Lihong Zheng1, Ruimei Jia2, Juan Zhao3. 1. Department of Anesthesiology, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, China (mainland). 2. Department of Pain Clinic, The First Affiliated Hospital Harbin Medical University, Harbin, Heilongjiang, China (mainland). 3. Department of Anesthesiology, Taixing People's Hospital, Taizhou, Jiangsu, China (mainland).
Abstract
BACKGROUND Dexmedetomidine (DMED) is widely used as an adjuvant anesthetic, but how DMED regulates biological behavior of OC cells remains an area of active research. This study investigated the mechanism by which DMED regulates the proliferation, apoptosis, migration, and invasion abilities of OC cells. MATERIAL AND METHODS We determined the optimal concentration of DMED for use in treating SKOV3 cells. The biological activities of DMED-treated SKOV3 cells following transfection with miR-155 inhibitor or si-HIF-1alpha were measured by CCK-8 assay, flow cytometry, wound healing assay, and Transwell assay. qRT-PCR and Western blot analysis were performed to assess the expression levels of apoptotic-related caspase-3 and Mcl-1. Luciferase reporter assay verified the targeting relationship of miR-155 and HIF-1alpha. RESULTS miR-155 was downregulated while HIF-1alpha was upregulated in SKOV3 cells. DMED dose-dependently reduced HIF-1alpha expression in SKOV3 cells, and upregulated the expression of miR-155. DMED inhibited the proliferation, migration and invasion abilities of OC cells, but also contributed to apoptosis of SKOV3 cells, while transfection of miR-155 inhibitor inhibited the effect of DMED on SKOV3 cells. In contrast, transfection with si-HIF-1alpha enhanced the effects of DMED on SKOV3 cells. HIF-1alpha was found to be a target gene of miR-155. CONCLUSIONS Our results suggest that DMED blocks cell proliferation, migration, and invasion and accelerates cell apoptosis in OC.
BACKGROUND Dexmedetomidine (DMED) is widely used as an adjuvant anesthetic, but how DMED regulates biological behavior of OC cells remains an area of active research. This study investigated the mechanism by which DMED regulates the proliferation, apoptosis, migration, and invasion abilities of OC cells. MATERIAL AND METHODS We determined the optimal concentration of DMED for use in treating SKOV3 cells. The biological activities of DMED-treated SKOV3 cells following transfection with miR-155 inhibitor or si-HIF-1alpha were measured by CCK-8 assay, flow cytometry, wound healing assay, and Transwell assay. qRT-PCR and Western blot analysis were performed to assess the expression levels of apoptotic-related caspase-3 and Mcl-1. Luciferase reporter assay verified the targeting relationship of miR-155 and HIF-1alpha. RESULTS miR-155 was downregulated while HIF-1alpha was upregulated in SKOV3 cells. DMED dose-dependently reduced HIF-1alpha expression in SKOV3 cells, and upregulated the expression of miR-155. DMED inhibited the proliferation, migration and invasion abilities of OC cells, but also contributed to apoptosis of SKOV3 cells, while transfection of miR-155 inhibitor inhibited the effect of DMED on SKOV3 cells. In contrast, transfection with si-HIF-1alpha enhanced the effects of DMED on SKOV3 cells. HIF-1alpha was found to be a target gene of miR-155. CONCLUSIONS Our results suggest that DMED blocks cell proliferation, migration, and invasion and accelerates cell apoptosis in OC.
