, n = 6). Note the low level of KCC2 expression in control CR (upper panels) compared to non-CR of ΔNp73cre/+;TauGFP/+ mice (bottom panels). Scale bar represents 5 µm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 2—figure supplement 1—source data 1.

We further explored whether these inputs are maintained at later stages, when CR cells are not eliminated. To this aim, we performed the same experiments at P23-28 in ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+ mice (Figure 2A–B). First, we found that sPSCs in rescued CRs had similar frequencies, amplitudes and kinetics in both models (Figure 2A–B). Moreover, sPSCs were completely abolished by GABAAR antagonist SR95531, indicating that rescued CRs remained innervated by functional GABAergic synaptic inputs (data not shown for SR95531 application, n = 8 and n = 5 for ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+ mice, respectively). Consistently, the complete block of ePSCs by SR95531, even in 0 mM Mg2+, revealed that ePSCs were exclusively mediated by GABAARs at hyperpolarized holding potentials, as observed in younger mice (Figure 2C–D and Figure 2—figure supplement 1C–D). While these GABAergic inputs were preserved in rescued CRs, we observed a reduced sPSC frequency and ePSC amplitude compared to P9-P11 mice, suggesting a decreased CR connectivity in the more mature neocortex (Figure 2A–B and Figure 2—figure supplement 1A–B).
Figure 2.

Pure GABAergic sPSCs and ePSCs in rescued CRs.

(A) Spontaneous PSCs (sPSCs) recorded in rescued CRs from ΔNp73cre/+;R26Kir2.1/+ at P27 (blue) and ΔNp73cre/+;Baxlox/lox mutants at P26 (green), respectively. (B) Plots of the frequency and amplitude of sPSCs (n = 11 for ΔNp73cre/+; R26Kir2.1/+ and n = 11 for ΔNp73cre/+; Baxlox/lox mice at P24-29; frequency: p=0.552, amplitude: p=0.580, Student T Test). Rise time is 2.10 ± 0.42 ms vs 1.02 ± 0.20 ms and decay time 34.26 ± 6.39 ms vs 29.14 ± 3.56 ms for ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox mice, respectively. (C) Mean evoked PSCs (ePSCs) for rescued CRs respectively from a ΔNp73cre/+;R26Kir2.1/+ mutant at P29 (blue) and a ΔNp73cre/+;Baxlox/lox mutant at P26 (green) upon stimulation of LI neuronal fibers (stimulation time, arrowhead) in control conditions (top), with SR95531 (middle) and SR95531 in Mg2+-free solution (bottom). Note that ePSCs completely disappeared after bath application of SR95531. (D) Amplitudes of ePSCs in control conditions, with SR95531 and with SR95531 in Mg2+-free solution (ΔNp73cre/+;R26Kir2.1/+ mice at P24-29: ncontrol = 10, nSR95531 = 8 and nSR95531/Mg2+free=8; ΔNp73cre/+;Baxlox/lox: ncontrol = 8, nSR95531 = 5 and nSR95531/Mg2+free=5; Kruskal-Wallis test followed by a Bonferroni multiple comparison when comparing the three conditions for each mutant; Student T test for comparison of control ePSCs between ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox mutants, p=0.638). To detect CRs in ΔNp73cre/+;Baxlox/lox mutants the R26mT/+ reporter line was used. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 2—figure supplement 1—source data 1.

(A) Spontaneous PSCs (sPSCs) recorded in a control CR from ΔNp73cre/+;R26mt/+ at P10. (B) Plots of the frequency and amplitude of sPSCs (n = 8) (p=0.0025 and p=0.0022 for the frequency of sPSCs of controls compared to rescued CRs of both ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+ mice (Figure 2A); one-way ANOVA followed by a Bonferroni post hoc test). (C) Mean evoked PSCs (ePSCs) for a control CR at P9-11 upon stimulation of LI neuronal fibers in control conditions (top), with SR95531 (middle) and SR95531 in Mg2+-free solution (bottom). Note that ePSCs completely disappeared after bath application of SR95531. Stimulation artefacts were blanked for visibility. The stimulation time is indicated (arrowheads). (D) Amplitudes of ePSCs in control conditions (p=0.0027 and p=0.0067 for the amplitude of ePSCs in controls compared to rescued CRs of ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+mice, (Figure 2D); one-way ANOVA followed by a Bonferroni post hoc test), in the presence of SR95531 and with SR95531 in Mg2+-free solution (ncontrol = 8, nSR95531 = 7 and nSR95531/Mg2+free=7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (E) Confocal images of a control CR at P10 in ΔNp73cre/+;TauGFP/+ mice expressing GFP (green), Gephyrin (red) and contacted by GABAergic GAD65/67-positive presynaptic terminals (blue; objective 93×; stack of 109 Z sections, each 0.07 µm, n = 11). Arrowheads show GABAergic synapses onto the CR. Note the partial co-localization of GAD65/67 and Gephyrin on the GFP+ membrane of the CR (Inset). Scale bars: 5 µm and 1 µm (inset). (F) Confocal images of a Layer I CR in the cortex and non-CR in the hypothalamus at P10 stained for DAPI (blue), KCC2 (red) and GFP (green) in ΔNp73cre/+; TauGFP/+ mice (objective 93×; single plane of 0.07 µm, n = 6). Note the low level of KCC2 expression in control CR (upper panels) compared to non-CR of ΔNp73cre/+;TauGFP/+ mice (bottom panels). Scale bar represents 5 µm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 2—figure supplement 1—source data 1.

Pure GABAergic sPSCs and ePSCs in rescued CRs.

(A) Spontaneous PSCs (sPSCs) recorded in rescued CRs from ΔNp73cre/+;R26Kir2.1/+ at P27 (blue) and ΔNp73cre/+;Baxlox/lox mutants at P26 (green), respectively. (B) Plots of the frequency and amplitude of sPSCs (n = 11 for ΔNp73cre/+; R26Kir2.1/+ and n = 11 for ΔNp73cre/+; Baxlox/lox mice at P24-29; frequency: p=0.552, amplitude: p=0.580, Student T Test). Rise time is 2.10 ± 0.42 ms vs 1.02 ± 0.20 ms and decay time 34.26 ± 6.39 ms vs 29.14 ± 3.56 ms for ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox mice, respectively. (C) Mean evoked PSCs (ePSCs) for rescued CRs respectively from a ΔNp73cre/+;R26Kir2.1/+ mutant at P29 (blue) and a ΔNp73cre/+;Baxlox/lox mutant at P26 (green) upon stimulation of LI neuronal fibers (stimulation time, arrowhead) in control conditions (top), with SR95531 (middle) and SR95531 in Mg2+-free solution (bottom). Note that ePSCs completely disappeared after bath application of SR95531. (D) Amplitudes of ePSCs in control conditions, with SR95531 and with SR95531 in Mg2+-free solution (ΔNp73cre/+;R26Kir2.1/+ mice at P24-29: ncontrol = 10, nSR95531 = 8 and nSR95531/Mg2+free=8; ΔNp73cre/+;Baxlox/lox: ncontrol = 8, nSR95531 = 5 and nSR95531/Mg2+free=5; Kruskal-Wallis test followed by a Bonferroni multiple comparison when comparing the three conditions for each mutant; Student T test for comparison of control ePSCs between ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox mutants, p=0.638). To detect CRs in ΔNp73cre/+;Baxlox/lox mutants the R26mT/+ reporter line was used. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 2—figure supplement 1—source data 1.

Pure GABAergic sPSCs and ePSCs in control CRs during early postnatal development.

(A) Spontaneous PSCs (sPSCs) recorded in a control CR from ΔNp73cre/+;R26mt/+ at P10. (B) Plots of the frequency and amplitude of sPSCs (n = 8) (p=0.0025 and p=0.0022 for the frequency of sPSCs of controls compared to rescued CRs of both ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+ mice (Figure 2A); one-way ANOVA followed by a Bonferroni post hoc test). (C) Mean evoked PSCs (ePSCs) for a control CR at P9-11 upon stimulation of LI neuronal fibers in control conditions (top), with SR95531 (middle) and SR95531 in Mg2+-free solution (bottom). Note that ePSCs completely disappeared after bath application of SR95531. Stimulation artefacts were blanked for visibility. The stimulation time is indicated (arrowheads). (D) Amplitudes of ePSCs in control conditions (p=0.0027 and p=0.0067 for the amplitude of ePSCs in controls compared to rescued CRs of ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox;R26mT/+mice, (Figure 2D); one-way ANOVA followed by a Bonferroni post hoc test), in the presence of SR95531 and with SR95531 in Mg2+-free solution (ncontrol = 8, nSR95531 = 7 and nSR95531/Mg2+free=7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (E) Confocal images of a control CR at P10 in ΔNp73cre/+;TauGFP/+ mice expressing GFP (green), Gephyrin (red) and contacted by GABAergic GAD65/67-positive presynaptic terminals (blue; objective 93×; stack of 109 Z sections, each 0.07 µm, n = 11). Arrowheads show GABAergic synapses onto the CR. Note the partial co-localization of GAD65/67 and Gephyrin on the GFP+ membrane of the CR (Inset). Scale bars: 5 µm and 1 µm (inset). (F) Confocal images of a Layer I CR in the cortex and non-CR in the hypothalamus at P10 stained for DAPI (blue), KCC2 (red) and GFP (green) in ΔNp73cre/+; TauGFP/+ mice (objective 93×; single plane of 0.07 µm, n = 6). Note the low level of KCC2 expression in control CR (upper panels) compared to non-CR of ΔNp73cre/+;TauGFP/+ mice (bottom panels). Scale bar represents 5 µm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 2—figure supplement 1—source data 1. Altogether, these results indicate that rescued CRs, as previously showed in the early postnatal neocortex (Soda et al., 2003; Sava et al., 2010; Kilb and Luhmann, 2001), receive solely GABAergic synaptic inputs at the time of their death. They further demonstrate that rescued CRs in both mouse models, inspite of a reduced connectivity compared to earlier stages, are kept integrated in functional neuronal circuits.

