Literature DB >> 31867273

RORα Suppresses Epithelial-to-Mesenchymal Transition and Invasion in Human Gastric Cancer Cells via the Wnt/β-Catenin Pathway.

Jian Su1,2, Bo Su1,3, Hong Xia1,4, Fang Liu1,4, XiaoHong Zhao1,5, Juan Li1,6, JiZhen Zhang1,7, Ying Shi1,8, Ying Zeng1,4, Xi Zeng1,4, Hui Ling1,4, YouHua Wu4, Qi Su1,4.   

Abstract

Retinoid-related orphan receptor alpha (RORα) is involved in tumor development. However, the mechanisms underlying RORα inhibiting epithelial-to-mesenchymal transition (EMT) and invasion are poorly understood in gastric cancer (GC). This study revealed that the decreased expression of RORα is associated with GC development, progression, and prognosis. RORα suppressed cell proliferation, EMT, and invasion in GC cells through inhibition of the Wnt/β-catenin pathway. RORα overexpression resulted in the decreased Wnt1 expression and the increased RORα interaction with β-catenin, which could lead to the decreased intranuclear β-catenin and p-β-catenin levels, concomitant with downregulated T-cell factor-4 (TCF-4) expression and the promoter activity of c-Myc. The inhibition of Wnt/β-catenin pathway was coupled with the reduced expression of Axin, c-Myc, and c-Jun. RORα downregulated vimentin and Snail and upregulated E-cadherin protein levels in vitro and in vivo. Inversely, knockdown of RORα attenuated its inhibitory effects on Wnt/β-catenin pathway and its downstream gene expression, facilitating cell proliferation, EMT, migration, and invasion in GC cells. Therefore, RORα could play a crucial role in repressing GC cell proliferation, EMT, and invasion via downregulating Wnt/β-catenin pathway.
Copyright © 2019 Su, Su, Xia, Liu, Zhao, Li, Zhang, Shi, Zeng, Zeng, Ling, Wu and Su.

Entities:  

Keywords:  RORα; Wnt/β-catenin pathway; epithelial-to-mesenchymal transition; human gastric cancer; invasion; proliferation

Year:  2019        PMID: 31867273      PMCID: PMC6909819          DOI: 10.3389/fonc.2019.01344

Source DB:  PubMed          Journal:  Front Oncol        ISSN: 2234-943X            Impact factor:   6.244


Introduction

Gastric cancer (GC) is the fifth most common cancer and the third leading cause of death worldwide; an estimated 1,033,701 new GC cases and 782,685 deaths occurred in 2018 (1). The number of new cases and deaths from GC is 679,100 and 498,000, respectively, making GC the second most common cancer and the leading cause of cancer-related death in China in 2015 (2). Diagnosis is usually made after the disease reaches an advanced stage because early GC produces few symptoms. Therefore, most GC patients are diagnosed with advanced-stage disease and given a poor prognosis and the curative effect is not satisfactory, with median survival rarely exceeding 12 months and a 5-year survival of <10% (3). Therefore, there is an urgent need to identify novel diagnostic marker and therapeutic targets in GC. Retinoid-related orphan receptors (RORs; consisting of RORα, RORβ, and RORγ) are involved in many physiological processes, including regulation of metabolism, development, and immunity, as well as circadian rhythm (4–6). In addition, RORα plays critical roles in tumorigenesis (6). Integrated gene expression analysis has shown that RORα expression is obviously decreased in a wide variety of human malignancies (7). RORα is widely expressed in normal epithelial tissues and is often downregulated in many kinds of epithelium-derived tumors, such as breast cancer, GC, and liver cancer (8–10). Moreover, RORα can inhibit proliferation and invasion and induce apoptosis in various cancer cells. It is suggested that RORα may be a potent tumor suppressor and therapeutic target for cancer (8–12). Although RORα suppresses breast tumor invasion, whether RORα inhibits invasion in GC and the underlying mechanism are poorly understood. This study aimed to explore whether RORα suppresses epithelial-to-mesenchymal transition (EMT) and invasion in GC cells through inhibition of the Wnt/β-catenin signaling pathway.

Materials and Methods

Reagents and Antibodies

Primary antibodies against RORα (ab60134), E-cadherin (ab40772), vimentin (ab92547), Snail (ab53519), matrix metalloproteinase-9 (MMP-9) (ab38898), tissue inhibitor of metalloproteinase-3 (TIMP-3) (ab39184), Ki-67 (ab66155), and CD34 (ab81289) were provided by Abcam (Cambridge, MA, UK). Primary antibodies targeting β-catenin (sc-1496), p-β-catenin (sc-101650), Axin-1 (sc-14029), c-Jun (sc-44), c-Myc (sc-40), TCF-4 (sc-271287), and β-actin (sc-8432) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). HRP-conjugated secondary antibodies were provided by Abzoom (Dallas, TX, USA). Goat anti-rabbit IgG-HRP (KGAA35) and goat anti-mouse IgG-HRP (KGAA37) were provided by KeyGEN BioTECH Corp (Jiangsu, China). Goat anti-mouse IgG (H + L) was purchased from Protech Technology, Inc. (Rocky Hill, NJ, USA). pGL3-c-Myc promoter luciferase reporter plasmid was obtained from Guangzhou Cyagen Biosciences Inc.