Ovarian cancer (OC), which is the third most common cause of gynecologic malignancies, has the highest mortality rate among gynecologic malignancies [1,2]. The absence of distinctive symptoms and lack of effective and available screening approaches in clinical practice makes early diagnosis of OC difficult. Unfortunately, stage of diagnosis is a major factor that determinates the survival rate of OCpatients, and the average 5-year survival rate for OCpatients is only 44% [3,4]. Although chemotherapy in advanced OC can achieve similar therapeutic efficiency as surgery, radical resection remains the primary treatment approach for OC [5,6]. Noticeably, anesthetic drugs must be properly used during OC surgery to avoid adverse effects of anesthesia, such as respiratory depression and unstable vital signs [7]. Therefore, selection of anesthetic drugs essential for OC radical surgery.Dexmedetomidine (DMED) is a selective α2-adrenoreceptor agonist that is a novel adjuvant analgesic-sparing agent used for reducing stress and protecting the cardiovascular system [8]. DMED can lead to local vasoconstriction, thus decreasing the systemic absorption and contributing to the safety and efficacy of intraperitoneal administration of local anesthetics [9]. Following cesarean section births, use of DMED can increase the analgesia effect from local anesthetics and can decrease adverse reactions [10]. In an OCrat model, DMED was found to inhibit activation of chemotherapy resistance pathways, thus improving therapeutic efficiency in patients with OC [11].MicroRNAs (miRNAs) are mainly responsible for mediating the expression levels of many coding genes, consequently altering cellular pathways and thus affecting cell progression [12]. miR-155 can mediate DNA repair ability and sensitivity to ionizing radiation (IR) in triple-negative breast cancer [13]. Data also demonstrated that miR-155 can regulate cisplatin-induced apoptosis in OC by targeting X-linked inhibitor of apoptosis protein (XIAP), suggesting the protective role of miR-155 in OC progression by promoting cell apoptosis [14]. However, whether miR-155 can regulate cell activity in DMED-treated OC cells remains to be determined. In this report, we tested the hypothesis that HIF-1α is a target gene of miR-155. The miR-155-HIF-1α-HO-1 signaling pathway was reported to involved in DMED-regulated endotoxin-induced acute lung injury [15]. However, whether DMED can regulate the miR-155-HIF-1α-HO-1 signal pathway to affect the viability of OC cells remains an area of clinical uncertainty. In this regard, we hypothesize that DMED can regulate OC cell progression by the miR-155-HIF-1α axis. Therefore, this work was undertaken to analyze the mechanism by which DMED regulates the proliferation, apoptosis, migration, and invasion abilities of SKOV3 cells via the miR-155-HIF-1 axis.
Material and Methods
Cell culture
OC cells SKOV3 and ovarian epithelial cells HOSEpiC were purchased from American Type Culture Collection (ATCC, USA). Functionally, HOSEpiC cells were used as normal controls for OC cells. SKOV3 cells were cultured in RPMI-1640 culture medium (GIBCO, USA) containing 10% FBS and 1% double-antibody. The HOSEpiC cells were incubated in DMEM culture medium with 10% FBS and 1% double-antibody. The incubation of SKOV3 and HOSEpiC cells was performed at 37°C with 5% CO2. DMED was purchased from Shanghai Lianshuo Biological Company. DMED of different concentrations (0, 1, 10, and 100 nM) were added to culture medium of SKOV3 cells. After 24-h incubation, culture medium was refreshed.
Cell transfection
SKOV3 cells were transfected with miR-155 inhibitor, miR-155 inhibitor negative control, si-HIF-1α, and its relative negative control (GenePharma, Shanghai). Lipofectamine 2000 transfection reagent (Invitrogen, USA) was used for transfection in accordance with its transfection instructions. Transfection experiments were conducted in triplicate.
qRT-PCR
Total RNAs were extracted using Trizol (Invitrogen, USA). The qualified RNAs were diluted to appropriate concentrations for reverse transcription using a reverse transcription kit (TaKaRa, Japan). All operations were performed based on kit protocols. Real-time quantitative RT-PCR was performed with a LightCycler 480 (Roche, Switzerland) fluorescence quantitative PCR instrument. The reaction conditions were conducted using a fluorescent quantitative RT-PCR kit (SYBR Green PCR kit, Dongsheng Biology). The detailed conditions for PCR were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s, for a total of 40 cycles. Three replicates were set up. U6 was selected as the internal reference of miRNA, and GAPDH served as the internal reference of mRNA. The 2−ΔΔCt method was used to analyze data. The amplified primer sequences of each gene and its internal reference genes are detailed in Table 1.
Table 1
Primer sequences used for RT-PCR.
