Ka-Lai Pang1, Sheng-Yu Guo1, I-An Chen1, Gäetan Burgaud2, Zhu-Hua Luo3, Hans U Dahms4, Jiang-Shiou Hwang1, Yi-Li Lin1, Jian-Shun Huang1, Tsz-Wai Ho5, Ling-Ming Tsang6, Michael Wai-Lun Chiang7, Hyo-Jung Cha1. 1. Institute of Marine Biology and Centre of Excellence of the Oceans, National Taiwan Ocean University, Keelung, Taiwan. 2. Laboratoire Universitaire de Biodiversité et Ecologie Microbienne, Université de Brest, Plouzané, France. 3. Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, Ministry of Natural Resources, Xiamen, China. 4. Department of Biomedical Science and Environment Biology, College of Life Science, Kaohsiung Medical University, Kaohsiung, Taiwan. 5. School of Biological Sciences, University of Western Australia, Perth, Australia. 6. School of Biological Sciences, Chinese University of Hong Kong, Kowloon Tong, Hong Kong SAR. 7. Department of Chemistry, City University of Hong Kong, Kowloon Tong, Hong Kong SAR.
Abstract
This paper reports the diversity of fungi associated with substrates collected at a shallow hydrothermal vent field at Kueishan Island, Taiwan, using both culture-based and metabarcoding methods. Culture of fungi from yellow sediment (with visible sulfur granules), black sediment (no visible sulfur granules), the vent crab Xenograpsus testudinatus, seawater and, animal egg samples resulted in a total of 94 isolates. Species identification based on the internal transcribed spacer regions of the rDNA revealed that the yellow sediment samples had the highest species richness with 25 species, followed by the black sediment (23) and the crab (13). The Ascomycota was dominant over the Basidiomycota; the dominant orders were Agaricales, Capnodiales, Eurotiales, Hypocreales, Pleosporales, Polyporales and Xylariales. Hortaea werneckii was the only common fungus isolated from the crab, seawater, yellow and black sediment samples. The metabarcoding analysis amplifying a small fragment of the rDNA (from 18S to 5.8S) recovered 7-27 species from the black sediment and 12-27 species from the yellow sediment samples and all species belonged to the Ascomycota and the Basidiomycota. In the yellow sediments, the dominant order was Pleosporales and this order was also dominant in the black sediment together with Sporidiobolales. Based on the results from both methods, 54 and 49 species were found in the black and yellow sediments, respectively. Overall, a higher proportion of Ascomycota (~70%) over Basidiomycota was recovered in the yellow sediment and the two phyla were equally abundant in the black sediment. The top five dominant fungal orders in descending order based on species richness were Pleosporales>Eurotiales>Polyporales>Hypocreales>Capnodiales in the black sediment samples, and Polyporales>Pleosporales>Eurotiales>Capnodiales>Hypocreales in the yellow sediment samples. This study is the first to observe a high diversity of fungi associated with various substrates at a marine shallow water hydrothermal vent ecosystem. While some fungi found in this study were terrestrial species and their airborne spores might have been deposited into the marine sediment, several pathogenic fungi of animals, including Acremonium spp., Aspergillus spp., Fusarium spp., Malassezia spp., Hortaea werneckii, Parengyodontium album, and Westerdykella dispersa, were recovered suggesting that these fungi may be able to cause diseases of marine animals.
This paper reports the diversity of fungi associated with substrates collected at a shallow hydrothermal vent field at Kueishan Island, Taiwan, using both culture-based and metabarcoding methods. Culture of fungi from yellow sediment (with visible sulfur granules), black sediment (no visible sulfur granules), the vent crabXenograpsus testudinatus, seawater and, animal egg samples resulted in a total of 94 isolates. Species identification based on the internal transcribed spacer regions of the rDNA revealed that the yellow sediment samples had the highest species richness with 25 species, followed by the black sediment (23) and the crab (13). The Ascomycota was dominant over the Basidiomycota; the dominant orders were Agaricales, Capnodiales, Eurotiales, Hypocreales, Pleosporales, Polyporales and Xylariales. Hortaea werneckii was the only common fungus isolated from the crab, seawater, yellow and black sediment samples. The metabarcoding analysis amplifying a small fragment of the rDNA (from 18S to 5.8S) recovered 7-27 species from the black sediment and 12-27 species from the yellow sediment samples and all species belonged to the Ascomycota and the Basidiomycota. In the yellow sediments, the dominant order was Pleosporales and this order was also dominant in the black sediment together with Sporidiobolales. Based on the results from both methods, 54 and 49 species were found in the black and yellow sediments, respectively. Overall, a higher proportion of Ascomycota (~70%) over Basidiomycota was recovered in the yellow sediment and the two phyla were equally abundant in the black sediment. The top five dominant fungal orders in descending order based on species richness were Pleosporales>Eurotiales>Polyporales>Hypocreales>Capnodiales in the black sediment samples, and Polyporales>Pleosporales>Eurotiales>Capnodiales>Hypocreales in the yellow sediment samples. This study is the first to observe a high diversity of fungi associated with various substrates at a marine shallow water hydrothermal vent ecosystem. While some fungi found in this study were terrestrial species and their airborne spores might have been deposited into the marine sediment, several pathogenic fungi of animals, including Acremonium spp., Aspergillus spp., Fusarium spp., Malassezia spp., Hortaea werneckii, Parengyodontium album, and Westerdykella dispersa, were recovered suggesting that these fungi may be able to cause diseases of marine animals.
Numerous studies have highlighted diverse marine fungi with important ecological roles such as commensals or pathogens of marine animals including corals [1] and sponges [2,3], trophic linkers between phytoplankton and zooplankton [4], or even nutrient recyclers. A relatively small percentage of described fungal species appears to be associated with the marine environment with just 1255 species [5]. In terms of biomass, marine fungi (together with marine protists) have been recently estimated to represent ~3% of the ~550 Gt carbon on Earth [6]. However, these estimates may be greatly underestimated due to under-sampling of diverse marine habitats. Yet, marine fungi are not represented in ocean ecosystem models [7], despite growing evidence of diverse marine fungi in the ocean.The deep-sea (loosely defined as habitats below the epipelagic zone) represents the largest biome on Earth, representing more than 65% of the Earth’s surface and more than 95% of the global biosphere [8]. The deep-sea encompasses a huge variety of ecological niches characterized by site-specific physical and geochemical conditions [9]. Deep-sea microorganisms, depending on the habitat, thus face many challenges such as elevated hydrostatic pressures, extreme temperature gradients and variable sea salt concentrations [10]. The deep subseafloor together with different deep-sea hotspots of life such as deep-sea hydrothermal vents, deep-hypersaline anoxic basins or even cold seeps have recently been reported to host active fungal communities with different ecological roles including recycling of refractory organic matter or competition with prokaryotes [11-20]. Burgaud and Edgcomb [21] have recently summarized all studies dedicated to the analysis of fungal communities from deep-sea and deep subsurface habitats (including both sedimentary and oceanic crustal habitats) and highlighted that culture-based approaches used so far have allowed the isolation of >116 species, a large majority of them being ubiquitous and affiliated to 11 fungal classes, with Eurotiomycetes, Dothideomycetes, and Microbotryomycetes being the most abundant. A “core culturable fungal diversity” consisting of 14 filamentous fungi (Acremonium sp., Aspergillus glaucus (also known as Eurotium herbariorum), As. restrictus, As. sydowii, Aureobasidium pullulans, Cladosporium cladosporioides, Cl. sphaerospermum, Cordyceps confragosa (also known as Lecanicillium lecanii), Cyphellophora europaea, Exophiala dermatitidis, Exophiala sp., Penicillium chrysogenum, Pe. citrinum and Purpureocillium lilacinum) and 3 yeasts (Candida parapsilosis, Meyerozyma guilliermondii and Rhodotorula mucilaginosa) was also established. Contrasted results were obtained using molecular studies. Indeed, based on 12 different studies specifically targeting deep-sea fungi, the fungal diversity was shown to be dominated by the classes Sordariomycetes, Dothideomycetes, Eurotiomycetes, Agaricomycetes, Saccharomycetes and Leotiomycetes, with Aspergillus, Cryptococcus, Penicillium, Rhodotorula, Candida, Trichosporon, Cladosporium, Phoma, Exophiala, Fusarium and Malassezia as the 10 most represented genera. Some studies have also revealed basal fungal lineages in the deep-sea, such as the Chytridiomycota [22], and the Cryptomycota [23]. While species richness appears higher in deep-sea sediments compared to deep-sea vents, the uniqueness of these samples in terms of taxonomic composition appears higher in deep-sea vent samples, especially taking into account the recent description of new deep-sea hydrothermal vent species, for example Candida oceani [24] and Yamadazyma barbieri [25]. While deep-sea hydrothermal vents appear to be unique ecological niches for fungi, no in-depth investigation of fungal communities occurring in shallow hydrothermal vents has been processed so far, to the best of our knowledge.Kueishan Island, also known as Turtle Island, is a volcanic island lying just outside Yilan County, Taiwan (Fig 1). In the southern end of the island, there are roughly 50 hydrothermal vent systems, with depth ranging from 10 m to 80 m, constantly emitting hydrothermal fluids (fluid temperature between 48 °C and 116 °C) and volcanic gases composed of high levels of carbon dioxide and hydrogen sulfide [26,27]. Many macro-organisms have been reported near this shallow-water hydrothermal vent system including fishes, crabs, mussels, sea anemones, snails, sipunculid worms, algae and zooplankton [26, 28,29]. However, knowledge on marine microorganisms including bacteria, archaea, and fungi is deficient. Recently, Wang et al. [30], using the pyrosequencing of the 16S rRNA gene, found that the Epsilonproteobacteria such as Sulfurovum and Sulfurimonas dominated the bacterial community in sediment samples collected near the hydrothermal vents at Kueishan Island. Also, they detected the presence of chemoautotrophic carbon fixation genes by the Epsilonproteobacteria in the samples suggesting their possible participation in the reductive tricarboxylic acid and the Calvin-Benson-Bassham cycles in the primary production in this extreme habitat. Complex microbial communities are supposed to occur here with either chemoautotrophic and photoautotrophic primary producers along with heterotrophs, such as fungi. Recently, Jiang et al. [31] reported the isolation of Aspergillus spp. from sediment samples and the hydrothermal vent crabXenograpsus testudinatus at Kueishan Island, which can be seen as first hints of fungal presence in this habitat. Here, we report the first comprehensive study of the diversity of fungi on various substrates at Kueishan Island. The main objective was to investigate the diversity of fungi in sediment, seawater and organic matter collected near the hydrothermal vents using culture-based and metabarcoding approaches.