Clinical Samples

A total of 140 surgically resected GC specimens, 64 cases of normal stomach mucosa, and 48 cases of precancerous lesion (including intestinal metaplasia and atypical hyperplasia) were collected from 2011 to 2014 at the Affiliated Hospital of University of South China. According to the research, three pieces of 10 × 10 chips were made. This study was approved by the research ethics committee of University of South China. The average follow-up was 47.45 months (6–96 months). All patients did not receive radiotherapy and chemotherapy.

Immunohistochemistry (IHC)

Briefly, after slides were dewaxed in xylene and hydrated in graded alcohol solutions, antigen retrieval was performed by heat treatment in 10 mM sodium citrate buffer (pH 8.0). Slides were incubated in 3% H2O2 solution to quench endogenous peroxidase activity and then incubated with normal goat serum for 20 min. Slides were incubated with primary antibodies (dilution 1:100) at 4°C overnight. Positive signals were developed with peroxidase-conjugated secondary antibodies and 0.5% diaminobenzidine/H2O2 followed by counterstaining with hematoxylin, dehydration, clearing, and mounting. The slides that were treated with normal goat serum were evaluated as negative controls. The intensities of positive staining were scored 0–4, according to the standards of 0–1 (no staining), 1–2 (weak staining), 2–3 (medium staining), and 3–4 (strong staining). The percentages of positively stained cells were analyzed. Those expression scores equaled to scores of the intensities × the percentages of positive cells. Those expression scores of ≥2 were defined as high expression; <2 was considered low expression.

Cell Culture and Cell Line Establishment

Human GC cell lines (MGC803, BGC823, SGC7901, MKN28) and gastric epithelial cell line (GES-1) was obtained from the Cancer Research Institute, Central South University in China. Cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (Life Technologies, Vienna, Austria) with the addition of 100 U/ml penicillin and 100 U/ml streptomycin and maintained at 37°C in a humidified atmosphere containing 5% CO2. To establish the stable RORα-interfering cell lines, four pcDNA™6.2-GW/EmGFPmiR RORα-microRNA-expressing and empty vector plasmids were constructed by Invitrogen Corporation. Sequences of DNA oligomers inserted into pcDNA™6.2-GW/EmGFPmiR were listed as follows: miR1: F: 5′-TGCTGTTTGATGGCACACAATTGCCAGTTTTGGCCACTGACTGACTGGC AATTGTGCCATCAAA-3′, R:5′-CCTGTTTGATGGCACAATTGCCAGTCAGTC AGTGGCCAAAACTGGCAATTGTGTGCCATCAAAC-3′; miR2: F: 5′-TGCTGATAAACACCACCTCTAGAGAAGTTTTGGCCACTGACTGACTTCTCTAGGTGG TGTTTAT-3′, R:5′-CCTGATAAACACCACCTAGAGAAGTCAGTCAGTGGCCA AAACTTCTCTAGAGGTGGTGTTTATC-3′; miR3: F: 5′-TGCTGTCCAGGTAGAAGCTGCTGACGGTTTTGGCCACTGACTGACCGTCAGCATTCTACCTGGA-3′, R: 5′-CCTGTCCAGGTAGAATGCTGACGGTCAGTCAGTGGCCAAAACCGTCA GCAGCTTCTACCTGGAC-3′; Negative: F: 5′-TGCTGAAATGTACTGCGCGTGG AGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT-3′, R:5′-CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCG CAGTACTTTTC-3′. MGC803 cells were transfected with RORα-miR expressing and empty vector plasmid using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, California, USA), following the manufacturer's instructions. The transfected cells were selected with blasticidin (Invitrogen). The expression levels of RORα were evaluated by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis to confirm the knockdown efficacy. To establish RORα-overexpressing cell lines, MGC803 cells were transfected with PcDNA3.1 eukaryotic expression vector RORα-expressing plasmid (constructed by Invitrogen Corporation) and empty vector (control) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The transfected cells were selected with G418 (Invitrogen, Carlsbad, CA, USA) until the stable transgene expression during culture maintenance.