Name of primer
Sequences
miR-155-F
GCAGGGTCCGAGGTATTC
miR-155-R
GTGGGGATAGTGCTAATC
U6-F
CTCGCTTCGGCAGCACATATACT
U6-R
ACGCTTCACGAATTTGCGTGTC
HIF-1α-F
GTCTGTTGCTACAAGCCCCA
HIF-1α-R
TGGTAAGAAATTACGGGGGCA
Caspase-3-F
GGGGGATATCGCTGTCATGG
Caspase-3-R
CCGTACCAGAGCGAGATGAC
Mcl-1-F
GTTTTCAGCGACGGCGTAAC
Mcl-1-R
AAGGCAAACTTACCCAGCCT
GAPDH-F
GTGGCTGGCTCAGAAAAAGG
GAPDH-R
GGGGAGATTCAGTGTGGTGG
F – forward; R – reverse; RT-PCR – reverse transcript polymerase chain reaction.
Western blot analysis
Proteins were isolated and bathed in boiling water for 3 min for protein degeneration. The electrophoresis was conducted initially with 80 V for 30 min, and then 120 V for 1~2 h. The current of transfer membrane was 300 mA for 60 min. After membrane transfer, the membrane was rinsed in washing solution for 1~2 min, and then sealed with blocking buffer at room temperature for 60 min, or incubated overnight at 4°C. Primary antibodies of rabbit anti-humanGAPDH (5174T), HIF-1α (36169T), caspase-3 (9662S), Mcl-1(94296S), 1: 1000, Cell Signaling, Boston, USA) were added for incubation on a shaker at room temperature for 1 h. After that, the membrane was washed 3 times for 10 min each time. Then, the membrane was incubated with secondary antibodies (HRP-marked goat anti-rabbit IgG, 1: 5000, Beijing Kangwei Century Biology Co., Beijing, China) at room temperature for 1 h, followed by washing 3 times for 10 min each time. X-ray film was used for color pressing, developing, and fixing.
Luciferase reporter gene experiment
The online software TargetScan () was used to predict the binding sites of miR-155 and HIF-1α. According to the predicted results, wild and mutation sequences of binding sites were designed and synthesized, respectively (wt-HIF-1α and mut-HIF-1α). The wild sequence or mutation sequence on the binding site was inserted into the luciferase reporter gene vector (pGL3-Basic), and those 2 sequences were separately co-transfected with miR-155 mimic (30 nM, GenePharma) or miR-155 mimic negative control (30 nM, GenePharma) into HEK239T cells (Shanghai Sixin Biological Co.). After transfection, firefly luciferase activity and Renilla luciferase activity were detected in each group. Renilla luciferase activity was used as an internal reference, and the ratio of firefly luciferase activity to Renilla luciferase activity was regarded as the relative activity of luciferase. The experimental groups were named as follows: mimic NC+mut-HIF-1α group, mimic NC+wt-HIF-1α group, mimic+mut-HIF-1α group, and mimic+wt-HIF-1α group. Luciferase intensity was measured 3 times.
CCK-8 assay
DMED-treated SKOV3 cells and suspensions of transfected SKOV3 cells of each group were seeded into 96-well plates (about 2000 cells in each well) with 3 replicates for per group. After incubation in an incubator for 24 h, 48 h, 72 h, and 96 h, 10 μl of CCK-8 solution (Mosak Biology) was added to each well. Then, after incubation for another 1~4 h, the absorbance at 450 nm wavelength was measured.
Flow cytometry
The density of DMED-treated SKOV3 cells and suspensions of transfected SKOV3 cells of each group were adjusted to 105/ml. Then, 3 ml of cell suspension was collected from each group into a 10-ml centrifugal tube and centrifuged at 500 rpm for 5 min before the culture medium was discarded. The suspension was washed with PBS and centrifuged at 500 rpm for 5 min. Then, the supernatant was discarded. Cells were re-suspended in 100 μl of labeled solution and incubated for 10 min without light exposure. Annexin V-FITC (5 μl) and PI (5 μl) were added and gently mixed with cells for reaction for 10 min without light exposure. FITC fluorescence and PI fluorescence were measured using flow cytometry to analyze the apoptosis of SKOV3 cells. The migration ability of cells was measured 3 times.
Scratch test
DMED-treated SKOV3 cells and transfected SKOV3 cells in each group (2×106 per well) after transfection were inoculated into 6-well plates. The cells in each group were inoculated into 3 wells and then incubated at 37°C with 5% CO2 for 24 h until the cells formed a monolayer. Scratches were made on the monolayer cells with the tip of a pipette (sterile, 200 μl). Then, cells were washed with PBS before incubation at 37°C with 5% CO2 for 24 h. Scratch widths were observed and recorded under a microscope (200×) after culturing for 0 h and 24 h. Migration rates of OC cells were analyzed based on scratch area. Migration rate=(0 h scratch distance–24 h scratch distance)/0 h scratch distance.