Survival of electrically-active CRs triggers dendritic exuberance of upper layer pyramidal neurons

In order to test whether CR aberrant survival may alter the function of other neurons in upper cortical layers, we used biocytin-filling and confocal 3D reconstructions to study the morphology of Layer II (LII) and LIII pyramidal neurons in the somatosensory barrel cortex of both ΔNp73cre/+;R26Kir2.1/+ and ΔNp73cre/+;Baxlox/lox mice. While no major changes were observed in the morphology of LII/III pyramidal neurons of ΔNp73cre/+;R26Kir2.1/+ mice compared to their matched controls (Figure 3—figure supplement 1), major defects were observed for these neurons in ΔNp73cre/+;Baxlox/lox mutants (Figure 3). Quantitative analyses revealed an increase in the number of apical and basal dendritic branches at P25 in ΔNp73cre/+;Baxlox/lox compared to controls (Figure 3B). In order to further characterize cell complexity in relation with the distance from the soma, we performed a Sholl analysis. We observed that LII/III pyramidal cells displayed an increased complexity for apical dendrites (between 180 µm and 240 µm from the soma) as well as for basal dendrites (between 60 and 80 µm from the soma) (Figure 3C). Interestingly, no statistically different changes in the number of dendritic branches (Figure 3—figure supplement 1B) or the complexity of apical and basal dendrites (Figure 3—figure supplement 1C) were detected in LII/LIII pyramidal neurons of the ΔNp73cre/+;R26Kir2.1/+ model, in which SE-CRs survive but are hyperpolarized. Thus, the survival of a specific subset of CRs has a general promoting impact onto the dendritic tree of upper layer pyramidal neurons only when they keep their normal intrinsic excitability. Collectively, our analyses show that SE-CRs survival in LI promotes an exuberance of apical and basal dendrites of LII/LIII pyramidal neurons in an activity-dependent manner.
Figure 3—figure supplement 1.

Morphological reconstruction of LII/LIII pyramidal neurons in ΔNp73cre/+;R26Kir2.1/+ mutants.

(A) Representative examples of somatosensory cortex LII/III pyramidal neurons filled with biocytin in control (P24) and ΔNp73cre/+;R26Kir2.1/+ (P27) mice. (B) Quantification of number of dendritic branches of LII/III pyramidal neurons in controls and ΔNp73cre/+;R26Kir2.1/+ mice, expressed as a percentage relative to the mean of controls (apical dendrites n = 7 for controls and n = 9 for mutants at P23-P29, p=0.550; basal dendrites n = 7 for controls and n = 8 for mutants at P23-P29, p=0.199; Mann-Whitney U Test). (C) Sholl analysis for the apical and basal dendrites in control and ΔNp73cre/+;R26Kir2.1/+ mutant mice showing no significant change in cell complexity with respect to the distance from the soma, (apical dendrites n = 7 for controls and n = 9 for mutants; basal dendrites n = 7 for controls and n = 8 for mutants). Multiple T-test. Scale bar represents 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 3—figure supplement 1—source data 1.

Figure 3.

Increased dendritic branches in LII/LIII pyramidal neurons of ΔNp73cre/+;Baxlox/lox mutants.

(A) Representative examples of LII/III pyramidal neurons filled with biocytin in control (P25) and ΔNp73cre/+;Baxlox/lox mutant (P24) somatosensory cortex. (B) Quantification of the number of dentritic branches in control and ΔNp73cre/+;Baxlox/lox mutant LII/III pyramidal neurons, expressed as a percentage of dendritic branches relative to the mean of controls (n = 7 for controls and n = 8 for mutants at P23-28 p=0.0182 for apical dendrites and p=0.014 for basal dendrites; Mann-Whitney U Test). (C) Sholl analysis for the apical and basal dendrites in control and ΔNp73cre/+;Baxlox/lox mutants showing an increased cell complexity between 180 and 240 µm (p-value=0.04, 0.027, 0.0007 and 0.005, respectively) and 60 and 80 µm (p value=0.027 and 0.019, respectively) from the soma, respectively (n = 7 for controls and n = 8 for mutants). Multiple T-test. Scale bar represents 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 3—figure supplement 1—source data 1.

(A) Representative examples of somatosensory cortex LII/III pyramidal neurons filled with biocytin in control (P24) and ΔNp73cre/+;R26Kir2.1/+ (P27) mice. (B) Quantification of number of dendritic branches of LII/III pyramidal neurons in controls and ΔNp73cre/+;R26Kir2.1/+ mice, expressed as a percentage relative to the mean of controls (apical dendrites n = 7 for controls and n = 9 for mutants at P23-P29, p=0.550; basal dendrites n = 7 for controls and n = 8 for mutants at P23-P29, p=0.199; Mann-Whitney U Test). (C) Sholl analysis for the apical and basal dendrites in control and ΔNp73cre/+;R26Kir2.1/+ mutant mice showing no significant change in cell complexity with respect to the distance from the soma, (apical dendrites n = 7 for controls and n = 9 for mutants; basal dendrites n = 7 for controls and n = 8 for mutants). Multiple T-test. Scale bar represents 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 3—figure supplement 1—source data 1.

Increased dendritic branches in LII/LIII pyramidal neurons of ΔNp73cre/+;Baxlox/lox mutants.

(A) Representative examples of LII/III pyramidal neurons filled with biocytin in control (P25) and ΔNp73cre/+;Baxlox/lox mutant (P24) somatosensory cortex. (B) Quantification of the number of dentritic branches in control and ΔNp73cre/+;Baxlox/lox mutant LII/III pyramidal neurons, expressed as a percentage of dendritic branches relative to the mean of controls (n = 7 for controls and n = 8 for mutants at P23-28 p=0.0182 for apical dendrites and p=0.014 for basal dendrites; Mann-Whitney U Test). (C) Sholl analysis for the apical and basal dendrites in control and ΔNp73cre/+;Baxlox/lox mutants showing an increased cell complexity between 180 and 240 µm (p-value=0.04, 0.027, 0.0007 and 0.005, respectively) and 60 and 80 µm (p value=0.027 and 0.019, respectively) from the soma, respectively (n = 7 for controls and n = 8 for mutants). Multiple T-test. Scale bar represents 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 3—figure supplement 1—source data 1.

Morphological reconstruction of LII/LIII pyramidal neurons in ΔNp73cre/+;R26Kir2.1/+ mutants.

(A) Representative examples of somatosensory cortex LII/III pyramidal neurons filled with biocytin in control (P24) and ΔNp73cre/+;R26Kir2.1/+ (P27) mice. (B) Quantification of number of dendritic branches of LII/III pyramidal neurons in controls and ΔNp73cre/+;R26Kir2.1/+ mice, expressed as a percentage relative to the mean of controls (apical dendrites n = 7 for controls and n = 9 for mutants at P23-P29, p=0.550; basal dendrites n = 7 for controls and n = 8 for mutants at P23-P29, p=0.199; Mann-Whitney U Test). (C) Sholl analysis for the apical and basal dendrites in control and ΔNp73cre/+;R26Kir2.1/+ mutant mice showing no significant change in cell complexity with respect to the distance from the soma, (apical dendrites n = 7 for controls and n = 9 for mutants; basal dendrites n = 7 for controls and n = 8 for mutants). Multiple T-test. Scale bar represents 100 μm. Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 3—figure supplement 1—source data 1.

Survival of electrically-active CRs increases excitatory entries in upper layer pyramidal neurons

To examine whether the defects of the dendritic arborization of LII/III pyramidal neurons were related to changes in the synaptic inputs received by these neurons, we first examined spines on both apical and basal dendrites of biocytin-filled pyramidal cells (Figure 4A–D). Because excitatory synapses are formed on dendritic spines, the latter can be used as a proxy for the quantification of those synapses. For apical dendrites, we examined terminal ramifications in LI, whereas for basal dendrites, we considered horizontal branches approximately at the same distance from the soma. Spine density on both apical and basal dendrites of pyramidal cells was significantly increased in ΔNp73cre/+;Baxlox/lox mutants compared to controls (Figure 4A and B) whereas no differences were observed in ΔNp73cre/+;R26Kir2.1/+ mutants (Figure 4C and D). These results indicate that the survival of electrically-active CRs not only triggers a dendritic exuberance, but also drives an increase in spine densities.
Figure 4.

Spine density and evoked synaptic activity recorded in LII/LIII pyramidal neurons in both ΔNp73cre/+;Baxlox/lox and ΔNp73cre/+;R26Kir2.1/+ mutants.

(A, C) Representative confocal images showing spines in apical and basal dendritic segments of controls (left) and ΔNp73cre/+;Baxlox/lox (A, right) and ΔNp73cre/+;R26Kir2.1/+ mutants (C, right) at P24-25. (B, D) Quantification of the spine density (number of spines/µm) in apical and basal dendrites in LII/LIII pyramidal neurons for both controls and mutants from the same litters (for ΔNp73cre/+;Baxlox/lox apical and basal dendrites: n = 8 for controls and n = 12 for mutants at P23-28, p=0.012 for apical dendrites and p=0.0014 for basal dendrites; for ΔNp73cre/+;R26Kir2.1/+ apical dendrites: n = 10 for controls and n = 6 for mutants at P23-P29, p=0.166; basal dendrites: n = 9 for controls and n = 7 for mutants, p=0.652; Mann-Whitney U Test). Scale bar represents 5 μm. (E, G) Pyramidal neurons recorded in voltage-clamp at −70 mV and 0 mV in control at P26 (E, left) and P24 (G, left) and in a ΔNp73cre/+;Baxlox/lox mutant at P23 (E, right) and a ΔNp73cre/+;R26Kir2.1/+ mutant at P28 (G, right) during the extracellular stimulation of LII/III fibers as indicated (E, inset). Stimulation artefacts were blanked for visibility. The stimulation time is indicated (arrowheads). (F, H) Plots of E/I ratio calculated from eEPSCs and eIPSCs in controls and ΔNp73cre/+;Baxlox/lox mutants (F) and ΔNp73cre/+; R26Kir2.1/+ mutants (H) (for ΔNp73cre/+;Baxlox/lox: n = 10 for controls and n = 14 for mutants, p=0.031, Student T Test; for ΔNp73cre/+;R26Kir2.1/+: n = 8 for controls and n = 7 for mutants, p=0.612; Mann-Whitney U Test). Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 4—figure supplement 1—source data 1.