Fig 1
Shallow hydrothermal vent field at Kueishan Island, Yilan County, Taiwan.
Sample location: V = vent area, E = further away from vent, W = west of vent area.
Shallow hydrothermal vent field at Kueishan Island, Yilan County, Taiwan.
Sample location: V = vent area, E = further away from vent, W = west of vent area.
Materials and methods
Collection of samples
The location of the shallow hydrothermal vents at Kueishan Island, Yilan, Taiwan is shown in Fig 1. Samples were collected on five collection trips: 23/6/2015 (yellow (Location V, Fig 1) and black (Location W, Fig 1) sediment), 10/10/2015 (yellow sediment, seawater, the crab Xenograpsus testudinatus (Location V, Fig 1)), 22-23/08/2016 (yellow and black sediment, water, crabs (Location E, Fig 1)), 29-30/03/2017 (black sediment, water, crabs, animal eggs (Location V, Fig 1)) and 28/06/2017 (yellow sediment, crabs (Location V, Fig 1)). Visible sulfur granules were found in the yellow sediment samples (with a higher SO3 content) but not in the black sediment samples (with a lower SO3 content) [30]. The sediment, seawater, crab (collected by hands of divers) and animal egg samples were immediately transferred into 50-ml sterile universal bottles. No permit was required to collect the animal samples as the collection site is not a national park. The crab X. testudinatus is not an endangered/protected species in Taiwan. The samples were kept in an ice bucket and brought to the laboratory for fungal isolation and molecular analysis. For each of the twenty-two sediment subsamples (in universal bottles) collected on the five collection dates, half of the sediment was transferred aseptically to another sterile universal bottle and freeze-dried for DNA extraction while the other half was used for isolation. A summary of the samples used in the isolation of fungi and the metabarcoding analysis (those with positive results) is shown in Table 1.
Table 1
Samples used in the culture-based and metabarcoding analyses.
Sample code: Y = yellow sediment sample, B = black sediment sample, V = vent area, E = further away from vent, W = west of vent area, 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017.
Date of sampling
Culture-based
Metabarcoding (Sample name)
Yellow sediment
Black sediment
Crab
Animal egg
Seawater
Yellow sediment
Black sediment
23/6/2015
× (Y-V-15)
× (B-W-15)
10/10/2015
× (V)
× (V)
× (V)
22/08/2016
× (E)
× (B-E-16)
23/08/2016
× (V)
29/03/2017
× (V)
× (V)
× (B-V-17)
30/03/2017
× (V)
× (V)
28/06/2017
× (V)
× (V)
× (Y-V-17)
Samples used in the culture-based and metabarcoding analyses.
Sample code: Y = yellow sediment sample, B = black sediment sample, V = vent area, E = further away from vent, W = west of vent area, 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017.
Isolation
Different methods were used to isolate fungi from the seawater samples collected on different dates; undiluted/diluted or concentrated (by centrifugation and resuspension in a small volume of seawater) seawater was directly inoculated into one-fifth strength GYPS (0.8 g/L glucose, 0.8 g/L yeast extract, 0.4 g/L peptone, 1 L natural seawater)/CDS (Czapek-Dox prepared with natural seawater instead of distilled water) liquid/solid media supplemented with 0.5 g/L each of Penicillin G sodium salt and streptomycin sulfate.For the sediment samples, 1 g of sediment was directly inoculated into 50 mL GYPS and CDS liquid media supplemented with the antibiotics. The sediment samples were also serially diluted to 1×10−3 with 100 μL of each dilution plated on GYPS and CDS agar media supplemented with the antibiotics. For some of the sediment samples with a liquid portion (seawater), the liquid (100 μL) was directly plated on GYPS and CDS agar media with the antibiotics.The crab samples (all dead at the time of isolation) were crushed in sterile seawater with 1 g inoculated into 50 mL GYPS and CDS liquid media with the antibiotics. The crushed crab samples were serially diluted up to 1×10−3 with 100 μL of each dilution plated on GYPS and CDS seawater agar media supplemented with the antibiotics. The crabs were also cut in halves with each half inoculated into GYPS and CDS liquid media with the antibiotics. The animal egg samples (collected as one clump) were directly inoculated into 50 mL GYPS and CDS liquid media with the antibiotics.All inoculated samples were incubated at 25 °C for up to two weeks. Colonies appearing on the agar media were subcultured onto fresh GYPS agar plates as pure cultures. For the liquid media, 100 μL of the enrichments were streaked onto fresh GYPS agar plates and individual colonies growing from these plates after incubation were subcultured onto fresh GYPS agar plates as pure cultures. Visible colonies that appeared floating on top of the liquid media were also subcultured onto fresh GYPS agar plates. These pure cultures were subjected to a molecular identification based on sequencing of the internal transcribed spacer regions of rDNA including the 5.8S (ITS).
Identification of fungal cultures
Mycelia from 1-week old cultures were scraped from the agar plates and ground into fine powder in liquid nitrogen using a mortar and pestle. Genomic DNA was extracted using the DNeasy Plant DNA Extraction Kit (Qiagen) according to the manufacturer’s instructions. The primers ITS4 (5’–TCCTCCGCTTATTGATATGC–3’) and ITS5 (5’–GGAAGTAAAAGTCGTAACAAGG–3’), amplifying a region from 18S to 28S rDNA covering ITS1, ITS2, and 5.8S regions, were used for PCR [32]. PCR reactions were performed in 25 μL volumes containing ca. 20 ng DNA, 0.2 μM of each primer, 12.5 μL Gran Turismo PreMix (Ten Giga BioTech) and 1 μL of the extracted DNA. The amplification cycle consisted of an initial denaturation step of 95°C for 2 min, followed by 35 cycles of (a) denaturation (95°C for 30s), (b) annealing (54°C for 30s) and (c) elongation (72°C for 30s) and a final 10 min elongation step at 72°C. The PCR products were analyzed by agarose gel electrophoresis and sent to Genomics BioSci & Tech (New Taipei City, Taiwan) for sequencing using the same PCR primers. The sequences obtained were checked for ambiguity, assembled in MegaX [33] and submitted to the National Center for Biotechnology Information (NCBI) for a nucleotide BLAST search. The ITS sequences of the fungal isolates were deposited in NCBI with the accession numbers given in S1 Table.
Metabarcoding study
Total DNA was extracted from the freeze-dried sediment samples using Soil DNA Isolation Maxi Kits (Norgen Biotek) according to the manufacturer’s instructions. A nested PCR approach was used. The primers NSA3 and NLC2 [34] was used in the first round of PCR. One microliter from the first-round PCR products was used in the second round of PCR. The primers used in the second PCR were ITS1-F_KYO1 [35] and ITS2 [32] with adapter sequences added on the 5’ end of the primers. These primers were found to amplify sequences of the Ascomycota and the Basidiomycota [36].PCR reactions were performed in 25 μL volumes containing ca. 20 ng DNA, 0.2 μM of each primer, 12.5 μL Gran Turismo PreMix (Ten Giga BioTech) and 1 μL first-round PCR product. The amplification cycle consisted of an initial denaturation step of 95°C for 2 min followed by 35 cycles of (a) denaturation (95°C for 30s), (b) annealing (54°C for 30s) and (c) elongation (72°C for 30s) and a final 10 min elongation step at 72°C. Five PCR reactions were performed for each sample and pooled. The pooled sample was run on a 1% agarose gel, gel-purified using EasyPure PCR/Gel Extraction Kit (Bioman Scientific Co., Ltd.) and sent to Genomics BioSci & Tech (New Taipei City, Taiwan) for Illumina sequencing (MiSeq Reagent kit v3, 600 cycles). TruSeq DNA Nano (input 120 ng / PCR 5 cycles) was used for library preparation. Negative PCR controls (water controls) were run to detect contamination of the PCR ingredients.Most of the following bioinformatics processes were run in QIIME 1.9.0 [37]. The raw sequences were filtered with a phred score ≥Q29 (a base call accuracy of ≥99.87%). The raw reads were merged into single reads and adaptors, primers and barcode sequences were removed using QIIME with the script split_library.py [37]. Clustering was performed using uclust v1.2.22q [38] in QIIME [37]. The reads were processed with UCHIME [39] to remove chimeric sequences. Assigning Operation Taxonomic Units (OTUs) and taxonomic assignments were performed with an open-reference OTU picking approach against the UNITE database in QIIME [37]. A similarity threshold of 97% was adopted. Taxonomic assignment of representative OTUs was run at a 0.97 confidence threshold against the UNITE ITS1 database with UNITE 7.2 reference OTU database ("UNITE+INSD" dataset) using the assignTaxonomy method [40]. The raw reads were deposited in the SRA database with the accession number PRJNA574255.