Transwell
Matrigel matrix gel (50 μg/mL) was mixed with serum-free RPMI-1640 medium at a ratio of 1: 5. Mixed matrix glue (80 μL) was laid in a Transwell chamber with an 8-μm aperture and placed on 24-well plates at 37°C for 6 h to solidify the gel. OC cells in each group were collected after treatment for 48 h. Serum-free RPMI-1640 medium was applied to adjust the cell concentration of each group to 2×105/ml. We then added 200 μL of cell suspension to the upper chamber and we added 600 μL of RPMI-1640 medium with 1% low-serum to the lower chamber. After 24 h of incubation at 37°C and 5% CO2, the chamber was taken out. After PBS washing, methanol fixation and crystal violet staining, 5 visual fields were randomly selected under an inverted microscope to count cells. The number of cells passing through the Matrigel matrix gel was used to express the invasive ability of cells. Three multiple wells were set up in each experiment.
Statistical analysis
GraphPad software (version 7.0) was used for statistical analysis. All data are expressed as the mean value and standard deviation (χ̄±s). We used the t test to compare differences between 2 groups. One-way analysis of variance was used for comparison among groups. Dunnett’s multiple comparisons test was performed for the post hoc comparison/test. P<0.05 was regarded as having statistical significance.
Results
Decreased miR-155 and increased HIF-1α in OC cells
The expression levels of miR-155 and HIF-1α in OC cells and HOSEpiC cells were measured by qRT-PCR and Western blot analysis, showing that miR-155 in SKOV3 cells was clearly lower than in HOSEpiC cells (Figure 1A), but the mRNA and protein expression levels of HIF-1α in SKOV3 cell were obviously higher than in HOSEpiC cells (Figure 1B, 1C).
Figure 1
Decreased expression of miR-155 and elevated expression of HIF-1α in SKOV3 cells. (A) The expression of miR-155 in SKOV3 cells and HOSEpiC cells was determined by qRT-PCR. The expression of HIF-1α in SKOV3 cells and HOSEpiC cells by (B) qRT-PCR and (C) Western blot; ** P<0.01, *** P<0.001, compared to HOSEpiC group.
DMED regulates miR-155 and HIF-1α levels in OC cells
SKOV3 cells subjected to DMED treatment (with concentrations of 0, 1, 10, and 100 nM) had elevated expression of miR-155 (Figure 2A) and decreased expression of HIF-1α, and these differences were dose-dependent (Figure 2B, 2C). SKOV3 cells treated with 10 nM of DMED had substantially upregulated miR-155 and notably downregulated expression of HIF-1α. Therefore, 10 nM of DMED was selected for the following assays to explore the effects of DMED on OC biological behavior.
Figure 2
DMED upregulates miR-155 expression and downregulates HIF-1α expression. (A) The expression of miR-155 in DMED (0, 1, 10 and 100 nM) treated SKOV3 cells was detected by qRT-PCR; The mRNA and protein expression levels of HIF-1α in SKOV3 cells by (B) qRT-PCR and (C) Western blot; * P<0.05, ** P<0.01, compared to DMED 0 nM group; DMED – Dexmedetomidine.
DMED upregulates miR-155 to mediate proliferation, apoptosis, migration, and invasion of OC cells
Transfection with miR-155 inhibitor reduced miR-155 expression in SKOV3 cells, but its expression was upregulated after DMED treatment. SKOV3 cells subjected to miR-155 inhibitor transfection and DMED treatment had substantially decreased miR-155 expression compared with cells treated with DMED alone (Figure 3A). After transfection of miR-155 inhibitor, the proliferation (Figure 3B), migration (Figure 3F), and invasion abilities (Figure 3G) of SKOV3 cells were enhanced, while cell apoptosis (Figure 3C) was clearly suppressed, as evidenced by increased expression level of Mcl-1 and decreased expression level of caspase-3 (Figure 3D, 3E). However, the expression profile in DMED-treated SKOV3 cells was the opposite of cells transfected with miR-155 inhibitor. In cells subjected to DMED treatment and miR-155 inhibitor transfection, the effect of DMED on the proliferation, apoptosis, migration, and invasion of SKOV3 cells was offset by transfection of miR-155 inhibitor. These results demonstrate that DMED regulates OC cell progression by upregulating miR-155 expression.