(A, B) Plots of the mean amplitude of eEPSCs (left) and eIPSCs (right) evoked by extracellular stimulation for the same pyramidal neurons of Figure 4 held at −70 mV and 0 mV, respectively, in controls and ΔNp73cre/+;Baxlox/lox (A) and ΔNp73cre/+;R26Kir2.1/+ (B) mutants. Note the significant increase in the mean amplitude of eEPSCs for ΔNp73cre/+;Baxlox/lox (p=0.042) but not for ΔNp73cre/+;R26Kir2.1/+ mutants (p=0.902). eIPSCs remained unchanged. (C) sEPSCs recorded in pyramidal neurons held at −70 mV in a control at P26 (black) and a ΔNp73cre/+;Baxlox/lox mutant at P23 (green). (D, E) Plots of the mean frequencies of sEPSCs in ΔNp73cre/+;Baxlox/lox (D) and ΔNp73cre/+;R26Kir2.1/+ (E) mutants at P23-26 and P23-28, respectively. Note the significant increase in the mean frequency of sEPSCs for ΔNp73cre/+;Baxlox/lox but not for ΔNp73cre/+;R26Kir2.1/+ mutants (n = 9 for controls and n = 11 for ΔNp73cre/+;Baxlox/loxp=0.038, Student T test; n = 7 for controls and n = 8 for ΔNp73cre/+;R26Kir2.1/+ mice p=0.942, Mann-Whitney U test). For the same cells, mean sEPSC amplitudes: −17.5 ± 2.2 pA for controls vs −19.2 ± 1.4 pA for ΔNp73cre/+;Baxlox/lox mice (p=0.501; Student T test) and −12.20 ± 0.81 pA for controls vs –14.30 ± 1.95 pA for ΔNp73cre/+;R26Kir2.1/+ mice (p=0.9551; Mann-Whitney U test). (F) Current-clamp recording of a ChR2-expressing rescued CR upon light stimulation in a ΔNp73cre/+;Baxlox/lox;ChR2lox/+ mouse (see diagram). Note that photoactivation (blue pulses, 1 ms) evoked action potentials in response to every light pulse of a 5 Hz-light train of 10 s (bottom left). Similar results were obtained with a 5 Hz-light train of 30 s (n = 7) and in the presence of ionotropic receptor antagonists 10 µM NBQX, 50 µM AP5 and 10 µM SR95351 (n = 2). Average percentage of success to elicit action potentials with light trains of 10 s delivered from 2 to 20 Hz (right). Note the decreased number of action potentials triggered by photoactivation from 10 Hz (n = 7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (G) Simultaneous Layer II/III extracellular recording and whole-cell recording of a Layer I interneuron localized nearby a ChR2-expressing rescued CR (see diagram, top left). The firing of the interneuron in response to 800 ms depolarizing and hyperpolarizing steps is shown (inset, top right). A 5 Hz-light train of 10 s did not induce Layer II/III LFPs or postsynaptic currents in the recorded interneuron held at −70 mV (bottom left). Similarly, no responses were observed during extracellular recordings of Layer I (n = 3), Layer II/III (n = 5) and Layer V (n = 3) or during whole-cell recordings of Layer I interneuron (n = 3) in normal conditions or in the presence of 0 mM Mg2+, 3 mM Ca2+ and 4AP (n = 3). Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 4—figure supplement 1—source data 1.

Spine density and evoked synaptic activity recorded in LII/LIII pyramidal neurons in both ΔNp73cre/+;Baxlox/lox and ΔNp73cre/+;R26Kir2.1/+ mutants.

(A, C) Representative confocal images showing spines in apical and basal dendritic segments of controls (left) and ΔNp73cre/+;Baxlox/lox (A, right) and ΔNp73cre/+;R26Kir2.1/+ mutants (C, right) at P24-25. (B, D) Quantification of the spine density (number of spines/µm) in apical and basal dendrites in LII/LIII pyramidal neurons for both controls and mutants from the same litters (for ΔNp73cre/+;Baxlox/lox apical and basal dendrites: n = 8 for controls and n = 12 for mutants at P23-28, p=0.012 for apical dendrites and p=0.0014 for basal dendrites; for ΔNp73cre/+;R26Kir2.1/+ apical dendrites: n = 10 for controls and n = 6 for mutants at P23-P29, p=0.166; basal dendrites: n = 9 for controls and n = 7 for mutants, p=0.652; Mann-Whitney U Test). Scale bar represents 5 μm. (E, G) Pyramidal neurons recorded in voltage-clamp at −70 mV and 0 mV in control at P26 (E, left) and P24 (G, left) and in a ΔNp73cre/+;Baxlox/lox mutant at P23 (E, right) and a ΔNp73cre/+;R26Kir2.1/+ mutant at P28 (G, right) during the extracellular stimulation of LII/III fibers as indicated (E, inset). Stimulation artefacts were blanked for visibility. The stimulation time is indicated (arrowheads). (F, H) Plots of E/I ratio calculated from eEPSCs and eIPSCs in controls and ΔNp73cre/+;Baxlox/lox mutants (F) and ΔNp73cre/+; R26Kir2.1/+ mutants (H) (for ΔNp73cre/+;Baxlox/lox: n = 10 for controls and n = 14 for mutants, p=0.031, Student T Test; for ΔNp73cre/+;R26Kir2.1/+: n = 8 for controls and n = 7 for mutants, p=0.612; Mann-Whitney U Test). Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 4—figure supplement 1—source data 1.

Evoked and spontaneous EPSCs and IPSCs of LII/LIII pyramidal neurons in ΔNp73cre/+;Baxlox/lox and ΔNp73cre/+;R26Kir2.1/+ mutants.

(A, B) Plots of the mean amplitude of eEPSCs (left) and eIPSCs (right) evoked by extracellular stimulation for the same pyramidal neurons of Figure 4 held at −70 mV and 0 mV, respectively, in controls and ΔNp73cre/+;Baxlox/lox (A) and ΔNp73cre/+;R26Kir2.1/+ (B) mutants. Note the significant increase in the mean amplitude of eEPSCs for ΔNp73cre/+;Baxlox/lox (p=0.042) but not for ΔNp73cre/+;R26Kir2.1/+ mutants (p=0.902). eIPSCs remained unchanged. (C) sEPSCs recorded in pyramidal neurons held at −70 mV in a control at P26 (black) and a ΔNp73cre/+;Baxlox/lox mutant at P23 (green). (D, E) Plots of the mean frequencies of sEPSCs in ΔNp73cre/+;Baxlox/lox (D) and ΔNp73cre/+;R26Kir2.1/+ (E) mutants at P23-26 and P23-28, respectively. Note the significant increase in the mean frequency of sEPSCs for ΔNp73cre/+;Baxlox/lox but not for ΔNp73cre/+;R26Kir2.1/+ mutants (n = 9 for controls and n = 11 for ΔNp73cre/+;Baxlox/loxp=0.038, Student T test; n = 7 for controls and n = 8 for ΔNp73cre/+;R26Kir2.1/+ mice p=0.942, Mann-Whitney U test). For the same cells, mean sEPSC amplitudes: −17.5 ± 2.2 pA for controls vs −19.2 ± 1.4 pA for ΔNp73cre/+;Baxlox/lox mice (p=0.501; Student T test) and −12.20 ± 0.81 pA for controls vs –14.30 ± 1.95 pA for ΔNp73cre/+;R26Kir2.1/+ mice (p=0.9551; Mann-Whitney U test). (F) Current-clamp recording of a ChR2-expressing rescued CR upon light stimulation in a ΔNp73cre/+;Baxlox/lox;ChR2lox/+ mouse (see diagram). Note that photoactivation (blue pulses, 1 ms) evoked action potentials in response to every light pulse of a 5 Hz-light train of 10 s (bottom left). Similar results were obtained with a 5 Hz-light train of 30 s (n = 7) and in the presence of ionotropic receptor antagonists 10 µM NBQX, 50 µM AP5 and 10 µM SR95351 (n = 2). Average percentage of success to elicit action potentials with light trains of 10 s delivered from 2 to 20 Hz (right). Note the decreased number of action potentials triggered by photoactivation from 10 Hz (n = 7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (G) Simultaneous Layer II/III extracellular recording and whole-cell recording of a Layer I interneuron localized nearby a ChR2-expressing rescued CR (see diagram, top left). The firing of the interneuron in response to 800 ms depolarizing and hyperpolarizing steps is shown (inset, top right). A 5 Hz-light train of 10 s did not induce Layer II/III LFPs or postsynaptic currents in the recorded interneuron held at −70 mV (bottom left). Similarly, no responses were observed during extracellular recordings of Layer I (n = 3), Layer II/III (n = 5) and Layer V (n = 3) or during whole-cell recordings of Layer I interneuron (n = 3) in normal conditions or in the presence of 0 mM Mg2+, 3 mM Ca2+ and 4AP (n = 3). Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 4—figure supplement 1—source data 1. To test whether these morphological modifications in ΔNp73cre/+;Baxlox/lox mutants is accompanied by modifications in excitatory synaptic inputs, we performed whole-cell recordings of upper layer pyramidal neurons during the extracellular stimulation of LII/III fibers. First, the membrane potential of recorded cells was maintained at −70 mV or 0 mV to respectively record evoked excitatory (eEPSCs) and inhibitory (eIPSCs) postsynaptic currents. Pyramidal cells in ΔNp73cre/+;Baxlox/lox mutants showed a significant increase in the mean amplitude of eEPSCs, while that of eIPSCs remained unchanged compared to controls (Figure 4E, Figure 4—figure supplement 1A). This modification is highlighted by a significant increase in the E/I ratio (Figure 4F). Together with the increased spine density, these data strongly suggest that pyramidal neurons have enhanced excitatory synaptic inputs. To corroborate this possibility, we then analyzed the spontaneous EPSCs (sEPSCs) of recorded pyramidal neurons. As expected for an increased number of inputs, the sEPSC frequency was significantly higher in ΔNp73cre/+;Baxlox/lox mutants with respect to controls while the mean sEPSC amplitude remained unchanged (Figure 4—figure supplement 1C-D). When the same experiments were performed in ΔNp73cre/+;R26Kir2.1/+ mutants, no differences were observed either in the amplitudes of both eEPSCs and eIPSCs or in the E/I ratio (Figure 4G–H, Figure 4—figure supplement 1B). In line with this, changes were neither observed in the frequency of sEPSCs of these mutants (Figure 4—figure supplement 1E), showing that defects in the synaptic activity of pyramidal neurons is dependent on the intrinsic activity of rescued CRs. To test whether the effect on pyramidal cells could be due to a direct action of CR activity on excitatory circuits, we produced ΔNp73cre/+;Baxlox/lox; ChR2lox/+ mutant mice to photoactivate rescued CRs while recording neuronal network activity. After defining an efficient photostimulation protocol for reliably eliciting action potentials on recorded CRs (Figure 4—figure supplement 1F), we combined photostimulation with of Layer I interneuron recordings in whole-cell configuration and/or local field potentials (LFPs) in different layers (Figure 4—figure supplement 1G). We could never detect light-evoked responses during patch-clamp or extracellular recordings, even in the presence of 0 mM Mg2+, 3 mM Ca2+ and 50 µM of the potassium channel blocker 4AP, a treatment that renders all neurons more excitable (Figure 4—figure supplement 1G). Although these results do not rule out that rescued CRs contact other neurons through bona fide glutamatergic synapses, the low proportion of these cells compared to pyramidal neurons and the lack of electrical extracellular responses during their sustained light stimulation suggest that direct synaptic inputs from CRs cannot account for the robust morphological and functional changes induced in pyramidal cells by the aberrant CR survival.
Figure 4—figure supplement 1.