Statistical analysis
Rarefaction and extrapolation sampling curves were computed and plotted to estimate sample completeness (sample coverage) in R package iNEXT (iNterpolation/EXTrapolation) with the 95% lower and upper confidence limits for the isolation and metabarcoding data [41]. Principle component analysis (PCA) was used to analyze trends in fungal species composition (based on OTU and percentage normalization of reads) of the sediments (black or yellow) collected from the three collection spots (vent region, east of Turtle Island, west of vent area, Fig 1) between 2015 and 2017 and calculated by R (version 3.6.1) using R studio [42] using package factoextra [43].Alpha (abundance) and beta (Bray-Curtis similarity) diversities were calculated in R package [42]. To investigate the relationship between species composition and sampling sites, i.e. differences in species composition are smaller for sites that are closer together than for sites that are further apart, a Mantel test (based on Pearson’s product-moment correlation coefficient) was conducted to test the null hypothesis that two matrices, spatial distance and ecological distance, are unrelated with alpha = 0.05 in R package [42].
Results
Culturable diversity of fungi
A total of 94 isolates was cultured from the crab Xenograpsus testudinatus, sediment, seawater and animal egg samples (S1 Table). These fungi were identified based on comparisons of their ITS sequences with those in the GenBank database. The identity of the fungi was referred in most cases to a species name and in some cases to a genus, based on the top BLAST results with the highest score, in terms of high query coverage (%) and identity (%). When the top BLAST results were unidentified/uncultured fungi, the next result with a name was used if the % query coverage and % identity were high (≥95%); if these figures were low, the identity was only referred to the family, order, class or phylum.Table 2 and Fig 2 summarize the fungal species richness obtained from the different samples. Sediment samples had the highest species richness: 25 species from the yellow sediment and 23 species from the black sediment. Thirteen species were isolated from the crab samples. Only two species each were isolated from the seawater and the animal egg samples. A higher proportion of the Ascomycota was isolated from the black sediment samples than the yellow sediment samples based on the total species richness (>70%, Fig 3a and 3d). At the class level, 5 different classes of fungi were isolated from the black and 6 from the yellow sediment samples (Fig 3b and 3e). At the order level, the fungi isolated from the yellow sediment could be referred to 11 different fungal orders, followed by black sediment (10), crabs (7), seawater (2) and animal egg (1) samples (Table 2, Fig 3c and 3f). Dominant orders based on species richness were Agaricales, Capnodiales, Eurotiales, Hypocreales, Pleosporales, Polyporales and Xylariales. Species of the Hypocreales were isolated from all types of samples (Table 2).
Table 2
List of fungal species from the culture-based study.
Fungal species isolated from crab, black sediment, yellow sediment, seawater and animal egg samples collected near/at the hydrothermal vents at Kueishan Island, Taiwan. Fungi isolated from more than one sample type are marked with an asterisk.
Crab
Black sediment
Yellow sediment
Seawater
Animal eggs
Ascomycota
Capnodiales
Capnodiales
Capnodiales
Capnodiales
Hypocreales
Hortaea werneckii*
Hortaea werneckii*
Fodinomyces uranophilus
Hortaea werneckii*
Cordyceps takaomontana
Eurotiales
Eurotiales
Hortaea werneckii*
Hypocreales
Fusarium sp.
Aspergillus sydowii
Aspergillus sp. 2
Eurotiales
Parengyodontium album*
Aspergillus terreus*
Aspergillus taichungensis
Aspergillus aculeatus
Aspergillus unguis
Aspergillus terreus*
Aspergillus terreus*
Penicillium citreosulfuratum
Penicillium citrinum
Penicillium oxalicum
Hypocreales
Glomerellales
Penicillium sp.
Hypocreales sp.
Gibellulopsis nigrescens
Penicillium sumatrense
Parengyodontium album*
Hypocreales
Hypocreales
Microascales
Parengyodontium album*
Acremonium brunnescens
Microascus brevicaulis
Trichoderma harzianum*
Acremonium citrinum
Saccharomycetales
Microascales
Acremonium felinum
Candida oceani
Microascales sp.
Trichoderma harzianum*
Xylariales
Pleosporales
Ophiostomatales
Hypoxylon monticulosum
Allophoma tropica
Sporothrix sp.
Peroneutypa scoparia*
Didymella sp./Phoma sp.
Pleosporales
Xylaria sp.
Leptosphaeria sp.
Curvularia clavata
Microsphaeropsis arundinis
Westerdykella dispersa*
Pleosporales sp.
Saccharomycetales
Westerdykella dispersa*
Meyerozyma guilliermondii
Sordariales
Xylariales
Chaetomium globosum
Peroneutypa scoparia*
Xylariales
Xylaria apiculata
Arthrinium arundinis
Xylaria curta
Arthrinium hydei
Incertae sedis
Incertae sedis
Ascomycetes sp.
Pezizomycotina sp.
Basidiomycota
Agaricales
Agaricales
Agaricales
Chondrostereum sp.*
Chondrostereum sp.*
Chondrostereum sp.*
Polyporales
Cystobasidiales
Bjerkandera adusta
Cystobasidium minutum
Cerrena sp.*
Hymenochaetales
Tropicoporus sp.
Polyporales
Cerrena sp.*
Earliella scabrosa
Porostereum sp.
Fig 2
Venn diagram.
The numbers represent fungal species richness within and between yellow sediment, black sediment, vent crab Xenograpsus testudinatus, animal egg and seawater samples. Sediment samples had the highest species richness. Hortaea werneckii was the only fungus isolated from four types of samples.
Fig 3
Diversity of fungi (based on percentage of species richness) in the black and yellow sediment samples.
Classification at phylum, class and order levels using culture-based (Culture) and metabarcoding (HTS) approaches. Total combines the results from both methods. Diversity of fungi at the phylum, class and order levels was different depending on the methods (Culture/HTS) and sample types (yellow/black sediment).
Venn diagram.
The numbers represent fungal species richness within and between yellow sediment, black sediment, vent crabXenograpsus testudinatus, animal egg and seawater samples. Sediment samples had the highest species richness. Hortaea werneckii was the only fungus isolated from four types of samples.
Diversity of fungi (based on percentage of species richness) in the black and yellow sediment samples.
Classification at phylum, class and order levels using culture-based (Culture) and metabarcoding (HTS) approaches. Total combines the results from both methods. Diversity of fungi at the phylum, class and order levels was different depending on the methods (Culture/HTS) and sample types (yellow/black sediment).
List of fungal species from the culture-based study.
Fungal species isolated from crab, black sediment, yellow sediment, seawater and animal egg samples collected near/at the hydrothermal vents at Kueishan Island, Taiwan. Fungi isolated from more than one sample type are marked with an asterisk.Concerning the common fungal species between the different sample types, Hortaea werneckii was the only fungus isolated from four types of samples, i.e. crab, seawater, yellow and black sediment samples (Table 2). Parengyodontium album was isolated from the crab, black sediment and seawater samples. Two species were common between the crab, yellow and black sediment samples (Aspergillus terreus, Chondrostereum sp.). One common species was isolated from the crabs and the yellow sediment (Peroneutypa scoparia). Three other species were isolated from both the black and yellow sediments (Cerrena sp., Trichoderma harzianum, Westerdykella dispersa).
Metabarcoding analysis of sediments
No PCR products were obtained from the negative PCR controls (water controls). Twenty-two sediment subsamples from the five collection trips were subjected to DNA extraction and the PCR. Positive PCR products were obtained from only 13 sediment subsamples (4 yellow and 9 black sediment subsamples) collected on 23/06/2015, 22-23/08/2016, 29/03/2017 and 28/06/2017 and subsequently sent for the high throughput sequencing. The average read lengths before quality trimming were 1 to 273 base pair (bp) and reads of 271–273 bp were used for the analyses. In S2 Table, the number of raw reads in the 13 subsamples ranged from 56,965 to 325,131. After removal of chimeric sequences and low quality reads, the number of clean reads in the 13 subsamples ranged from 15,211 to 113,956, with a total of 773,112 reads and an average of 59,470 reads per sample. Majority of the sequences from these samples was of a fungal origin; a low number of sequences (ranged from 41 to 294 reads) was classified as unassigned in 4 out of the 13 subsamples. The PCA analysis based on operational taxonomic units (OTU) and percentage normalization of reads shows that the first axis (PC1) described 16.8% of the variation in the species composition between sediment samples while the second axis (PC2) described 13.7% of the variation, giving a total of 30.5% of the variation in the dataset (Fig 4). From the score plot, sediment samples with a similar species composition clustered together. Generally, there was a gradient of species composition along PC2 axis, decreased from the black sediment samples collected at site W (west of vent area) to site V (vent area), and to site E (further away from vent). PC1 axis contributed significantly to one of the two black sediment samples at site E (B16-b). If the outliner B16-b was removed from the analysis, both PC1 and PC2 contributed significantly to the other black sediment sample at site E (B16-a) (results not shown). Overall, yellow sediment samples of the vent area had the lowest species composition in both PCA1 and PCA2 when compared with other sediment samples (black sediments, regardless of sites).
Fig 4
Principle component analysis (PCA) of the 13 sediment subsamples analyzed with metabarcoding data.
Sample code: V = vent area, E = further away from vent, W = west of vent area; B = black sediment sample, Y = yellow sediment sample; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017; a-e = subsample number. The first axis (PC1) described 16.8% of the variation in the species composition between sediment samples while the second axis (PC2) described 13.7% of the variation, giving a total of 30.5% of the variation in the dataset.
Principle component analysis (PCA) of the 13 sediment subsamples analyzed with metabarcoding data.
Sample code: V = vent area, E = further away from vent, W = west of vent area; B = black sediment sample, Y = yellow sediment sample; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017; a-e = subsample number. The first axis (PC1) described 16.8% of the variation in the species composition between sediment samples while the second axis (PC2) described 13.7% of the variation, giving a total of 30.5% of the variation in the dataset.Reads from the 13 subsamples were combined and referred to 5 samples based on the date of collection and sample type. The rarefaction analysis shown in Fig 5 reveals that species diversity had reached saturation for all 5 samples. Fig 6 is a heatmap showing the Bray-Curtis distances between the five sediment samples (beta diversity). The samples of the same type (black, yellow sediment) and collected on the same dates did not group together.
Fig 5
Rarefaction analysis of the five sediment samples based on sequence reads.