Figure 3
DMED upregulates miR-155 to mediate cell proliferation, apoptosis, migration, and invasion of OC cells. (A) qRT-PCR was performed to detect miR-155 expression in SKOV3 cells; (B) CCK-8 assay was used to measure SKOV3 cell proliferation; (C) Cell apoptosis rate was observed under the application of flow cytometry. The expression of caspase-3 and Mcl-1 were determined by (D) qRT-PCR and (E) Western blot. Wound healing assay and Transwell were used to detect (F) cell migration and (G) Invasion ability. * P<0.05, ** P<0.01, *** P<0.001, compared with Blank group; #
P<0.05, ##
P<0.01, compared with DMED group; DMED – Dexmedetomidine.
HIF-1α is a target gene of miR-155
After transfection with si-HIF-1α, the expression of HIF-1α in SKOV3 cells was significantly decreased, while in SKOV3 cells transfected with miR-155 inhibitor, the expression of HIF-1α was notably increased (P<0.05) (Figure 4A, 4B). The binding site between miR-155 and HIF-1α is represented in Figure 4C. There was no difference of luciferase activity between the mimic NC+mut-HIF-1α group and mimic+mut-HIF-1α group, whereas luciferase activity in the mimic+wt-HIF-1α group was significantly reduced (mimic+wt-HIF-1α group vs. mimic NC+wt-HIF-1α group) (Figure 4D), suggesting that miR-155 can bind with HIF-1α.
Figure 4
HIF-1α was a target gene of miR-155. The expression of HIF-1α in SKOV3 cells was measured by (A) qRT-PCR and (B) Western blot; (C) The binding site between miR-155 and HIF-1α was on the 3′UTR; (D) The binding of miR-155 with HIF-1α was verified by luciferase reporter gene assay; * P<0.05, ** P<0.01, compared inhibitor NC group or mimic NC+wt-HIF-1α group; NC – negative control.
DMED regulates proliferation, apoptosis, migration, and invasion of OC cells via miR-155-HIF-1α axis
Transfection of si-HIF-1α in DMED-treated SKOV3 cells can inhibit cell proliferation (Figure 5A), migration (Figure 5E), and invasion (Figure 5F), and enhance cell apoptosis (Figure 5B), as shown by increased level of caspase-3 expression and underexpression of Mcl-1 (Figure 5C, 5D). These results suggest that HIF-1 deficiency further enhances the inhibitory effect of DMED on OC cells; therefore, DMED may inhibit OC progression through reducing HIF-1α expression. The biological activity of DMED-treated SKOV3 cells co-transfected with si-HIF-1α and miR-155 inhibitor showed a different expression pattern from that in DMED-treated SKOV3 cells transfected with si-HIF-1α, which suggests that miR-155 affects the biological behavior of OC cells via controlling and targeting HIF-1α, while DMED inhibits OC development via the miR-155-HIF-1 axis.
Figure 5
DMED regulates miR-155-HIF-1α axis to mediate cell proliferation, apoptosis, migration, and invasion of OC cells. (A) Cell proliferation was inspected by CCK-8 assay; (B) Cell apoptosis was determined with flow cytometry; (C, D) The mRNA and protein expression levels of caspase-3 and Mcl-1 were separately detected by qRT-PCR and Western blot; (E) Cell migration was detected by wound healing assay; (F) Cell invasion was determined using Transwell assay; * P<0.05, ** P<0.01, compared to DMED group; #
P<0.05, ##
P<0.01, compared to DMED+si-HIF-1α group; DMED – dexmedetomidine.