Evoked and spontaneous EPSCs and IPSCs of LII/LIII pyramidal neurons in ΔNp73cre/+;Baxlox/lox and ΔNp73cre/+;R26Kir2.1/+ mutants.

(A, B) Plots of the mean amplitude of eEPSCs (left) and eIPSCs (right) evoked by extracellular stimulation for the same pyramidal neurons of Figure 4 held at −70 mV and 0 mV, respectively, in controls and ΔNp73cre/+;Baxlox/lox (A) and ΔNp73cre/+;R26Kir2.1/+ (B) mutants. Note the significant increase in the mean amplitude of eEPSCs for ΔNp73cre/+;Baxlox/lox (p=0.042) but not for ΔNp73cre/+;R26Kir2.1/+ mutants (p=0.902). eIPSCs remained unchanged. (C) sEPSCs recorded in pyramidal neurons held at −70 mV in a control at P26 (black) and a ΔNp73cre/+;Baxlox/lox mutant at P23 (green). (D, E) Plots of the mean frequencies of sEPSCs in ΔNp73cre/+;Baxlox/lox (D) and ΔNp73cre/+;R26Kir2.1/+ (E) mutants at P23-26 and P23-28, respectively. Note the significant increase in the mean frequency of sEPSCs for ΔNp73cre/+;Baxlox/lox but not for ΔNp73cre/+;R26Kir2.1/+ mutants (n = 9 for controls and n = 11 for ΔNp73cre/+;Baxlox/loxp=0.038, Student T test; n = 7 for controls and n = 8 for ΔNp73cre/+;R26Kir2.1/+ mice p=0.942, Mann-Whitney U test). For the same cells, mean sEPSC amplitudes: −17.5 ± 2.2 pA for controls vs −19.2 ± 1.4 pA for ΔNp73cre/+;Baxlox/lox mice (p=0.501; Student T test) and −12.20 ± 0.81 pA for controls vs –14.30 ± 1.95 pA for ΔNp73cre/+;R26Kir2.1/+ mice (p=0.9551; Mann-Whitney U test). (F) Current-clamp recording of a ChR2-expressing rescued CR upon light stimulation in a ΔNp73cre/+;Baxlox/lox;ChR2lox/+ mouse (see diagram). Note that photoactivation (blue pulses, 1 ms) evoked action potentials in response to every light pulse of a 5 Hz-light train of 10 s (bottom left). Similar results were obtained with a 5 Hz-light train of 30 s (n = 7) and in the presence of ionotropic receptor antagonists 10 µM NBQX, 50 µM AP5 and 10 µM SR95351 (n = 2). Average percentage of success to elicit action potentials with light trains of 10 s delivered from 2 to 20 Hz (right). Note the decreased number of action potentials triggered by photoactivation from 10 Hz (n = 7; Kruskal-Wallis test followed by a Bonferroni multiple comparison). (G) Simultaneous Layer II/III extracellular recording and whole-cell recording of a Layer I interneuron localized nearby a ChR2-expressing rescued CR (see diagram, top left). The firing of the interneuron in response to 800 ms depolarizing and hyperpolarizing steps is shown (inset, top right). A 5 Hz-light train of 10 s did not induce Layer II/III LFPs or postsynaptic currents in the recorded interneuron held at −70 mV (bottom left). Similarly, no responses were observed during extracellular recordings of Layer I (n = 3), Layer II/III (n = 5) and Layer V (n = 3) or during whole-cell recordings of Layer I interneuron (n = 3) in normal conditions or in the presence of 0 mM Mg2+, 3 mM Ca2+ and 4AP (n = 3). Data used for quantitative analyses as well as the numerical data that are represented in graphs are available in Figure 4—figure supplement 1—source data 1.

Overall, these experiments show that the survival of electrically-active SE-CRs increases the excitatory inputs to upper pyramidal neurons, possibly through a non-glutamatergic mechanism, thereby generating a E/I imbalance and functional changes in circuit wiring.

Discussion

Our results show that the elimination of specific subsets of CRs, SE-CRs, is activity-dependent and that this process is essential for proper cortical wiring. Indeed, the persistence of SE-CRs beyond their normal phase of elimination triggered major deficits in LII/LIII somatosensory pyramidal neurons. Not only the analyzed neurons displayed an increased dendritic arborization and spine density, but they also consistently showed enhanced excitatory inputs leading to a functional E/I imbalance. Remarkably, these anatomical and electrophysiological deficits all relied on the fact that persistent CRs were electrically-active. Our study thus demonstrates that activity is required to eliminate SE-CRs, whose survival would otherwise perturb cortical wiring in an activity-dependent manner. Taken together, it reveals an elegant interplay between transient CRs and neuronal activity in the construction of functional cortical excitatory circuits.

CR subtype-specific pathways in programmed cell death

Activity was reported to promote survival of both glutamatergic and GABAergic neurons in the neocortex and in general in the nervous system ( Blanquie et al., 2017a; Causeret et al., 2018; Wong and Marín, 2019), providing a mean to integrate around 70% of neurons into functional circuits. CRs, which completely undergo programmed cell death in the cerebral cortex (Ledonne et al., 2016; Causeret et al., 2018), have been previously proposed to behave differently. These neurons display ‘immature’ features such as a depolarized resting potential and a very high input resistance (Kirischuk et al., 2014). Especially, GABA is depolarizing in these cells due to their elevated intracellular chloride concentration resulting from the activity of the chloride inward transporter NKCC1 in the absence of expression of chloride outward transporter KCC2 (Mienville, 1998; Achilles et al., 2007; Pozas et al., 2008). Interestingly, the pharmacological blockade of NKCC1 in cell cultures or the genetic ablation of this transporter in vivo promotes the survival of a CR population, probably by preventing GABAA receptor-mediated depolarization (Blanquie et al., 2017b). It must be considered, however, that the depolarizing effect of GABA will depend most probably on the levels of neuronal activity since high activity levels attenuate the GABAA receptor-mediated excitatory drive in CRs (Kolbaev et al., 2011). Here, we confirmed that CRs receive exclusively functional GABAergic synaptic inputs and express low levels of KCC2 in the second postnatal week, that is during the period of massive cell death. Our findings raise the question of the identity of possible GABAergic neurons that regulate CR subtype elimination. CRs receive GABAergic synaptic inputs from different sources, including local interneurons of Layer I, the underlying layers of the neocortex and the subplate, a transient cortical structure absent in the fourth postnatal week, as well as the zona incerta (Kirmse et al., 2007; Myakhar et al., 2011; Kirischuk et al., 2014; Chen and Kriegstein, 2015; Sun et al., 2019). A related issue is how GABAergic inputs to CRs might change overtime, since we found that rescued CRs receive less inputs than at earlier stages. One interesting possibility is that rescued CRs in Layer I might lose GABAergic innervation from transient or distant populations (i.e. subplate and zona incerta) during maturation of neuronal networks, restricting their connectivity with more local neocortical inputs. Further investigation is needed to determine the different interneuron subtypes impinging on CRs in immature cortical circuits and after their aberrant survival in adults. Using conditional Kir2.1 expression in a large subpopulation of CRs, we unequivocally show that only a specific subset of CRs, SE-CRs, dies in an activity-dependent manner in vivo. Since CRs are highly hyperpolarized in this mouse model, a plausible explanation is that GABAergic inputs cannot exert their depolarizing effect as in normal conditions, thereby preventing cell death. In this context, it is also tempting to hypothesize that, as shown in other systems, neuronal activity via intracellular calcium signals could trigger apoptosis, as reported during excitotoxicity (Blanquie et al., 2017a). The timing of SE-CRs death, namely the second postnatal week, corresponds to a major switch in cortical activity (Luhmann and Khazipov, 2018) and in GABAergic circuits (Cossart, 2011), raising the possibility that the elimination of CRs is part of a more global activity-dependent remodeling of cortical circuits. Irrespective of the underlying mechanism, surviving Kir2.1-expressing CRs displayed a relatively normal morphology, expressed Reln and received GABAergic synaptic inputs. Remarkably, SE-CRs is also the subpopulation undergoing a Bax-dependent apoptosis. Quantification of CRs that persist in both models suggests that a vast majority of SE-CRs survives. Indeed, in both deletion of Bax (Ledonne et al., 2016) or over-expression of Kir2.1 (this manuscript) models, a five-fold increase in CR numbers, corresponding to approximately 30% of the initial pool at P7, is detected when using the ΔNp73Cre line, in contrast to none when using the hem-specific Wnt3aCre line. Since hem-CRs constitute about 70% of the population targeted by the ΔNp73Cre line (Bielle et al., 2005; Yoshida et al., 2006; Tissir et al., 2009), our findings support that the 30% of rescued CRs in ΔNp73Cre corresponds to a large fraction, if not all, of the SE-CR population. Together, these results demonstrate that hem-derived CRs die in a Bax- and activity-independent manner, in contrast to SE-CRs that survive in Bax and Kir2.1 mutants. Hence, our work reveals that subpopulations of CRs are eliminated by very distinct mechanisms. Interestingly, hippocampal CRs, which mostly derive from the cortical hem (Louvi et al., 2007) display a delayed death which seems to occur independently of the apoptotic-specific Caspase-3 activity (Anstötz et al., 2016; Anstötz et al., 2018). Together, these data support the notion that CR subtypes are intrinsically different in the mechanism determining their demise and argues in favor of complex yet unappreciated subtype-specific pathways leading ultimately to cell death.