Sample code: B = black sediment sample, Y = yellow sediment sample; V = vent area, E = further away from vent, W = west of vent area; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017. Species diversity of all samples had reached saturation.
Fig 6
Heatmap of the Bray-Curtis distances between the five sediment samples (beta diversity).
Heatmap depicting the relative abundance of the 30 most abundant taxa of each samples using Bray-Curtis dissimilarity. Each row in the heatmap represents a specific sample and each column represents a taxon. Colors represent the scaled relative abundance of taxa with light yellow indicating low abundance of that taxon and red as the most abundant. The degree of similarity of mycobiota is represented by the dendrogram on the x-axis and the degree of similarity of samples is shown by the dendrogram on the y-axis. The samples of the same type (black, yellow sediment) and collected on the same dates did not group together. Sample code: B = black sediment sample, Y = yellow sediment sample; V = vent area, E = further away from vent, W = west of vent area; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017.
Rarefaction analysis of the five sediment samples based on sequence reads.
Sample code: B = black sediment sample, Y = yellow sediment sample; V = vent area, E = further away from vent, W = west of vent area; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017. Species diversity of all samples had reached saturation.
Heatmap of the Bray-Curtis distances between the five sediment samples (beta diversity).
Heatmap depicting the relative abundance of the 30 most abundant taxa of each samples using Bray-Curtis dissimilarity. Each row in the heatmap represents a specific sample and each column represents a taxon. Colors represent the scaled relative abundance of taxa with light yellow indicating low abundance of that taxon and red as the most abundant. The degree of similarity of mycobiota is represented by the dendrogram on the x-axis and the degree of similarity of samples is shown by the dendrogram on the y-axis. The samples of the same type (black, yellow sediment) and collected on the same dates did not group together. Sample code: B = black sediment sample, Y = yellow sediment sample; V = vent area, E = further away from vent, W = west of vent area; 15 = collected in 2015, 16 = collected in 2016, 17 = collected in 2017.The Mantel test revealed that there was a low correlation among the spatial distance and the ecological distance with negatively association (r = -0.1098) (results not shown). Species composition and sampling sites were concluded to be unrelated (p = 0.55).Excluding the sequences belonging to the Fungi/Unassigned category, species richness of fungi in the black sediment samples was in the range of 7–27 OTUs, in the yellow sediment samples in the range of 12–27 OTUs (species/taxa hereafter) (results not shown). In the black sediment samples, the Ascomycota and the Basidiomycota were equally abundant but the Ascomycota was dominant over the Basidiomycota in the yellow sediment samples (Fig 7a and 7d). At the class and order levels, the fungi were more diverse in the black sediments than the yellow sediments; 10 classes and 17 orders in the black sediments (Fig 7b and 7c) while only 7 classes and 12 orders in the yellow sediments (Fig 7e and 7f). In the yellow sediments, the dominant classes were the Dothideomycetes (56.18% in abundance) and Agaricomycetes (9.49%) while the other classes constituted only small fractions of the sequences (~1%) (Fig 7e). The dominant orders in the yellow sediments were Pleosporales (55.62%) and Polyporales (9.19%) and the rest took up only small percentages (Fig 7f). In the black sediments, the Dothideomycetes (13.09%), the Microbotryomycetes (10.90%) and the Agaricomycetes (7.19%) were the dominant classes (Fig 7b) and the Sporidiobolales (10.90%), the Pleosporales (10.31%) and the Chaetothyriales (4.11%) were the dominant orders (Fig 7c).
Fig 7
Diversity of fungi (percentage of reads) in the black (a-c) and yellow (d-f) sediment samples based on the metabarcoding analysis.
Diversity of fungi at phylum, class and order levels was different between the black and yellow sediment.
Diversity of fungi (percentage of reads) in the black (a-c) and yellow (d-f) sediment samples based on the metabarcoding analysis.
Diversity of fungi at phylum, class and order levels was different between the black and yellow sediment.
Total diversity of fungi in sediments
Fig 3 shows the diversity of fungi isolated from the black and yellow sediment samples at the phylum, class and order levels from the isolation and metabarcoding methods (excluding unidentified/unknown fungi) based on species richness. Generally, the Ascomycota was dominant over the Basidiomycota in the isolation approach (Fig 3a and 3d). More diverse classes and orders, on the other hand, were obtained from the metabarcoding method (Fig 3b, 3c, 3e and 3f). A comparison of the common species in the black and yellow sediments at the class, order and genus levels between the two methods is shown in Fig 8. A higher richness was found in the black sediment samples and in the metabarcoding analysis at the class, order and genus levels.
Fig 8
Fungal richness.
Comparison of fungal richness at class, order and genus levels in black and yellow sediment samples using culture-based method and metabarcoding analysis. A higher richness was found in the black sediment samples and in the metabarcoding analysis at the class, order and genus levels.
Fungal richness.
Comparison of fungal richness at class, order and genus levels in black and yellow sediment samples using culture-based method and metabarcoding analysis. A higher richness was found in the black sediment samples and in the metabarcoding analysis at the class, order and genus levels.Overall, the proportion of Ascomycota (~70%) to Basidiomycota in the black and yellow sediment samples was similar (Fig 3a and 3d). At the class level, the fungi in the black sediment samples could be referred to 10 different fungal classes and the dominant classes were Agaricomycetes (Basidiomycota), Dothideomycetes and Sordariomycetes (Ascomycota) (Fig 3b). These three classes among six other classes were also dominant in the yellow sediment samples (Fig 3e). Nineteen different fungal orders were discovered from the black sediment samples (Fig 3c) while sixteen from the yellow sediment samples (Fig 3f). The top five dominant fungal orders in descending order based on species richness were Pleosporales>Eurotiales>Polyporales>Hypocreales>Capnodiales in the black sediment samples, and Polyporales>Pleosporales>Eurotiales>Capnodiales>Hypocreales in the yellow sediment samples.Table 3 lists the species of fungi based on the results of the culture-based and the metabarcoding analyses of the black and yellow sediment samples, excluding those species only classified above the genus level. A total of 54 and 49 species were found in the black and yellow sediments, respectively, excluding the various unknown Aspergillus spp. in the black sediment. Twenty-eight species were common between the two sediment types. Species of Colletotrichum, Fusarium and Malassezia were only identified in the black sediment samples, while species of Acremonium and Xylaria only in the yellow sediment samples.
Table 3
List of fungal species in the sediment samples.
The list was constructed based on species from both culture-based and metabarcoding methods. Common species betwen both sediment types are marked with an asterisk.
Black sediment
Yellow sediment
Ascomycota
Capnodiales
Capnodiales
Cladosporium delicatulum*
Cladosporium delicatulum*
Cladosporium sphaerospermum*
Cladosporium sphaerospermum*
Cladosporium sp.*
Cladosporium sp.*
Hortaea werneckii*
Hortaea werneckii*
Chaetothyriales
Fodinomyces uranophilus
Exophiala xenobiotica*
Chaetothyriales
Dothideales
Capronia semi-immersa
Aureobasidium sp.*
Exophiala xenobiotica*
Eurotiales
Dothideales
Aspergillus penicillioides*
Aureobasidium sp.*
Aspergillus taichungensis
Eurotiales
Aspergillus terreus*
Aspergillus aculeatus
Aspergillus spp.
Aspergillus penicillioides*
Penicillium citrinum
Aspergillus terreus*
Glomerellales
Penicillium oxalicum
Colletotrichum brasiliense
Penicillium sumatrense
Colletotrichum gloeosporioides
Penicillium sp.
Gibellulopsis nigrescens
Hypocreales
Hypocreales
Acremonium brunnescens
Fusarium solani
Acremonium citrinum
Fusarium sp.
Acremonium felinum
Parengyodontium album
Acremonium polychromum
Simplicillium obclavatum
Trichoderma harzianum*
Trichoderma harzianum*
Trichoderma lixii*
Trichoderma lixii*
Ophiostomatales
Trichoderma sp.
Sporothrix sp.
Pleosporales
Pleosporales
Allophoma tropica
Curvularia clavata
Alternaria sp.
Preussia persica*
Didymella sp./Phoma sp.
Pyrenochaetopsis leptospora*
Leptosphaeria sp.
Pyrenochaetopsis sp.
Microsphaeropsis arundinis
Sclerostagonospora phragmiticola*
Preussia persica*
Westerdykella dispersa*
Pyrenochaetopsis leptospora*
Saccharomycetales
Roussoella solani
Meyerozyma guilliermondii
Sclerostagonospora ericae
Xylariales
Sclerostagonospora phragmiticola*
Arthrinium sp.*
Stagonospora neglecta
Hypoxylon monticulosum*
Westerdykella dispersa*
Nigrospora oryzae*
Sordariales
Peroneutypa scoparia
Chaetomium globosum
Xylaria apiculata
Xylariales
Xylaria curta
Arthrinium arundinis
Arthrinium hydei
Arthrinium sp.*
Hypoxylon monticulosum*
Nigrospora oryzae*
Basidiomycota
Agaricales
Agaricales
Chondrostereum sp.*
Chondrostereum sp.*
Coprinopsis urticicola
Psilocybe coprophila*
Psilocybe coprophila*
Psilocybe sp.*
Psilocybe inquilina
Cystobasidiales
Psilocybe sp.*
Cystobasidium minutum
Geminibasidiales
Geminibasidiales
Geminibasidium sp.*
Geminibasidium sp.*
Malasseziales
Hymenochaetales
Malassezia globosa
Tropicoporus sp.
Malassezia restricta
Polyporales
Polyporales
Bbjerkandera adusta*
Bjerkandera adusta*
Cerrena sp.*
Cerrena sp.*
Earliella scabrosa
Phanerochaete tuberculata
Phlebia chrysocreas*
Phlebia chrysocreas*
Porostereum sp.