RT-PCR

Total RNA was extracted from the cells using Trizol reagent (Gibco BRL, Grand Island, USA). Reverse transcription was carried out using the RT-PCR system (Promega, Madison, USA). PCR analysis was performed using the Gene amp PCR kit (Promega). Primer sequence for RORα: F: 5′-TAGGATCCACCATGGAGTCAGCTCCG-3′; R: 5′-TCGGAATTCTTACCCATCAATTTGC-3′; Wnt1: F: 5′-TGCACGCACACGCGCGTACTGCAC-3′, R: 5′-CAGGATGGCAAGAGGGTTCATG-3′; β-catenin: F: 5′-GTTGTACCGGAGCCCTTCAC-3′, R: 5′-TCCCACCCTACCAACCAAGT-3′; Axin: R: 5′-AGCCGTGTCGGACATGGA-3′, F: 5′-CCTCAAACACCACCCCACA G-3′; c-Myc: R: 5′-CGTCTCCACACATCAGCACAA-3′, F: 5′-CTGCTTGGACGGACAGGATG-3′; c-Jun: R: 5′-CGCACCGGTTGTTGAACTTG-3′, F: 5′-ATGCCTCCCGCACTCTTACT-3′; MMP-9: F: 5′-GTGCTGGGCTGCTGCTTTGCTG-3′, R: 5′-T GGGGTTCGCATGGCCTTCA-3′; TIMP3: F: 5′-AACTTGGGTGAAGGCTGAGTG T-3′, R: 5′-CATGAGGCAGGTCTGGAACG-3′; vimentin: F: 5′-ACACCCTGCAATCTTTCAGACA-3′, R: 5′-AGAAATCCTGCTCTCCTCGCCT-3′; E-cadherin: F:5′-CT CCCAATACATCTCCCTTCAC-3′, R: 5′-CGCCTCCTTCTTCATCATAGTAA-3′; β-actin: F: 5′-TCTACAATGAGCTGCGTGTGG-3′, R:5′-GGAACCGCTCATTGCCAATG-3′. The PCR products were analyzed on 2% agarose gel containing ethidium bromide. Densitometric quantitation of products was determined using the Labwork analysis software. The relative abundance was expressed as the ratio of the object gene to β-actin.

Western Blotting and Coimmunoprecipitation (Co-IP)

Cells were immediately placed on ice and washed with ice-cold PBS. All wash buffers and the final resuspension buffer included 1× protease inhibitor mixture (GE Healthcare, Munich, Germany), NaCl (150 μM), β-glycerophosphate (62.5 mM), DTT (0.1 μM), NaF (5 mM), and Na3VO4 (200 μM). When needed, a CelLytic NuCLEAR extraction kit (Sigma Aldrich) was used to isolate nuclear proteins. Immunoprecipitation was performed using Protein A/G PLUS-Agarose beads (Santa Cruz) following the standard protocol. Proteins were resolved on 8–12% SDS-polyacrylamide gels and transferred via electroblotting to PVDF membranes (Bio-Rad). The membranes were blocked with 5% non-fat dry milk in TBST (50 mM Tris pH 7.6 with 0.1% Tween 20) and incubated overnight at 4°C in 5% non-fat dry milk in TBST with antibody. Immunolabeling was detected using ECL reagent (Amersham Biosciences). Relative expression levels were determined by quantitative densitometric analysis using one-dimensional image analysis software (GE Health Sciences).

Cell Migration and Invasion Assays

For the cell migration assays, an artificial “wound” was created after transfected and untransfected cells were cultured to 90% confluence. The migration distance was measured, and migration rates are expressed as the ratio of the transfected and untransfected cell values. Invasion assays were performed using Transwell® plates (Corning, Corning, NY). Cells were seeded onto Matrigel-coated filters. The cells that had invaded the lower surface of the filter were fixed and stained with hematoxylin. Invasion rates are expressed as the ratio of the transfected group value to the untransfected group value.

Luciferase Reporter Assay

Briefly, 3 × 104/cm2 cells were plated in 24-well plates. Cells were transfected with c-Myc-pGL-3 plasmid using Lipofectamine 2000. Cells were collected 24 h after transfection, and luciferase activities were analyzed with a liquid scintillator. Reporter activity was normalized to the control Renilla luciferase activity.

Animal Models of Tumor

Untransfected or transfected MGC803 cells were injected into the subcutis of the right axillary of BALB/c nude mice. Average tumor volumes were assessed (n = 5 for each group) starting from the seventh day and continuing until sacrifice at 70 days. The xenografts were removed, and tumor size and weight were measured at 70 days. Tumor tissues were fixed and embedded, and sections were prepared for IHC analysis. All experiments were performed according to the guidelines for animal use of the Ethics Committee of the University of South China.

Statistical Analysis

All results are presented as the mean ± SD of three independent experiments. Student's t tests and one-way ANOVA were used to analyze differences in expression among groups. Pearson's χ2 test was used to analyze differences in RORα expression between normal gastric epithelia and tumor samples and to evaluate correlations between RORα expression and clinicopathological parameters. Univariate survival analysis was conducted according to the Kaplan–Meier method, with log-rank tests for comparison. Survival was measured from the day of the surgery. P values < 0.05 were considered to be statistically significant. Statistical analyses were conducted using SPSS13.0 software.