CRs aberrant survival perturbs the morphology and connectivity of upper layer neurons in an activity-dependent manner

In this work, we have demonstrated that SE-CRs persistence in mice has a strong effect on LII/III pyramidal neuron morphology and excitatory circuits. Notably, in the ΔNp73cre/+;Baxlox/lox mutants, we observed an impact on both apical and basal dendrites. While the effect on apical dendrites could be direct via local surviving SE-CRs, the impact on basal ones might be circuit-mediated since excitatory entries in apical dendritic tufts were shown to modify basal dendrite synaptic plasticity (Williams and Holtmaat, 2019). Moreover, SE-CRs survival leads in ΔNp73cre/+;Baxlox/lox mutants to increased synaptic density with major functional consequences on the E/I ratio. Conversely, recent work showed that aberrant reduction of CRs during development triggers decreased apical dendritic tufts and dendritic spine density of LII/III pyramidal neurons accompanied by a reduction in the E/I ratio (de Frutos et al., 2016). Taken together our findings reveal that the proper balance of CRs constitutes an essential, yet underappreciated, regulator of LII/III pyramidal neuron morphology and wiring. Importantly, we found in both Bax and Kir models that surviving CRs are similarly kept embedded into functional networks. Interestingly, rescued CRs are also solely innervated by GABAA receptor-mediated synapses like their younger control counterparts. Although GABAergic synaptic connectivity often increases during postnatal development (Pangratz-Fuehrer and Hestrin, 2011), some cells may display transient connections that disappear after the second postnatal week, thereby accounting for the reduced connectivity observed in the two models. In contrast, since the effects on pyramidal neurons and cortical excitability are only found in Bax mutants, our study reveals that the inappropriate survival of SE-CRs drives an abnormal cortical wiring via an activity-dependent mechanism. However, CRs appear to act on upper layer pyramidal neurons via partially distinct mechanisms at different time points during development. Indeed, Kir2.1 expressing mice appear largely similar to controls, suggesting that the impact of reducing CR density on LII/III apical dendrites (de Frutos et al., 2016) does not rely exclusively on the intrinsic excitability of CRs. Nevertheless, the mechanism by which rescued CRs induce morphological and functional changes on pyramidal neurons remains unresolved. The lack of response observed during our optogenetic experiments suggest that these changes may not depend on a direct CR excitatory synaptic input onto principal neurons. This is in line with recent data obtained with experiments performed in the hippocampus using ChR2 activation and paired-recordings in the third postnatal week, where CRs are still present in high density (Quattrocolo and Maccaferri, 2014; Anstötz et al., 2016). Indeed, only very few pyramidal cells could be detected as an output of CR cells. Further experiments will be required to determine the relative roles of CR-secreted factors versus circuit-mediated effects onto apical and basal dendrites. Regardless the mechanism and since excitatory entries onto apical dendrites are emerging as major actors in sensory gating, cortical integration and reward (Keller and Mrsic-Flogel, 2018; Khan and Hofer, 2018; Lacefield et al., 2019; Williams and Holtmaat, 2019; Zhang and Bruno, 2019), our findings highlight the importance of a transient cell population in the emergence of functional circuits as well as the deleterious effects of their abnormal demise. Our study thus shows that the elimination of SE-CRs in the somatosensory cortex is required for proper morphology and wiring of LII/III pyramidal neurons and reveals a remarkable interplay between activity, the elimination of transient cells and cortical wiring. Indeed, activity, likely driven by cortical maturation, regulates the elimination of transient CRs that would otherwise perturb upper layer wiring. Notably, CRs persistence has been described in human pathological conditions, often associated with epilepsy. Our work thus not only provides novel insights onto normal wiring of upper layers, but also addresses the functional consequences of incomplete CR removal with major relevance for neurodevelopmental diseases, such as autism spectrum disorder, schizophrenia or epilepsy.

Materials and methods

Animals

ΔNp73(ΔNp73Cre) (Tissir et al., 2009), Wnt3a (Yoshida et al., 2006), ROSA26(R26mT) (Madisen et al., 2010), Tau (TauGFP) (Hippenmeyer et al., 2005) and ChR2lox (Ai32(RCL-ChR2(H134R)/EYFP) (https://www.jax.org/strain/012569​)) transgenic mice were kept in a C57BL/6J background. The Bax/J line (Takeuchi et al., 2005) harboring the floxed Bax and the Bak knock-out alleles was purchased from the Jackson laboratory as mixed B6;129. ΔNp73Cre and Wnt3aCre lines were crossed with the R26mT or TauGFP reporter lines to permanently label CR subtypes. ΔNp73Cre line was crossed to the Bax/J line (Baxlox/lox) to inactivate Bax function in specific CR subtypes. The conditional knock-out also harbored a reporter allele R26mT in order to trace the neurons in which recombination had occurred. ΔNp73Cre and Wnt3aCre lines were crossed to ROSA26 (R26Kir2.1/+) (Moreno-Juan et al., 2017) to overexpress the Kcnj2 gene, which encodes Kir2.1, in specific CR subpopulations. Controls used were littermates heterozygous Bax for the Bax model and ΔNp73+/+;R26Kir2.1/+ for the Kir2.1 model. Animals were genotyped by PCR using primers specific for the different alleles. All animals were handled in strict accordance with good animal practice as defined by the national animal welfare bodies, and all mouse work was approved by the Veterinary Services of Paris (Authorization number: 75–1454) and by the Animal Experimentation Ethical Committee Buffon (CEEA-40) (Reference: CEB-34–2012) and by the Animal Experimentation Ethical Committee Darwin (Reference: 02224.02).

Tissue preparation and immunohistochemistry

For staging of animals, the birth date was considered as postnatal day 0 (P0). Animals were anesthetized with Isoflurane and intracardially perfused with 4% paraformaldehyde (PFA) in 0.1 M PBS, pH 7.4 and post-fixed over-night in 4% PFA at 4°C. Brain were embedded in 3.5% agarose and sectioned in 70 µm free-floating slices at all stages in Figure 1 and Figure 1—figure supplement 1. For Figure 2—figure supplement 1E, brains were cryoprotected and sectioned in 50 µm free-floating slices. Immunostaining was performed as previously described (Bielle et al., 2005; Griveau et al., 2010; de Frutos et al., 2016). Primary antibodies used for immunohistochemistry were: mouse anti-Reelin (MAB5364, Millipore 1:300), rabbit anti-DsRed (Takara 632496, 1:500), mouse anti-Gephyrin (147 011, Synaptic Systems, 1:250), Rabbit anti-GAD65/67 (AB1511, Merck, 1:250), guinea pig anti-KCC2 (Gift of S.Morton and D.Ng, 1:4000). Secondary antibodies used against primary antibodies were: donkey anti-mouse Alexa-488 (Jackson ImmunoResearch Laboratories, 1:800), donkey anti-rabbit Cy3 (Jackson ImmunoResearch Laboratories, 1:800), donkey anti-chick Alexa-488 (Jackson ImmunoResearch Laboratories, 1:1000), donkey anti-mouse Alexa-555 (A-31570, Molecular Probes, 1:1000), donkey anti-rabbit Alexa-647 (A31573, Molecular Probes, 1:500), goat anti-guinea pig Alexa-555 (A-21435, Molecular Probes, 1:1000). Hoechst (Sigma-Aldrich 33342, 1:1000) and DAPI (D1306, ThermoFisher Scientific, 1:2000) were used for fluorescent nuclear counterstaining the tissue and mounting was done in Vectashield (Vector Labs).

Image acquisition and cell countings

Immunofluorescence images were acquired using a confocal microscope (Leica TCS SP5), except for anti-KCC2, Gephyrin and GAD65/67 (Figure 2—figure supplement 1E, f) that were acquired on a LEICA SP8 confocal microscope with 93X objective and 2.5 digital zoom (a single optical plane or around 100 z-stacks of 0.07 µm respectively). DsRed+ neurons, detected by immunofluorescence, were counted using the ImageJ software, in the somatosensory barrel cortex (S1) for each age and genotype. For each section, the density of CRs (DsRed+ CRs/mm3) was calculated taking into account the thickness of the section and the surface of Layer I, measured using ImageJ software.