Rigidoporus sp.*
Rigidoporus sp.*
Trametes cubensis*
Trametes cubensis*
Russulales
Russulales
Peniophora sp.*
Peniophora sp.*
Sporidiobolales
Sporidiobolales
Rhodotorula mucilaginosa*
Rhodotorula mucilaginosa*
List of fungal species in the sediment samples.
The list was constructed based on species from both culture-based and metabarcoding methods. Common species betwen both sediment types are marked with an asterisk.
Discussion
Environmental relevance of fungal isolates
The vent crabXenograpsus testudinatus, sediment (yellow and black), seawater and animal eggs were collected at/near the hydrothermal vent system of the Kueishan Island, Taiwan for the isolation of fungi. The sediment samples yielded the highest fungal richness, supporting recent studies revealing complex fungal communities associated with different marine sediments, either shallow [44,45] or deep [19,20]. Marine sediments seem to represent a reservoir of fungi, most of them being ubiquitous [46]. These results may also be linked to the fact that more sediment samples were collected than the other samples, i.e. crabs, seawater and animal eggs and consequently, more species were isolated from the sediment samples.Thirteen species in seven orders of fungi were isolated from the crab Xenograpsus testudinatus with Aspergillus as the most retrieved genus on the crab. The association between such fungi and the crab is unclear and an in-depth study is required to get insights into real or erratic association, e.g. by characterizing biofilm on carapace of the crab, by examining more crab samples at the same site to see whether fungi can lead to diseases (necrosis for example) or by examining the ability of fungi isolated on dead crabs to synthesize specific hydrolytic enzymes such as chitinases. It is also possible that the cultures isolated from the crabs (and the animal eggs) represented resting spores on the crab surface at the time of collection.Hortaea werneckii is likely to be a common fungus at/near the hydrothermal vent system at Kueishan Island as it was the only fungus cultured from the sediment, seawater and crab samples. Hortaea werneckii is possibly a marine fungus, although it was not listed as a marine species [47]. This species is halophilic [48] and has previously been reported from a hydrothermal vent at the Atlantic Ocean [14] and scuba diving equipment [49]. Hortaea werneckii was reported to cause tinea nigra in humans [50] and may occur as an opportunistic pathogenic fungus but whether this fungus can cause diseases of vent animals requires a thorough investigation.Seven common orders (Agaricales, Capnodiales, Eurotiales, Hypocreales, Pleosporales, Polyporales, and Xylariales) of fungi were isolated from the yellow and black sediments and six species (Aspergillus terreus, Cerrena sp., Chondrostereum sp., Hortaea werneckii, Trichoderma harzianum, Westerdykella dispersa) were cultured from both sample types. Fungi of the Agaricales, Capnodiales, Eurotiales, Hypocreales, and Polyporales are common in the marine environment, especially seawater and sediment [47]. The Xylariales has been isolated as endophytes of marine-adapted mangrove plants, seagrasses and macroalgae [51]. However, Peroneutypa scoparia of the Xylariales was reported to be an endophyte of plants and also a wood inhabitant [52] but it is unknown in the marine environment. No yeasts were isolated from the black sediment and only two marine yeast species, Cystobasidium minutum and Meyerozyma guilliermondii, were isolated from the yellow sediment. Yeasts are common in the marine environment, especially basidiomycetous yeasts [53] and the low number of yeasts isolated may be related to the isolation methods. Yeasts were covered by dense mycelia of filamentous fungi on the isolation plates which impeded their isolation. Sequences of the yeastsGeminibasidium sp. and Rhodotorula mucilaginosa recovered through the metabarcoding analysis confirm the presence of other yeast species in both sediment types.
Molecular diversity of fungi
Ascomycota and Basidiomycota were the only phyla identified from sequences of the metabarcoding analysis. No basal fungal lineages, such as the Chytridiomycota and the Cryptomycota, were obtained, although such lineages are common in the marine environment [54]. This might be due to the primer bias towards the amplification of the Ascomycota and the Basidiomycota in the PCR reactions.The fungal communities of the five sediment samples analyzed through the metabarcoding analysis did not form separate clusters based on the date of collection and sample types, suggesting that no temporal variation or substrate-specificity seemed to occur. However, the whole picture (Fig 3) strongly highlights that each type of sediment harbors specific fungal communities.Over half of the total reads in the yellow sediment belonged to the Pleosporales (55.62%) of the Dothideomycetes (56.18%) due to the high number of reads belonging to Westerdykella dispersa (55.11%). The role of W. dispersa near the hydrothermal vent is unknown but this species was previously reported from the marine sediment of the South China Sea [55]. The proportion of the different dominant classes (Agaricomycetes, Microbotryomycetes, Dothideomycetes, ~10%) and orders (Sporidiobolales, Pleosporales, ~10%) in the black sediment was comparable.On the sediment samples in which both the isolation and metabarcoding methods were applied, no common species of fungi were recovered from both methods from the black sediment samples collected on 22/08/2016 and 29/03/2017 and the yellow sediment samples collected on 28/06/2017. Culture-dependent methods favor fast-growing fungi such as Asperigllus spp. and Penicillium spp. (Table 2), species that might not be dominant in the samples. The diverse classes and orders of fungi recovered from the metabarcoding method confirm the pitfalls of using isolation as the sole method to studying the diversity of fungi.
Ecology of fungi
Based on the results from the metabarcoding analysis and the culture-based approach, the number of fungal species from the yellow (49) and black (54) sediments was comparable. Among these fungi, the majority have been classified as terrestrial taxa while a few can be recognized as marine [47] (Table 3). Several species found in this study are common species of the deep-sea, including Penicillium citrinum, Meyerozyma guilliermondii and Rhodotorula mucilaginosa [21]. Species richness of the Ascomycota was higher than the Basidiomycota, supporting the results of other studies highlighting the dominance of ascomycetes in the marine environment. Majority of the fungi isolated from animal, sediment, rock and seawater samples collected at various deep sea hydrothermal vent sites in the Pacific and Atlantic Oceans belonged to Coniochaetales, Hypocreales, Helotiales, Chaetothyriales and Eurotiales of the Ascomycota while only one basidiomycete was obtained [13]. On sulfide and black smoker samples collected at a deep-sea hydrothermal vent site located near the Mid-Atlantic Ridge of the South Atlantic Ocean, 129 isolates belonging to the Ascomycota (Cladosporium, Phoma, Phialemonium, Stachybotrys, Penicillium, Aspergillus, Phialophora, Botryotinia, Meyerozyma, unclassified Hypocreales and unclassified Xylariaceae) and 32 isolates to the Basidiomycota (Rhodotorula, Tilletiopsis and Sporobolomyces) were isolated [55]. However, basidiomycetous yeasts (e.g. Cryptococcus, Rhodosporidium, Rhodotorula) were found predominantly on Fe-oxide mats and basalt rock surfaces at the active volcano, Vailulu’u seamount, Samoa [56]. The Chytridiomycota was not recovered in this study by both culture and metabarcoding methods but sequences of this phylum were obtained from animal and rock samples of deep-sea hydrothermal vents at the East Pacific Rise and the Mid-Atlantic Ridge using PCR-cloning-sequencing analysis [22].The dominant classes (i.e. Agaricomycetes, Dothideomycetes and Sordariomycetes) and orders (i.e. Capnodiales, Eurotiales, Hypocreales, Pleosporales, Polyporales, Xylariales) in both the yellow and black sediment types were similar. Most marine Pleosporales are intertidal mangrove species [47, 57,58]. As discussed above, basidiomycetous yeasts are common in the marine environment but not many filamentous basidiomycetes are known in the marine environment [47] and it may be related to salinity sensitivity [59]. Occurrence of filamentous basidiomycetes in this report and in other studies may suggest that spores of the terrestrial Polyporales (e.g. Bjerkandera adusta, Cerrena sp., Phanerochaete tuberculate, Phlebia chrysocreas, Rigidoporus sp., Trametes cubensis and T. versicolor) and Agaricales (e.g. Chondrostereum sp. and Schizophyllum commune) deposit in the marine sediment [19,20]. Kueishan Island is only ~10 km away from the main Taiwan Island and it is likely that spores of the filamentous basidiomycetes were originated from the terrestrial environment through freshwater runoff or air deposition [60] and deposited into the sediment. Four species are described in Chondrostereum and C. purpureum can cause the silverleaf disease, which causes the death of plants and its spores are dispersed by air [61]. Fröhlich-Nowoisky et al. [60] examined the diversity of fungi in continental, coastal and marine air; the Basidiomycota constituted 41% and 28% of the total fungal propagules in coastal and marine air, respectively and the dominant class was Agaricomycetes in both air types. It is likely that spores of the Agaricomycetes settle into the ocean and eventually sink to the seabed but they play no role in the sediment. The shallow nature of the Kueishan Island vent field and its close proximity to land strongly support the idea of terrestrial spore/hyphae dissemination from land to the marine environment. Although speculative, such preliminary results pave the road for a complementary fungal-focused metatranscriptomic approach to delve deeper into marine fungal functions at the mRNA expression level. In the same study [60], the Ascomycota belonging to the Dothideomycetes, Eurotiomycetes, Leotiomycetes and Sordariomycetes was dominant in the coastal and marine air and it may also explain the dominance of the Dothideomycetes, Eurotiomycetes, and Sordariomycetes in the sediment.Species of Colletotrichum, Fusarium and Malassezia were only identified in the black sediment samples, the same is true for species of Acremonium and Xylaria in the yellow sediment samples. Colletotrichum is a genus of common plant disease fungi including a range of agricultural plants and of endophytes of terrestrial plants [62]. Currently available evidence does not suggest Colletotrichum play a role in the marine sediment, same for Xylaria spp. Members of the genus Fusarium are also well known in terrestrial habitats as common soil fungi or plant pathogens. However, some Fusarium species have true roles in the marine environment; for example F. oxysporum has been reported to associate to marine mammals like dolphins and whales [63], causing dermatitis and systemic lesions sometimes leading to mortalities, and also known as a denitrifying species in oxygen-depleted regions in the marine environment [64]. Species of the genus Malassezia can cause skin diseases of human [65] and are among the most widespread fungi in the marine environment. DNA signatures of Malassezia and Malassezia-like sequences have been retrieved from numerous contrasted marine habitats, including sponges and deep-sea sediments [10]. The detection of DNA signatures of Malassezia in the black sediment at the hydrothermal vents of Kueishan Island is another proof of Malassezia occurrence in the marine environment. Complementary rRNA biosignatures have revealed metabolic activities of this genus in deep-sea sediments [15, 18]. Malassezia members may cause diseases of marine animals and represent a relevant target taxon to isolate into culture in the coming years to better assess their ecophysiological features.This study, as in a number of other studies on fungal diversity of marine sediment, recovered a number of fungal species with potential animal pathogenicity, including Acremonium spp., Aspergillus spp., Fusarium spp., Malassezia spp., Hortaea werneckii, Parengyodontium album, and Westerdykella dispersa. Whether Hortaea werneckii, P. album and W. dispersa [66-68] can cause diseases of the vent animals (i.e. the vent crabXenograpsus testudinatus) is unknown at Kueishan Island. More research is required to determine whether any of the fungi recovered from the marine sediment can cause diseases of bottom-dwelling animals and impact this specific food web.