Discussion
To investigate the mechanism of DMED in the development of SKOV3 cells, the expression levels of miR-155 and HIF-1α in ovarian epithelial cells HOSEpiC and DMED-treated OC cells were first examined. Then, we knocked down miR-155 and HIF-1α expression levels to observe how miR-155 and HIF-1α suppression can regulate OC cell activity. Dual-luciferase reporter assay further identified the binding of miR-155 and HIF-1α. The results from this study support that DMED can inhibit the progression of OC cells by regulating the miR-155-HIF-1 axis.Although genetic factors and environmental factors are well-known risk factors for OC [1], the detailed biological mechanism of OC occurrence still remains unknown. The biological function of OC cells can be regulated by many miRNAs whose downregulation or overexpression has been detected in OC cells [16,17]. The first major finding in this study illustrated that miR-155 expression in SKOV3 cells was notably decreased, whereas the expression of HIF-1α behaved in the opposite fashion when compared with that in HOSEpiC cells. We speculate that the dysregulation of miR-155 and HIF-1α might be involved in OC development. Further, the expression of miR-155 in DMED-treated cells was detected, supporting the regulatory role of DMED in miR-155 expression. Inflammation after surgery can promote cancer progression and metastasis, and DMED can decrease the risk of surgery-related tumor metastasis through inhibiting inflammation and exerting a sedative function [18]. In addition, administration of DMED can provide clinical benefits in oxygenation and lung mechanics for patients complicated with lung cancer and chronic obstructive pulmonary disease [19], but whether DMED provides similar benefit for OCpatients remains to be explored. In this report, assessment of DMED-treated cell progression showed that DMED can hinder cell activity and potentiate cell apoptosis via the regulation of miR-155 expression. The role of miR-155 in tumors may vary in different contexts and it can either act as an oncomiR or an oncosuppressor miR [14]. Our study suggests that miR-155 plays an important role as a tumor suppressor miR. Elevated serum expression of miR-155 was detected in osteosarcoma, and miR-155 has the potential to predict relapse of breast cancer [20,21]. Furthermore, accumulating evidence has emerged regarding the dysregulation of miR-155 in development of breast cancer drug resistance [22]. Consistent with our study, miR-155 was reported to regulate cell growth and proliferation of melanoma cells and to serve as a tumor suppressor [23]. Furthermore, miR-155 was long ago found to be down-regulated in OC cells and had antiproliferative and proapoptotic activity in OC by targeting claudin-1 [24]. However, the role of miR-155 in DMED-treated OC cells has been unclear.This study also clarified that HIF-1α is a target gene of miR-155. This result is in agreement with the conclusion in a prior study that found certain miRNAs, such as miR-155, can control HIF-1α so as to form the HIF-1α-miR-155 pathway to maintain oxygen homeostasis [25]. Knockdown of HIF-1α enhances cisplatin resistance in OC cells, and the pathway underlying HIF-1α-adjusted tumor metabolism could be a new target for overcoming cisplatin resistance in OC [26]. Our study further offers important evidence supporting our hypothesis that HIF-1α is involved in OC. Therefore, we assessed the miR-155-HIF-1α pathway in therapy of OC. In the present work, transfection with miR-155 inhibitor inhibited the effects of DMED on the development of SKOV3 cells, while transfection with si-HIF-1α promoted the effects of DMED on proliferation, apoptosis, migration, and invasion abilities of SKOV3 cells. These experiments further verified that DMED directly regulates miR-155 and HIF-1α expression levels. It has become increasingly clear that DMED affects the progression of OC via the miR-155-HIF-1α pathway.
Conclusions
Taken together, our research provides ample evidence that DMED affects the development of OC cells via the miR-155-HIF-1α pathway. Our results show the distinctive role of DMED in controlling OC progression and may have the possibility to be widely used for OCpatients, possibly providing a new approach to treatment of OC. Considering the complicated biological mechanism and varied functions of DMED, further studies are required to better elucidate the roles of DMED in the biological behavior of OC cells.
Authors: Sean Kehoe; Jane Hook; Matthew Nankivell; Gordon C Jayson; Henry Kitchener; Tito Lopes; David Luesley; Timothy Perren; Selina Bannoo; Monica Mascarenhas; Stephen Dobbs; Sharadah Essapen; Jeremy Twigg; Jonathan Herod; Glenn McCluggage; Mahesh Parmar; Ann-Marie Swart Journal: Lancet Date: 2015-05-19 Impact factor: 79.321
Authors: Eleonora A Braga; Marina V Fridman; Alexey A Moscovtsev; Elena A Filippova; Alexey A Dmitriev; Nikolay E Kushlinskii Journal: Int J Mol Sci Date: 2020-11-23 Impact factor: 5.923