Acute slice preparation, electrophysiology and photostimulation

Acute coronal slices (300 µm) of the neocortex were obtained from ΔNp73cre/+;Baxlox/lox and ΔNp73cre/+;R26Kir2.1/+ mutants. Excitation light to visualize the tdTomato or Cherry fluorescent proteins was provided by a green Optoled Light Source (Cairn Research, UK) and images were collected with an iXon+ 14-bit digital camera (Andor Technology, UK), as previously described (Orduz et al., 2015). Patch-clamp recordings were performed at RT using an extracellular solution containing (in mM): 126 NaCl, 2.5 KCl, 1.25 NaH2PO4, 26 NaHCO3, 20 glucose, five pyruvate, 2 CaCl2 and 1 MgCl2 (95% O2, 5% CO2). Fluorescent CRs were recorded at P13-17 and P24-29 with different intracellular solutions according to the experiment and containing (in mM): either 130 K-Gluconate (K-Glu) or 130 KCl, 0.1 EGTA, 0.5 CaCl2, 2 MgCl2, 10 HEPES, 2 Na2-ATP, 0.2 Na-GTP and 10 Na2-phosphocreatine and 5.4 mM biocytin (pH ≈ 7.3). When using a KGlu-based intracellular solution in whole-cell configuration, potentials were corrected for a junction potential of −10 mV. Recordings were made without series resistance (Rs) compensation; Rs was monitored during recordings and cells showing a change of more than 20% in Rs were discarded. To evaluate the effect of SR95351 (10 µM; Abcam, Cambridge, UK), drug perfusion reached a steady state at 3 min in the recording chamber. This time was respected before quantification of either spontaneous or evoked PSCs. To test for the presence of eEPSCs mediated by NMDARs receptors at hyperpolarized potentials, the extracellular concentration of MgCl2 was replaced by CaCl2 in order to relieve the Mg2+ block of these receptors. Photostimulation of fluorescent ChR2-expressing rescued CRs recorded in whole-cell configuration was obtained by triggering light trains with a blue LED (470 nm, 1 ms pulses; Optoled Light Source, Cairn Research, UK). Light trains of 2, 5, 10 and 20 Hz during 10 s or 30 s were applied to define the optimal frequency inducing an effective activation of recorded ChR2-expressing rescued CRs. For each frequency, we calculated the number of spikes (Ns) with respect to the number of light pulses (NLP) and determined the percentage of success as [Ns/NLP] x 100. To test the effect of rescued CRs activation, we performed extracellular recordings and patch-clamp recordings of Layer I interneurons while stimulating with light trains (5 Hz, 10 s or 30 s). Extracellular recordings were recorded with a patch pipette filled with extracellular solution. In a set of experiments, the extracellular solution contained 0 mM Mg2+, 3 mM Ca2+ and 4AP for more than 5 min at least. Recordings were obtained using Multiclamp 700B and pClamp10.1 (Molecular Devices), filtered at 4 kHz and digitized at 20 kHz. Digitized data were analyzed off-line using Neuromatic within IGOR Pro 6.0 environment (Wavemetrics, USA) (Rothman and Silver, 2018). Extracellular stimulations were performed using a monopolar electrode (glass pipette) placed in Layer I for CRs and Layer II/III for pyramidal neurons (20–99 V, 100 µs stimulations each 8–12 s; Iso-Stim 01D, npi electronic GmbH, Tamm, Germany). Spontaneous postysynaptic currents were detected with a threshold of 2 times the noise standard deviation during a time window of 3 min for CRs and 1.5 min for pyramidal cells. The Vm was estimated in current-clamp mode as soon as the whole-cell configuration was established. The analysis of Rin, action potential amplitudes and duration was performed during pulses of 800 ms in current-clamp configuration from −80 mV during increasing steps of 5 pA as previously described (Ledonne et al., 2016).

Morphological analyses

For morphological analysis, CRs and layer II/III pyramidal cells were loaded with biocytin through patch pipette during whole-cell recordings. The slices were fixed 2 hr in 4% paraformaldehyde at 4°C, rinsed three times in PBS for 10 min, and incubated with 1% triton X-100% and 2% BSA during 1 hr. Then, they were washed three times in PBS and incubated in DyLight 488 streptavidin (Vector Labs, Burlingame, USA) for 2 hr. Successfully labeled CRs and Layer II/III pyramidal cells were visualized either using a LEICA SP5 or SP8 confocal microscope with a 40X objective and a 1.3 digital zoom. Around 250 optical sections of 0.6 μm were necessary to image the whole dendritic tree of each neuron. For dendritic spines, images of apical dendrites in Layer I and basal dendrites in Layer II/III were acquired with a 63X objective (100 optical sections of 0.25 μm each). For apical dendrites, a terminal ramification in Layer I was acquired, while for basal dendrites a horizontal dendrite in Layer II/III was acquired approximately at 60 μm distance from the soma after the first ramification. 3D reconstruction was performed using the IMARIS software 8.4. Statistical analyses were performed based on the data given by IMARIS in apical and basal dendrites separately. Counting of spines was performed manually using ImageJ software on black and white maximum projections on two different segments approximately 50 µm long for each image. For morphological analysis of CRs, statistical analyses were performed based on the values calculated by image analyses using the IMARIS software (soma diameter and filament length).