Conclusions
Fungal diversity in shallow hydrothermal vent system is a gap of our knowledge of the marine mycota. This is the first study to report a high diversity of fungi (54 and 49 species of the Ascomycota and the Basidiomycota) in the black and yellow sediments collected at/near the shallow hydrothermal vent area of Kueishan Island by culture-based and metabarcoding methods. Some of the recovered fungi might be of a terrestrial origin while some may cause diseases of marine animals.
BLAST search results of the fungi isolated from sediment, seawater, the vent crab Xenograpsus testudinatus and animal egg samples collected at the shallow hydrothermal vent field, Kueishan Island, Taiwan.
(XLSX)Click here for additional data file.
Identification of reads/sequences from results of the metabarcoding analysis.
(XLSX)Click here for additional data file.21 Aug 2019PONE-D-19-20402Insights into fungal diversity of a shallow-water hydrothermal vent field at Kueishan Island, Taiwan by culturomics and metabarcoding analysisPLOS ONEDear Dr. Pang,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.==============================I received two reviews from experts in the field, and both reviewers agree that the work has value and will be a nice contribution to the literature. However, both reviewers also noted that the manuscript needs to be improved and elaborated prior to acceptance for publication. I am in agreement with them. As pointed out by reviewer #1, the manuscript would be stronger if there was connection to the environmental data. The amplicon data needs to be presented properly. I also highlighted a few area that requires clarity, discussion and revision (below). Also the statistical analysis, together with the amplicon data should be analyzed sufficiently. It is essential to deposit the raw reads in SRA. The manuscript would be improved if you pay attention to these recommendations.==============================We would appreciate receiving your revised manuscript by Oct 05 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Kin Ming TsuiAcademic EditorPLOS ONEJournal Requirements:1. When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.3. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set. PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field. Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data. For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing.Additional Editor Comments:line 215-216 - although the amplicons were sent to a commercial platform, it was essential to describe the library preparation method and the package for sequencing (e.g. Miseq V2 or V3). How many cycles of sequencing reaction?line 231-242 - the description of statistical analysis was inadequate and incomplete. Use R packages or other statistical software instead of MS Excel; Different analysis packages/tools should be used for culture-based and sequence based data. Have you estimated the alpha, beta diversity (similar to Bray-Curtis dissimilarity) for the amplicon data?line 295-296 - report the read and sequence information: read length before and after quality trimming; # of chimera reads; # of reads due to contamination (there was a negative control)line 296 - there was 10 fold difference in # of reads among samples; have you normalized the # of reads before the data analysis. Did you observe any changes in the communities with or without normalization of reads?Fig.4, line 440-444 - sample B15-b was an outlier. What could be the possible ecological factors or technical reasons? Another PCA diagram should be generated without B15-b to show the variation among other samples (The current Fig 4 was not acceptable). Otherwise the variations (temporal or substrate specificity) could be masked.Fig.6 - the samples were collected from 3 locations; How much observed variation among the communities was due to geographic factor? Mantel test or a correlation between community variation and geographic distance should be established.line 128, 438 - if the primers were biased towards the higher fungi and if the study did not aim at lower fungi, this should be mentioned in the introduction/ materials and methods.line 198-199 - the ITS sequences are deposited; however the raw reads also need to be deposited in the GenBank / SRA.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: NoReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: Pang et al. presented a study on the diversity of marine fungi at a shallow hydrothermal vent system, using both cultivation and metabarcoding methods. Their findings will make an important contribution to our knowledge about the biogeography of marine fungi, and should be of interest to microbial ecologists and marine biologists. However, there are several major issues that need to be addressed before it is suitable for publication. In sum I recommend a major revision.Major commentsThe fungal diversity reported from this shallow hydrothermal vent system is valuable, but the impact of the paper can be significantly elevated by simply incorporating relevant environmental parameters such as temperature, depth, oxygen concentration, sulphide concentration, sediment porosity, water turbidity, primary productivity, etc. Are any of these variables measured at the site at the time of sample collection? If not, is there any historic data reported in the literature that can be used for interpreting the fungal diversity?One major parameter that was repeatedly referred to in the manuscript is the sediment type (yellow vs. black). What caused the sediment to have different colors? How do the physical and chemical properties of the two types of sediments compare? Do they have the same porosity? What is the nutrient concentration in the sediment porewater? What is the depth of each sediment sampled? Similarly, what are the differences between the three sampling sites? Is the yellow sediment from location V the same as the yellow sediment in location E? The multiple locations of sampling are a strength of this study, and it will be of high interest for microbial ecologists to learn which factor played the most important role in determining the fungal community. Was it the sediment type or the physicalchemical variables associated with each location? Specifically, the authors can perform statistical tests to address this question.Moreover, the discussion of the manuscript is inadequate. Since other marine systems have been mentioned in the introduction, it is natural and necessary to compare the fungal diversity discovered at the shallow hydrothermal vent to other systems such as deep hydrothermal vents. At which location is fungal diversity higher? How important is depth and organic matter input in determining the diversity of marine fungi?The introduction in its current form requires major revision. The lengthy second paragraph of the introduction is a brief review of deep-sea fungi including those from deep-sea hydrothermal vents, which has little relevance to the current study. I suggest removing the majority of the contents from this paragraph and condense it to a summary of marine habitats where marine fungal diversity has been surveyed. At the end it should be pointed out that fungal diversity in shallow hydrothermal vent system is a gap in our knowledge.Additionally, the method and/or the result section needs to include a few key pieces of information. As for the metabarcoding analysis of sediments, how many reads were merged? How many reads can be classified as fungal? How many reads were classified as other known taxa? How many reads cannot be classified as any known taxa? What is the classification threshold? As for PCA, how were data transformed before ordination? What is the definition of species composition?The discussion section should include comparison with other studies on deep-sea hydrothermal vents as mentioned above, and a discussion on what environmental variables may have played a role in determining the fungal diversity. The current section “Putative ecological roles” is a misnomer because the majority of this section deals with either diversity alone or dispersal mechanisms. The section on Malassezia is really about its biogeography and not about its ecological roles. Therefore, I suggest restructuring the section into biogeography and dispersal mechanisms.Minor comments“taxa” (line 33) is a vague term and should be avoided when possible. In the manuscript, taxa refer to species/genus in most occasions, and should be revised accordingly.Line 64-65: it is misleading to state “especially in the deep sea”. I suggest removing this part.Line 135: (The section on Collection of Samples). Table 1 should include information about which site and which type of substrate was sampled for cultivation.Line 220: “paired” should be “merged”.Line 256: “taxa” should be “species”.Table 2: what does the asterisk sign mean? It needs to be explained in the caption.Figure 3: it needs to be specified which sub-figures are for cultivation results and which sub-figures are for metabarcoding results.Reviewer #2: This is nicely written paper on metabarcoding and culture based studies of shallow water hydrothermal vent field in Taiwan.1. Please don't use the term culturomics! I would use culture-based through out the manuscript instead.2. Additional coorections are annotated on the attached manuscript.3. Please include a summary or conclusion section at the end if possible.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: Culturomic and metabarcoding approaches.docx_Reviewer.docxClick here for additional data file.30 Oct 20194 October 2019Clement Kin-Ming TsuiAssociate EditorPLoS OneDear Dr. Tsui,We are submitting a revised manuscript entitled ‘Insights into fungal diversity of a shallow-water hydrothermal vent field at Kueishan Island, Taiwan by culture-based and metabarcoding analysis’. We have attended to all comments made by you and the reviewer and made corresponding changes to the manuscript. We have also reformat the manuscript based on the journal requirements. Here we list the response to the comments:Associate EditorComment 1: ‘line 215-216 - although the amplicons were sent to a commercial platform, it was essential to describe the library preparation method and the package for sequencing (e.g. Miseq V2 or V3). How many cycles of sequencing reaction?’Response: TruSeq DNA Nano (input 120 ng / PCR 5 cycles) was used for library preparation. Miseq v3 was used and 600 cycles was used in the sequencing reaction.Comment 2: ‘line 231-242 - the description of statistical analysis was inadequate and incomplete. Use R packages or other statistical software instead of MS Excel; Different analysis packages/tools should be used for culture-based and sequence based data. Have you estimated the alpha, beta diversity (similar to Bray-Curtis dissimilarity) for the amplicon data?’Response: Figure 6 has been replaced by a new figure showing a heatmap of the Bray-Curtis distances between the five sediment samples (beta diversity).Comment 3: ‘line 295-296 - report the read and sequence information: read length before and after quality trimming; # of chimera reads; # of reads due to contamination (there was a negative control)’Response: The average read lengths before quality trimming were 1 to 273 base pair (bp) and reads of 271-273 bp used for the analyses. Control PCRs (water control) were performed but no PCR products were obtained and therefore, these samples were not sequenced for comparison. These information is added to the new Supplementary Table 2 and the text.Comment 4: ‘line 296 - there was 10 fold difference in # of reads among samples; have you normalized the # of reads before the data analysis. Did you observe any changes in the communities with or without normalization of reads?’Response: We agree with the editor that normalization is required for the data due to the fold differences between samples. We have re-run the PCR analysis with percentage normalization and Figure 4 has been replaced.Comment 5: ‘Fig.4, line 440-444 - sample B15-b was an outlier. What could be the possible ecological factors or technical reasons? Another PCA diagram should be generated without B15-b to show the variation among other samples (The current Fig 4 was not acceptable). Otherwise the variations (temporal or substrate specificity) could be masked.’Response: The PCA was re-run with normalization of reads including the sample B15-b. B15-b clusters with other samples. The outlier is B16-b but only in PC1 which only constitutes 16.8% of the variation. Figure 4 has been replaced.Comment 6: ‘Fig.6 - the samples were collected from 3 locations; How much observed variation among the communities was due to geographic factor? Mantel test or a correlation between community variation and geographic distance should be established.’Response: A Mantel test was run and was found that there was a low correlation among the spatial distance and the ecological distance with negatively association (r = -0.1098). Species composition and sampling sites were concluded to be unrelated (p = 0.55). These information has been added to the text.Comment 7: ‘line 128, 438 - if the primers were biased towards the higher fungi and if the study did not aim at lower fungi, this should be mentioned in the introduction/ materials and methods.’Response: This has been added in the Materials and Methods and it reads ‘These primers were found to amplify sequences of the Ascomycota and the Basidiomycota.’Comment 8: ‘line 198-199 - the ITS sequences are deposited; however the raw reads also need to be deposited in the GenBank / SRA.’Response: The ITS sequences from the isolation study and the raw reads from the metabarcoding study have been deposited in GenBank/SRA and their accession numbers have been added to the manuscript.Reviewer 1Comment 9: ‘The fungal diversity reported from this shallow hydrothermal vent system is valuable, but the impact of the paper can be significantly elevated by simply incorporating relevant environmental parameters such as temperature, depth, oxygen concentration, sulphide concentration, sediment porosity, water turbidity, primary productivity, etc. Are any of these variables measured at the site at the time of sample collection? If not, is there any historic data reported in the literature that can be used for interpreting the fungal diversity? One major parameter that was repeatedly referred to in the manuscript is the sediment type (yellow vs. black). What caused the sediment to have different colors? How do the physical and chemical properties of the two types of sediments compare? Do they have the same porosity? What is the nutrient concentration in the sediment porewater? What is the depth of each sediment sampled? Similarly, what are the differences between the three sampling sites? Is the yellow sediment from location V the same as the yellow sediment in location E? The multiple locations of sampling are a strength of this study, and it will be of high interest for microbial ecologists to learn which factor played the most important role in determining the fungal community. Was it the sediment type or the physicalchemical variables associated with each location? Specifically, the authors can perform statistical tests to address this question.’Response: The characteristics of the sediment samples have been added in the text and it reads ‘Visible sulfur granules were found in the yellow sediment samples (with a higher SO3 content) but not in the black sediment samples (with a lower SO3 content).’ The depth of the sampling sites was also provided in Table 1. However, the other information regarding environmental variable and sample properties mentioned by the reviewer is not available from us or literature.Comment 10: ‘Moreover, the discussion of the manuscript is inadequate. Since other marine systems have been mentioned in the introduction, it is natural and necessary to compare the fungal diversity discovered at the shallow hydrothermal vent to other systems such as deep hydrothermal vents. At which location is fungal diversity higher? How important is depth and organic matter input in determining the diversity of marine fungi?’Response: A discussion between the results of this study and others from the deep-sea has been added. Most studies of fungal diversity of hydrothermal vent ecosystem are from the deep-sea and this, to our knowledge, is the first study of fungal diversity of a shallow hydrothermal vent ecosystem. More information on the latter is needed to make a comparison between the two types of hydrothermal vents. Currently, little information is available to relate depth and organic matter input on the diversity of marine fungi.Comment 11: ‘The introduction in its current form requires major revision. The lengthy second paragraph of the introduction is a brief review of deep-sea fungi including those from deep-sea hydrothermal vents, which has little relevance to the current study. I suggest removing the majority of the contents from this paragraph and condense it to a summary of marine habitats where marine fungal diversity has been surveyed. At the end it should be pointed out that fungal diversity in shallow hydrothermal vent system is a gap in our knowledge.’Response: The introduction has been reorganized as suggested by the reviewer. It now only summarizes brief results of fungal diversity from other deep-sea hydrothermal vent studies.Comment 12: ‘Additionally, the method and/or the result section needs to include a few key pieces of information. As for the metabarcoding analysis of sediments, how many reads were merged? How many reads can be classified as fungal? How many reads were classified as other known taxa? How many reads cannot be classified as any known taxa? What is the classification threshold? As for PCA, how were data transformed before ordination? What is the definition of species composition?’Response: Species composition includes both species richness and abundance of each species. For the PCA, the reads were transformed into % abundance (reads of each species over total reads � 100%) for each species. The number of removed reads, merged reads, fungal reads and reads classified as other known taxa are provided in Supplementary Table 2. These information has been added to the text.Comment 13: ‘The discussion section should include comparison with other studies on deep-sea hydrothermal vents as mentioned above, and a discussion on what environmental variables may have played a role in determining the fungal diversity. The current section “Putative ecological roles” is a misnomer because the majority of this section deals with either diversity alone or dispersal mechanisms. The section on Malassezia is really about its biogeography and not about its ecological roles. Therefore, I suggest restructuring the section into biogeography and dispersal mechanisms.’Response: The section title has been changed from ‘Putative ecological roles’ to ‘Ecology of fungi’. A discussion between the results of this study and others from the deep-sea has been added. Jones (2000) has reviewed the key factors (temperature, salinity, etc.) influencing diversity of marine fungi but concerned only those occurring on organic substrates (mainly wood) in coastal habitats.Comment 14: ‘“taxa” (line 33) is a vague term and should be avoided when possible. In the manuscript, taxa refer to species/genus in most occasions, and should be revised accordingly.’Response: The term ‘taxa’ has been changed to ‘species’ in most cases, but is kept where necessary.Comment 15: ‘Line 64-65: it is misleading to state “especially in the deep sea”. I suggest removing this part.’Response: This sentence has been modified and it reads ‘Yet, marine fungi are not represented in ocean ecosystem models [7], despite growing evidence of diverse marine fungi in the ocean.’Comment 16: ‘Line 135: (The section on Collection of Samples). Table 1 should include information about which site and which type of substrate was sampled for cultivation.’Response: These information is now available in Table 1.Comment 17: ‘Line 220: “paired” should be “merged”.’Response: This has been corrected.Comment 18: ‘Line 256: “taxa” should be “species”.’Response: This and others have been corrected.Comment 19: ‘Table 2: what does the asterisk sign mean? It needs to be explained in the caption.’Response: This is explained in the caption.Comment 20: ‘Figure 3: it needs to be specified which sub-figures are for cultivation results and which sub-figures are for metabarcoding results.’Response: These have already been specified in the y-axis and explained in the caption. No change is required.Reviewer 2Comment 21: ‘Please don't use the term culturomics! I would use culture-based through out the manuscript instead.’Response: This term has been changed throughout.Comment 22: ‘Additional coorections are annotated on the attached manuscript.’Response: These have been corrected.Comment 23: ‘Please include a summary or conclusion section at the end if possible.’Response: A conclusion section is added and it reads ‘Fungal diversity in shallow hydrothermal vent system is a gap of our knowledge of the marine mycota. In this study, 54 and 49 species of the Ascomycota and the Basidiomycota were found in the black and yellow sediments collected at/near the shallow hydrothermal vent area of Kueishan Island by culture-based and metabarcoding methods, suggesting a high diversity of fungi in this extreme environment.’Submitted filename: Response to Reviewers.docxClick here for additional data file.21 Nov 2019PONE-D-19-20402R1Insights into fungal diversity of a shallow-water hydrothermal vent field at Kueishan Island, Taiwan by culture-based and metabarcoding analysisPLOS ONEDear Dr. Pang,Thank you for submitting your manuscript to PLOS ONE. The authors have done a good job in addressing the majority of the comments from the reviewers and editor. I appreciate the effort that has been put into this. However, there are a few minor issues raised by both reviewers that I believe require clarification/revision prior to acceptance for publication. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Jan 05 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Kin Ming TsuiAcademic EditorPLOS ONEAdditional Editor Comments (if provided):What would happen when sample 16-b (in PCA1) was excluded from the analysis? Have you done the comparison?