Statistical analysis

All data were expressed as mean ± SEM. A P-value less than 0.05 was considered significant. For statistical groups larger than 7, we performed a D’Agostino-Pearson normality test. According to the data structure, two-group comparisons were performed using two-tailed unpaired Student T test or Mann-Whitney U Test. Bonferroni multiple comparisons were used as post-hoc test following one-way or two-way ANOVA or the non-parametric Kruskal-Wallis Tests. For small statistical groups (less than 7), we systematically performed non-parametric tests (Mann-Whitney U Test or Kruskal-Wallis Tests with Dunn’s correction). A reconstructed pyramidal neuron displaying an exceptional basal dendrite projecting to Layer I was submitted to Grubbs test and excluded as an extreme outlier. Statistics and plotting were performed using GraphPad Prism 7.00 (GraphPad Software Inc, USA). *p<0.05, **p<0.01, ***p<0.001. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: In this paper, you have provided novel information on the role of the subset of Cajal-Retzius (CR) neurons derived from the septum and thalamic eminences in the maturation of cortical circuits. You show that upon overexpressing Kir2.1, this subpopulation of CR cells can be rescued from developmental cell death, then become functionally integrated into cortical circuits. You also nicely demonstrate that spontaneous and evoked postsynaptic currents observed in the rescued CRs can be abolished by GABA-AR antagonists, implicating GABAergic inputs in regulating CR neuronal activity. Of interest is that the CRs aberrantly survive after hyperpolarization and trigger dendritic and spine complexity and electrophysiological properties of L2/3 pyramidal neurons, leading to an increased E/I ratio. In all, your paper highlights activity-dependent programmed cell death that is required for the proper formation of cortical circuits. Decision letter after peer review: Thank you for sending your article entitled "Activity-dependent death of transient Cajal-Retzius neurons is required for functional cortical wiring" for peer review at eLife. Your article is being evaluated by three peer reviewers, and the evaluation is being overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. Given the list of essential revisions, including new experiments, the editors and reviewers invite you to respond within the next two weeks with an action plan and timetable for the completion of the additional work. We plan to share your responses with the reviewers and then issue a binding recommendation. Two of the three reviewers, and the Reviewing Editor, are enthusiastic about your work, and considered the data that Cajal-Retzius (CR) developmental cell death is regulated by neuronal activity "innovative and highly interesting", "convincing", and "providing important new insights" on the role of the subset of CR neurons derived from the septum and thalamic eminences in the maturation of cortical circuits. You demonstrate that upon overexpressing Kir2.1, this subpopulation of CR cells can be rescued from apoptosis and functionally integrated into cortical circuits. You nicely show that spontaneous and evoked postsynaptic currents observed in the rescued CRs can be abolished by GABA-AR antagonist application, and you thus implicate GABAergic inputs as regulating CR neuron activity. Of interest is that the CRs that aberrantly survive promote dendritic and spine complexity and electrophysiological properties of in L2/3 pyramidal neurons, thus leading to an increased E/I ratio. These data add to your previous study and are novel. However, the appended reviews and off-line reviewer consultation raise several questions and suggestions made for addressing them, that would strengthen the paper. Below the requests for additional data are summarized, in order of feasibility and time required to perform the analyses. 1) Even though NKCC1 expression and lack of KCC2 in identified CR cells have been reported by single-cell PCR (Figures 4 in Achilles et al.), demonstrate that KCC2 is not expressed in CR postnatally, by immunohistochemistry. 2) Confirm the identity of local GABAergic neurons that provide these inputs to CR cells to regulate CR activity, via EM evidence for GABAergic synapses on postnatal CR as they undergo cell death (this can be done with or without associated immunohistochemistry). 3) Output from CR cells: Provide evidence for direct connections between CR cells onto L2/L3 projections neurons, with optogenetic approaches (e.g., introducing CHR2 in CR neurons and recording L2/3 neurons. 4) Further experimental analyses on the molecular mechanisms connecting neuronal activity and apoptosis requiring controlled activation of CR cells (e.g. via optogenetics, as above) and subsequent analysis of the expression profile of death and/or survival factors in single cells undergoing apoptosis. This would admittedly be a very challenging and beyond the scope of this study. Reviewer #2: Using mouse lines targeting CRs from different lineages and conditional genetic hyperpolarization, the authors demonstrate that apoptosis of SE-derived CRs – but not of hem-derived CRs – is prevented upon membrane hyperpolarization. It has been recently shown that SE-derived CRs, but not hem-derived CRs, undergo a Bax-dependent apoptosis. Using conditional inactivation of Bax, the authors further demonstrate that the SE-derived CRs rescued upon hyperpolarization stay embedded in the cortical network. Finally, the authors demonstrate that the rescued, electrically active CRs – but not the rescued, hyperpolarized CRs – promote dendritic complexity in LII-III pyramidal neurons, thus leading to an increased E/I ratio. Altogether, the generated data are innovative and highly interesting. Reviewer #3: Programmed cell death of Cajal-Retzius neurons (CR) regulates cortical circuit assembly and authors provide important new data to support this idea. CR neurons are diverse and authors used two Cre lines to study two distinct subpopulations of CR (ΔNp73-CRs and Wnt3a-derived hem-CRs). Theses Cre-driver lines are well-characterized and allow a precise cellular dissection of the developmental process of postnatal programmed cell death. Previous work from the group has revealed that ΔNp73-CRs (but not Wnt3a-derived CRs) are eliminated postnatally via Bax-dependent death. Authors follow-up on this seminal observation and provide new convincing data showing that intrinsic neuronal excitability regulates the process of CR programmed cell death. More specifically they nicely show that the density of ΔNp73-CRs is increased postnatally by selectively hyperpolarizing these cells through Kir2.1 overexpression. Following this key finding, authors provide electrophysiological data to demonstrate that ΔNp73-CRs overexpressing Kir2.1 (ΔNp73cre/+;R26Kir2.1/+) are functionally integrated in cortical circuits. Interestingly spontaneous (sPSCs) and evoked postsynaptic currents (ePSCs) observed in ΔNp73cre/+;R26Kir2.1/+ were found to be abolished by GABA-AR antagonist application, thus suggesting that GABAergic inputs are important regulators of CR neuron activity. Finally authors convincingly show that aberrant CR neuron survival affects the dendritic morphology, spine density and electrophysiological properties of L2/3 pyramidal cells. Overall, this study provides important new insights on the role of a subset of CR in the postnatal maturation of cortical circuits and show that the synaptic activity of pyramidal neurons is dependent on the intrinsic activity of rescued CRs. My questions are mainly centered on input-output connectivity of CR neurons. Spontaneous and evoked postsynaptic currents were abolished by GABA-AR antagonist in the ΔNp73cre/+;R26Kir2.1, thus suggesting that GABAergic synaptic inputs are likely to be important regulators of the activity of postnatal CR cells. What is the possible identity of local GABAergic neurons that provide these inputs to CR cells ? Are they located in deep cortical layers (Martinotti SST+ INs ?) or locally in L1 ? This is a difficult question to address given the high diversity of GABergic interneurons. Authors could comment on this point. GABA is depolarizing in CR cells due to NKCC1 expression and absence of KCC2 expression. Has KCC2 expression been assessed postnatally during the critical period of CR cell death ? Regarding GABAergic inputs to CR: is there evidence at the EM level for GABAergic synapses on postnatal CR as they undergo cell death ? Have authors tried to find direct evidence for GABAA receptor-mediated depolarization in CR cells? CR cells abnormally rescued from cell death affect the morphology/connectivity of L2/L3 projections neurons. Using optogenetic approaches (e.g. introducing CHR2 in CR neurons and recording L2/3 neurons), is there evidence for a direct connectivity of CR cells onto L2/L3 projections neurons ? Reviewer #4: Riva et al. investigated the mechanisms underlying cell death in Cajal-Retzius (CR) neurons and the role of CR cell death in circuit formation. They found that CR cell death was regulated by neuronal activity. Furthermore, they found that elimination of CR neurons regulated the morphology and functional properties of cortical neurons. Although their data is convincing and potentially interesting, novel mechanistic insights were limited, and therefore I must say that, unfortunately, their data did not provide sufficient conceptional advances. 1) The authors showed that apoptosis of ΔNp73-CR was suppressed by Kir2.1-induced hyperpolarization. The molecular mechanisms connecting neuronal activity and apoptosis are missing. Although the authors discussed a potential hypothesis, it would be much more exciting if the authors could show some experimental data supporting their hypothesis. 2) The authors demonstrated that ΔNp73Cre/+;Baxlox/lox, rather than ΔNp73Cre/+;R26Kir2.1/+, affected dendritic development, spine densities and EPSC. These are interesting observations, but the authors had already reported consistent results in their previous report (Neuron, 92, 435-448, 2016). I am afraid to say that their new data were not novel enough. If the authors could uncover some of the mechanisms of how CR neurons affect various aspects of cortical neurons, this paper would be much more attractive. We are grateful to the reviewers and editors for their constructive feedback on our Short Report. While most of them highlighted the interest and novelty of our work, they also raised some concerns that we have addressed by performing additional experiments now included in an entirely novel figure (Figure 2—figure supplement 1) and Figures 1, Figure 1—figure supplement 1, Figure 3—figure supplement 1 and Figure 4—figure supplement 1. These data confirm i) low KCC2 expression in these cells and ii) the presence of GABAergic inputs both electrophysiologically and by immunohistochemistry onto genetically labeled CRs at the time of death and iii) provide evidence of lack of direct connections of CRs onto nearby neurons using optogenetics. We have modified the text accordingly in Results and Discussion and stressed the novelty of our findings. Please find below point-by-point answers and revisions. “Your comments are well supported, and we look forward to seeing a revision addressing the 1) KCC2 IHC 2) GABA inputs to CR 3) and CR inputs to PNs. We understand that you have tried to demonstrate a direct synaptic contact between CRPNs but were unsuccessful. Although the data are negative, the reviewers welcome the inclusion of these data as a figure supplement.” We are grateful to reviewers and the editor for their constructive feedback. We provide a revised version of our manuscript in which we address the three main points raised by the reviewers. We have performed KCC2 immunostainings (presented in novel Figure 2—figure supplement 1) that highlight the low to undetectable expression level of the protein in CRs, identified by the ΔNp73cre line. As the patchy nature of the staining precludes quantification, we have further included non-CR cells labelled by this line in the hypothalamus for comparison. Together with previous publications examining RNA levels (Achilles et al., 2007; Pozas et al., 2008), our additional experiment confirms that CRs express undetectable protein levels of KCC2. Regarding GABAergic inputs to CRs, we have performed two sets of experiments that are both presented in Figure 2—figure supplement 1. On the one hand, we have characterized by whole cell recording at P9-P11 the synaptic inputs onto genetically labeled CRs and showed that both spontaneous and evoked post-synaptic currents are solely mediated by GABAA receptors. On the other hand, we have performed immunohistochemistry with pre (GAD65/65) and post-synaptic markers (Gephryn) to visualize GABAergic synapses onto CRs. Taken together, these experiments highlight that during the time period of massive cell death (P9-P11), CRs receive exclusively GABAergic synaptic inputs. Finally, and as discussed with the reviewers, we present in Figure 4—figure supplement 1 our attempts to identify CR outputs. We have generated ΔNp73mutant mice, as proposed by the reviewers. While we could establish an efficient protocol to stimulate CRs with light, as assessed by their recording, we were struck by the limited number of these cells compared to the density of pyramidal cells. We therefore decided to record local field potentials close to the light stimulation site to test whether the photoactivation of CRs was able to induce any effect on neuronal networks. In other experiments, we also patched nearby Layer I interneurons while simultaneously recording the extracellular activity with a second pipette during light train stimulations. Unfortunately, we never detected a light-evoked response in any of these experiments, even in the presence of 0 mM Mg2+, 3 mM Ca2+ and 50 µM 4AP, a treatment that renders neurons more excitable. These findings are consistent with experiments performed in the hippocampus using ChR2 activation and paired-recordings (Quattrocolo and Maccaferri, 2014; Anstötz et al., 2016), where CRs are still present in high density during the first three postnatal weeks and only very few pyramidal cells could be detected as direct output of CRs. Although these results do not entirely preclude that cortical CRs contact Layer II/III neurons through bona fide synapses, they reveal that it is an extremely difficult point to assess. For these reasons, we decided not to pursue these experiments, but include them in Figure 4—figure supplement 1 and discuss their implications in the report as requested by the reviewers. Collectively, we believe that our additional experiments significantly reinforce our claims, by providing a compelling framework on how activity might eliminate specific subpopulations of CRs and how they could impinge onto cortical development. We have also significantly rewritten the manuscript as suggested by reviewers and addressed their specific comments as detailed below. Reviewer #3: […] My questions are mainly centered on input-output connectivity of CR neurons. Spontaneous and evoked postsynaptic currents were abolished by GABA-AR antagonist in the ΔNp73cre/+;R26Kir2.1, thus suggesting that GABAergic synaptic inputs are likely to be important reglators of the activity of postnatal CR cells. What is the possible identity of local GABAergic neurons that provide these inputs to CR cells ? Are they located in deep cortical layers (Martinotti SST+ INs ?) or locally in L1? This is a difficult question to address given the high diversity of GABergic interneurons. Authors could comment on this point. GABA is depolarizing in CR cells due to NKCC1 expression and absence of KCC2 expression. Has KCC2 expression been assessed postnatally during the critical period of CR cell death ? Regarding GABAergic inputs to CR: is there evidence at the EM level for GABAergic synapses on postnatal CR as they undergo cell death ? Have authors tried to find direct evidence for GABAA receptor-mediated depolarization in CR cells? CR cells abnormally rescued from cell death affect the morphology/connectivity of L2/L3 projections neurons. Using optogenetic approaches (e.g. introducing CHR2 in CR neurons and recording L2/3 neurons), is there evidence for a direct connectivity of CR cells onto L2/L3 projections neurons ? We have addressed the main points raised by reviewer 3 by adding the novel experiments now presented in Figures 2—figure supplement 1 and Figure 4—figure supplement 1. Reviewer #4: Riva et al. investigated the mechanisms underlying cell death in Cajal-Retzius (CR) neurons and the role of CR cell death in circuit formation. They found that CR cell death was regulated by neuronal activity. Furthermore, they found that elimination of CR neurons regulated the morphology and functional properties of cortical neurons. Although their data is convincing and potentially interesting, novel mechanistic insights were limited, and therefore I must say that, unfortunately, their data did not provide sufficient conceptional advances. 1) The authors showed that apoptosis of deltaNp73-CR was suppressed by Kir2.1-induced hyperpolarization. The molecular mechanisms connecting neuronal activity and apoptosis are missing. Although the authors discussed a potential hypothesis, it would be much more exciting if the authors could show some experimental data supporting their hypothesis. While we fully agree with reviewer 4 on the importance of identifying the molecular link between neuronal activity and apoptosis, we also believe that this lies outside of the scope of our short report and deserves a full independent study on the topic. 2) The authors demonstrated that deltaNp73Cre/+;Bax lox/lox, rather than deltaNp73Cre/+;R26Kir2.1/+, affected dendritic development, spine densities and EPSC. These are interesting observations, but the authors had already reported consistent results in their previous report (Neuron, 92, 435-448, 2016). I am afraid to say that their new data were not novel enough. If the authors could uncover some of the mechanisms of how CR neurons affect various aspects of cortical neurons, this paper would be much more attractive. We are grateful to reviewer 4 for pointing out that our initial submission could have stressed more the novelty of our findings. We previously showed that a reduced density of CRs during normal development alters spine densities and EPSC (De Frutos et al., 2016). Our current study addressed the mechanisms controlling the demise of CRs, as well as the impact of abnormal survival of these cells. Not only do we show that the death of a specific population of CRs receiving solely GABAergic inputs is activity-dependent, we furthermore demonstrate that the aberrant survival of such a minor population of active transient neurons is sufficient to drive an imbalance of the excitatory entries on pyramidal neurons. These findings have major implications on the activity-dependent mechanisms controlling cortical wiring in health and disease. We have now stressed the novelty of our findings throughout the Results and Discussion section.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain Mus musculus (males and female)C57BL6JJanvier
Mus musculus (males and female)ΔNp73CreIRESGFPTissir et al., 2009ΔNp73Cre
Mus musculus (males and female)Wnt3aCreYoshida et al., 2006Wnt3aCre
Mus musculus (males and female)TauloxP-stop-loxP-MARCKSeGFP-IRES-nlslacZHippenmeyer et al., 2005TauGFP
Mus musculus (males and female)Baxtm2Sjk;Bak1tm1Thsn/JTakeuchi et al., 2005Baxlox/lox
Mus musculus (males and female)ROSA26loxP-stop-loxP-TomatoMadisen et al., 2010R26mT
Mus musculus (males and female)ROSA26 loxP-stop-loxP- Kcnj2-cherry/+Moreno-Juan et al., 2017R26Kir2.1/+
Mus musculus (males and female)Ai32(RCL-ChR2(H134R)/EYFPhttps://www.jax.org/strain/012569ChR2lox
Antibodyrabbit polyclonal anti-DsRedTakaraRRID:AB_10013483IF(1:500)
Antibodymouse monoclonal anti-ReelinMerck MilliporeRRID:AB_565117IF(1:300)
Antibodymouse monoclonal anti-GephyrinSynaptic systemsRRID:AB_2619837IF(1:250)
Antibodyrabbit polyclonal anti-GAD65/67MerckRRID: AB_22 78725IF(1:250)
Antibodyguinea-pig anti-KCC2D Ng and S Morton TM Jessell’s labIF(1:4000)
Antibodydonkey anti-mouse Alexa-488Jackson ImmunoResearch LaboratoriesRRID:AB_2340846IF(1:800)
Antibodydonkey anti-rabbit Cy3Jackson ImmunoResearch LaboratoriesRRID:AB_2307443IF(1:800)
Antibodydonkey anti-rabbit Alexa-647Molecular ProbesRRID:AB_2536183IF(1:500)
Antibodydonkey anti-chick Alexa-488Jackson ImmunoResearch LaboratoriesRRID:AB_2340375IF(1:1000)
Antibodydonkey anti-mouse Alexa-555Molecular ProbesRRID:AB_2536180IF(1:1000)
Antibodygoat anti-guinea pig Alexa-555Molecular ProbesRRID:AB_2535856IF(1:1000)
AntibodyDAPI (4', 6-diamidino-2-phenylindole)Invitrogen Molecular ProbesRRID:AB_2629482IF(1:2000)
AntibodyDyLight 488 streptavidinVector LabsSP-4488
Sequence-based reagentCRE genotyping 188 f 167 rThis paperPCR primers188 f: TGA TGG ACA TGT TCA GGG ATC 167 r: GAA ATC AGT GCG TTC GAA CGC TAG A
Sequence-based reagentR26Kir2.1/+genotyping AAY101 AAY103 SD297PCR primersAAY101: AAAGTCGCTCTGAGTTGTTAT (Rosa26 forward WT) AAY103: GGGAGCGGGAGAAATGGATATG (Rosa26 reverse WT) SD297: GGCCATTTACCGTAAGTTATG (CAG promoter reverse)
Chemical compound, drugParaformaldehydeSigma-AldrichCAT:P6148
Chemical compound, drugTriton 100XEurobioCAT:GAUTTR00-07
Chemical compound, drugSR95531AbcamAb120042
Chemical compound, drug4-APSigma AldrichA-0152
Software, algorithmIMARIS software 8.4.IMARISRRID:SCR_007370
Software, algorithmGraphPad Prism 7.0GraphPad SoftwareRRID:SCR_000306
Software, algorithmImageJ/FIJINIHRRID:SCR_002285
Software, algorithmAdobe Photoshop CS6Adobe SystemsRRID:SCR_014199
Software, algorithmpClamp10.1Molecular DevicesRRID:SCR_011323
Software, algorithmIGOR Pro 6.0WavemetricsRRID:SCR_000325
Software, algorithmNeuroMaticWavemetricsRRID:SCR_004186
  50 in total

1.  A GABAergic projection from the zona incerta to cortex promotes cortical neuron development.

Authors:  Jiadong Chen; Arnold R Kriegstein
Journal:  Science       Date:  2015-10-01       Impact factor: 47.728

Review 2.  Cortical developmental death: selected to survive or fated to die.

Authors:  Frédéric Causeret; Eva Coppola; Alessandra Pierani
Journal:  Curr Opin Neurobiol       Date:  2018-05-05       Impact factor: 6.627

3.  Networks of coactive neurons in developing layer 1.

Authors:  T H Schwartz; D Rabinowitz; V Unni; V S Kumar; D K Smetters; A Tsiola; R Yuste
Journal:  Neuron       Date:  1998-03       Impact factor: 17.173

4.  Migration Speed of Cajal-Retzius Cells Modulated by Vesicular Trafficking Controls the Size of Higher-Order Cortical Areas.

Authors:  Melissa Barber; Yoko Arai; Yoshihiro Morishita; Lisa Vigier; Frédéric Causeret; Ugo Borello; Fanny Ledonne; Eva Coppola; Vincent Contremoulins; Frank W Pfrieger; Fadel Tissir; Subashika Govindan; Denis Jabaudon; Véronique Proux-Gillardeaux; Thierry Galli; Alessandra Pierani
Journal:  Curr Biol       Date:  2015-09-17       Impact factor: 10.834

5.  Kinetic properties of Cl uptake mediated by Na+-dependent K+-2Cl cotransport in immature rat neocortical neurons.

Authors:  Katharina Achilles; Akihito Okabe; Masahiko Ikeda; Chigusa Shimizu-Okabe; Junko Yamada; Atsuo Fukuda; Heiko J Luhmann; Werner Kilb
Journal:  J Neurosci       Date:  2007-08-08       Impact factor: 6.167

6.  DeltaNp73 regulates neuronal survival in vivo.

Authors:  Fadel Tissir; Aurélia Ravni; Younès Achouri; Dieter Riethmacher; Gundela Meyer; Andre M Goffinet
Journal:  Proc Natl Acad Sci U S A       Date:  2009-09-10       Impact factor: 11.205

Review 7.  Programmed cell death in animal development and disease.

Authors:  Yaron Fuchs; Hermann Steller
Journal:  Cell       Date:  2011-11-11       Impact factor: 41.582

8.  Morphology, input-output relations and synaptic connectivity of Cajal-Retzius cells in layer 1 of the developing neocortex of CXCR4-EGFP mice.

Authors:  Max Anstötz; Kathleen E Cosgrove; Iris Hack; Enrico Mugnaini; Gianmaria Maccaferri; Joachim H R Lübke
Journal:  Brain Struct Funct       Date:  2013-09-12       Impact factor: 3.270

9.  Cell Type-Specific Circuit Mapping Reveals the Presynaptic Connectivity of Developing Cortical Circuits.

Authors:  Laura A Cocas; Gloria Fernandez; Mariya Barch; Jason Doll; Ivan Zamora Diaz; Samuel J Pleasure
Journal:  J Neurosci       Date:  2016-03-16       Impact factor: 6.167

10.  Developmental Profile, Morphology, and Synaptic Connectivity of Cajal-Retzius Cells in the Postnatal Mouse Hippocampus.

Authors:  Max Anstötz; Hao Huang; Ivan Marchionni; Iris Haumann; Gianmaria Maccaferri; Joachim H R Lübke
Journal:  Cereb Cortex       Date:  2015-11-18       Impact factor: 5.357

View more
  8 in total

Review 1.  Transient cortical circuits match spontaneous and sensory-driven activity during development.

Authors:  Zoltán Molnár; Heiko J Luhmann; Patrick O Kanold
Journal:  Science       Date:  2020-10-16       Impact factor: 47.728

2.  Involvement of Mechanical Cues in the Migration of Cajal-Retzius Cells in the Marginal Zone During Neocortical Development.

Authors:  Ana López-Mengual; Miriam Segura-Feliu; Raimon Sunyer; Héctor Sanz-Fraile; Jorge Otero; Francina Mesquida-Veny; Vanessa Gil; Arnau Hervera; Isidre Ferrer; Jordi Soriano; Xavier Trepat; Ramon Farré; Daniel Navajas; José Antonio Del Río
Journal:  Front Cell Dev Biol       Date:  2022-05-16

Review 3.  Step by step: cells with multiple functions in cortical circuit assembly.

Authors:  Rosa Cossart; Sonia Garel
Journal:  Nat Rev Neurosci       Date:  2022-04-14       Impact factor: 38.755

4.  Glutamate released by Cajal-Retzius cells impacts specific hippocampal circuits and behaviors.

Authors:  Max Anstötz; Sun Kyong Lee; Gianmaria Maccaferri
Journal:  Cell Rep       Date:  2022-05-17       Impact factor: 9.995

Review 5.  Epigenetic and Transcriptional Regulation of Spontaneous and Sensory Activity Dependent Programs During Neuronal Circuit Development.

Authors:  Gabriele M Pumo; Taro Kitazawa; Filippo M Rijli
Journal:  Front Neural Circuits       Date:  2022-05-18       Impact factor: 3.342

6.  Dynamic interplay between thalamic activity and Cajal-Retzius cells regulates the wiring of cortical layer 1.

Authors:  Ioana Genescu; Mar Aníbal-Martínez; Vladimir Kouskoff; Nicolas Chenouard; Caroline Mailhes-Hamon; Hugues Cartonnet; Ludmilla Lokmane; Filippo M Rijli; Guillermina López-Bendito; Frédéric Gambino; Sonia Garel
Journal:  Cell Rep       Date:  2022-04-12       Impact factor: 9.995

7.  Heterogeneous nuclear ribonucleoprotein U (HNRNPU) safeguards the developing mouse cortex.

Authors:  Tamar Sapir; Aditya Kshirsagar; Anna Gorelik; Tsviya Olender; Ziv Porat; Ingrid E Scheffer; David B Goldstein; Orrin Devinsky; Orly Reiner
Journal:  Nat Commun       Date:  2022-07-21       Impact factor: 17.694

Review 8.  Neurophysiology of the Developing Cerebral Cortex: What We Have Learned and What We Need to Know.

Authors:  Heiko J Luhmann
Journal:  Front Cell Neurosci       Date:  2022-01-03       Impact factor: 5.505

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.