[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #2: All comments have been addressedReviewer #3: (No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #2: YesReviewer #3: Partly**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #2: YesReviewer #3: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #2: YesReviewer #3: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2: YesReviewer #3: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #2: In the abstract:1. The metabarcoding analysis amplifying a small fragment of the rDNA (from 18S to 5.8S) recovered 7-27 species from the black sediment and 12-27 species from the yellow sediment samples of the Ascomycota and the Basidiomycota.Add respectively at the end with a comma.2. In the abstract: One or two sentences to put results in a general context and broader perspective are missing.3. Line 284 One common species were should be "one common species was isolated.4. Figure legends are still not explaining the key results. Doing so will make the paper more interesting to the reader.5. Conclusion statement is weak, please strengthen it.Reviewer #3: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.Submitted filename: PONE-D-19-20402 review.docxClick here for additional data file.26 Nov 2019Editor’s Comments:Comment: ‘What would happen when sample 16-b (in PCA1) was excluded from the analysis? Have you done the comparison?’Response: We have actually done the analysis without B16-b (please check the attached response to reviewers file as the figure cannot be shown here) and both axes were found to contribute significant variations in the sample B16-a. These suggest the samples collected at Site E were with very different species composition. We have modified the text as ‘PC1 axis contributed significantly to one of the two black sediment samples at site E (B16-b). If the outliner B16-b was removed from the analysis, both PC1 and PC2 contributed significantly to the other black sediment sample at site E (B16-a) (results not shown).’Reviewer 1:Comment 1: ‘However, there is a methodological issue which needs to be highlighted in the paper. Ideally the crab and egg samples would have been surface-sterilised before being ground up for culturing and molecular analysis. The results are still interesting and worth reporting, but it is important to discuss the fact that the cultures and DNA from these samples may simply be from spores resting on the surface of the crabs.’Response: We agree with the reviewer. A sentence has been added in the discussion and it reads ‘It is also possible that the cultures isolated from the crabs (and the animal eggs) represented resting spores on the crab surface at the time of collection.’Comment 2: ‘The authors make a very valid point in the discussion about airborne spores being found when using the metabarcoding methods. This is a really important point which is often missed in metabarcoding studies. It would be good to mention this point in the abstract.’Response: A sentence has been added in the abstract and it reads ‘While some fungi found in this study were terrestrial species and their airborne spores might have been deposited into the marine sediment,…………’Comment 3: ‘Introduction First sentence is too long. Please break it up.’Response: The first sentence has been broken up into two sentences.Comment 4: ‘Please define "deep sea".’Response: The ‘deep-sea’ was loosely defined as ‘habitats below the epipelagic zone, (Herring 2001) and this has been added to the text.Comment 5: ‘Please define "deep subsurface". How far below surface?’Response: The deep subsurface habitats include both sedimentary and oceanic crustal habitats and this has been added to the text.Comment 6: ‘Lines 59 to 60: Change " fungal species appears associated to the marine environment with 1255 species recently documented from the ocean [5]." to "fungal species appear to be associated with the marine environment with just 1255 species...".’Response: This has been changed.Comment 7: ‘Line 71: Change "... depending on the habitat, are thus facing many..." to "... depending on the habitat, thus face many...’Response: This has been changed.Comment 8: ‘Line 72: Change "...gradients, variable sea salt..." to "gradients and variable sea salt..."’Response: This has been changed.Comment 9: ‘Line 97: The word "illustrated" here doesn't seem right. Perhaps just use "found".’Response: I cannot find the word ‘illustrated’ in the manuscript in Line 97.Comment 10: ‘Line 105: Change "...vents appear as unique..." to "...vents appear to be unique..."’Response: This has been changed.Comment 11: ‘Line 115: Change "28-29], however, knowledge..." to "28-29]. However, knowledge...".’Response: This has been changed.Comment 12: ‘Materials and methods: Ideally the crabs and eggs would have been surface sterilised before culturing and molecular analysis.’Response: See Comment 1.Comment 13: ‘Line 143: Were the universal bottles sterilised?’Response: Yes, the universal bottles were sterile. The word ‘sterile’ is added before universal bottles in the text.Comment 14: ‘Line 146-147: How were the samples divided? Was there any randomisation process? If so, then please add this.’Response: No randomisation process was performed. The text has been modified to clarify how the samples were divided and it reads ‘For each of the twenty-two sediment subsamples (in universal bottles) collected on the five collection dates, half of the sediment was transferred aseptically to another sterile universal bottle and freeze-dried for DNA extraction while the other half was used for isolation.’Comment 15: ‘Table 1: Ideally all samples that are to be compared would be collected on the same day.’Response: We agree with the reviewer on this. In fact, we have analysed twenty-two sediment subsamples in the metabarcoding analysis, but positive results were only obtained from 13 subsamples collected on the five collection dates. This is mentioned in the discussion.Comment 16: ‘Line 174: Why was 25 deg C chosen? How does this compare to the temperature where the samples were taken?’Response: From January 2014 to December 2017, the average water temperatures at Kueishan Island were between 20.2 °C and 29.4 °C. The use of 25 °C to incubate the inoculated samples was based on roughly the median of the lowest and highest average water temperatures.Comment 17: ‘Line 175: Change "appeared" to "appearing".’Response: This has been changed.Comment 18: ‘Line 184: Change "scrapped" to "scraped".’Response: ‘Scraped’ was used in the original text.Comment 19: ‘Line 203: Change "Maxi Kit" to "Maxi Kits".’Response: This has been changed.Comment 20: ‘Results: Line 285: Change "were" to "was"’Response: This has been changed.Comment 21: ‘Line 291: Change "subjected to the DNA..." to "subjected to DNA..."’Response: This has been changed.Comment 22: ‘Line 297: Change "operational taxonomic unit" to "operational taxonomic units".’Response: This has been changed.Comment 23: ‘Line 314: Change "based the" to "based on the".’Response: ‘based on the’ was used in the original text.Comment 24: ‘Discussions: Line 395: Change " associated to" to "associated with".’Response: ‘associated with’ was used in the original text.Comment 25: ‘Line 440: Change "Fungal community" to "Fungal communities".’Response: This has been changed.Comment 26: ‘Line 443: Change "habor" to "habors".’Response: This has been changed.Comment 27: ‘Line 463: Change "majority has been" to "majority have been".’Response: This has been changed.Comment 28: ‘Line 484 to 486: This is an interesting point. Please expand on this and provide references for the reader to follow up.’Response: We have elaborated on the topic and the text reads as ‘Occurrence of filamentous basidiomycetes in this report and in other studies may suggest that spores of the terrestrial Polyporales (e.g. Bjerkandera adusta, Cerrena sp., Phanerochaete tuberculate, Phlebia chrysocreas, Rigidoporus sp., Trametes cubensis and T. versicolor) and Agaricales (e.g. Chondrostereum sp. and Schizophyllum commune) deposit in the marine sediment [19�20]. Kueishan Island is only ~10 km away from the main Taiwan Island and it is likely that spores of the filamentous basidiomycetes were originated from the terrestrial environment through freshwater runoff or air deposition [61] and deposited into the sediment.’Reviewer 2:Comment 29: ‘In the abstract: 1. The metabarcoding analysis amplifying a small fragment of the rDNA (from 18S to 5.8S) recovered 7-27 species from the black sediment and 12-27 species from the yellow sediment samples of the Ascomycota and the Basidiomycota. Add respectively at the end with a comma.’Response: The meaning of the sentence is not clear as written. This has been rewritten as ‘The metabarcoding analysis amplifying a small fragment of the rDNA (from 18S to 5.8S) recovered 7-27 species from the black sediment and 12-27 species from the yellow sediment samples and all species belonged to the Ascomycota and the Basidiomycota.’Comment 30: ‘2. In the abstract: One or two sentences to put results in a general context and broader perspective are missing.’Response: An extra sentence has been added and it reads ‘This study is the first to observe a high diversity of fungi associated various substrates at a marine shallow water hydrothermal vent ecosystem.’Comment 31: ‘3. Line 284 One common species were should be "one common species was isolated.’Response: This has been changed.Comment 32: ‘4. Figure legends are still not explaining the key results. Doing so will make the paper more interesting to the reader.’Response: The figure legends have been elaborated.Comment 33: ‘5. Conclusion statement is weak, please strengthen it.’Response: The conclusion has been rewritten.Submitted filename: Response to Reviewers 26 Nov 2019.docxClick here for additional data file.4 Dec 2019Insights into fungal diversity of a shallow-water hydrothermal vent field at Kueishan Island, Taiwan by culture-based and metabarcoding analysisPONE-D-19-20402R2Dear Dr. Pang,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Kin Ming TsuiAcademic EditorPLOS ONEAdditional Editor Comments (optional):Thank you for the revision. The revised manuscript could be accepted for publication.Reviewers' comments:10 Dec 2019PONE-D-19-20402R2Insights into fungal diversity of a shallow-water hydrothermal vent field at Kueishan Island, Taiwan by culture-based and metabarcoding analysesDear Dr. Pang:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Kin Ming TsuiAcademic EditorPLOS ONE
Authors: Virginia P Edgcomb; David Beaudoin; Rebecca Gast; Jennifer F Biddle; Andreas Teske Journal: Environ Microbiol Date: 2011-01 Impact factor: 5.491
Authors: Thomas Le Calvez; Gaëtan Burgaud; Stéphane Mahé; Georges Barbier; Philippe Vandenkoornhuyse Journal: Appl Environ Microbiol Date: 2009-07-24 Impact factor: 4.792
Authors: Alexandra Z Worden; Michael J Follows; Stephen J Giovannoni; Susanne Wilken; Amy E Zimmerman; Patrick J Keeling Journal: Science Date: 2015-02-13 Impact factor: 47.728
Authors: S Suetrong; C L Schoch; J W Spatafora; J Kohlmeyer; B Volkmann-Kohlmeyer; J Sakayaroj; S Phongpaichit; K Tanaka; K Hirayama; E B G Jones Journal: Stud Mycol Date: 2009 Impact factor: 16.097
Authors: Alessia Marchetta; Bert Gerrits van den Ende; Abdullah M S Al-Hatmi; Ferry Hagen; Polona Zalar; Montarop Sudhadham; Nina Gunde-Cimerman; Clara Urzì; Sybren de Hoog; Filomena De Leo Journal: Life (Basel) Date: 2018-07-23
Authors: Ka-Lai Pang; Michael Wai-Lun Chiang; Sheng-Yu Guo; Chi-Yu Shih; Hans U Dahms; Jiang-Shiou Hwang; Hyo-Jung Cha Journal: PLoS One Date: 2020-05-26 Impact factor: 3.240
Authors: Gustavo A Ramírez; Paraskevi Mara; Taylor Sehein; Gunter Wegener; Christopher R Chambers; Samantha B Joye; Richard N Peterson; Aurélie Philippe; Gaëtan Burgaud; Virginia P Edgcomb; Andreas P Teske Journal: PLoS One Date: 2021-09-08 Impact factor: 3.240