Results

RORα Expression Is Downregulated in Primary GC

The relationship between RORα expression and GC was determined using IHC analysis of tissue arrays. GC exhibited a clear downregulation of RORα expression compared with normal mucosa and precancerous lesions (Table 1, Figure 1A). These data indicate that RORα expression may be related to the occurrence of GC.
Table 1

Expression of retinoid-related orphan receptor alpha (RORα) is downregulated in primary gastric cancer.

ViableCase (n)Low (n)High (n)P-value
Normal641153
precancerous lesion482127P = 0.002*
Gastric cancer14010634P = 0.000#

P < 0.002 vs. normal;

P < 0.000 vs. normal and precancerous lesion.

Figure 1

Retinoid-related orphan receptor alpha (RORα) expression is correlated with histological grade and survival probability. (A) RORα expression in normal mucosa, intestinal metaplasia, and gastric cancer (GC) was detected by immunohistochemistry (IHC). A representative image is shown (×400 magnification). (B) Decreased RORα expression was correlated with poor overall survival. The overall survival curves for patients with low or high RORα expression are shown.

Expression of retinoid-related orphan receptor alpha (RORα) is downregulated in primary gastric cancer. P < 0.002 vs. normal; P < 0.000 vs. normal and precancerous lesion. Retinoid-related orphan receptor alpha (RORα) expression is correlated with histological grade and survival probability. (A) RORα expression in normal mucosa, intestinal metaplasia, and gastric cancer (GC) was detected by immunohistochemistry (IHC). A representative image is shown (×400 magnification). (B) Decreased RORα expression was correlated with poor overall survival. The overall survival curves for patients with low or high RORα expression are shown.

RORα Expression Is Related to Clinicopathological Parameters and Prognosis

RORα expression levels were negatively correlated with differentiation, tumor size, TNM stage, and lymph node metastasis (Table 2, Figure 1A). To further evaluate the significance of RORα expression in terms of clinical prognosis, a Kaplan–Meier survival analysis of patient overall survival (OS) showed that patients with low RORα expression had fewer mean months of OS than patients with high RORα expression (Figure 1B). Likewise, the median survival time was shorter in low RORα expression (24 months) than in the high RORα level group (51 months). It is indicated that RORα expression is associated with prognosis in GC.
Table 2

Analysis of the correlation between retinoid-related orphan receptor alpha (RORα) expression in primary gastric cancer and its clinicopathological parameters.

ViableCase (n)Low (n)High (n)P-value
Gender
  Male9774230.812
  Female433211
Age (years)
  <608262200.973
  ≥60584414
Histological grade
  Well-differentiated3218140.002
  Moderately differentiated473413
  Poorly differentiated*61547
Tumor size (cm)
  ≤3.03421130.027
  >3.01078621
TNM stage
  I–II4731160.016
  III–IV937815
Lymph node metastasis
  Yes10489150.0003
  No361719

Including mucinous cancer and signet-ring cell cancer.

Analysis of the correlation between retinoid-related orphan receptor alpha (RORα) expression in primary gastric cancer and its clinicopathological parameters. Including mucinous cancer and signet-ring cell cancer.

The Effect of RORα Overexpression and Knockdown on GC Cell Proliferation, Migration, and Invasion

First, we demonstrated that the expression of RORα mRNA and protein was lower in MGC803, BGC823, SGC7901, and MKN28 cells than in GES-1 cells (Figure S1A). To determine whether RORα has an inhibitory effect on proliferation, migration, and invasion, we constructed RORα-overexpressing and silencing MGC803 cells (Figures S1B,C). Cell proliferation assays (Cell Proliferation Assay kit, MTS) showed that RORα overexpression inhibited cell proliferation in a time-dependent manner (Figure S2A). Colony formation assays revealed that the colony-forming efficiency in RORα-overexpressing cells was lower than those in control group and vector group (Figure S2B). Flow cytometry assays showed that the percentage of cells in G2/M phase in RORα group was higher than those in control group and vector group (Figure S2C). Cell migration experiments demonstrated that the migration distance in RORα group was lower than in control group and in vector group (Figure 2A). Invasion assays showed that the number of cells through the Matrigel-coated membrane in RORα group was decreased compared with the control group and the vector group (Figure 2B). In contrast, silencing of RORα enhanced proliferation in MGC803 cells (Figure S2D). The colony-forming efficiency of miR group was higher than in control group and vector group (Figure S2E). In contrast, the percentage of cells in S phase in miR-RORα cells showed an increase compared with those in the control group and vector groups (Figure S2C). Silencing of RORα enhanced proliferation in MGC803 cells(Figure S2D). The colony-forming efficiency of miR group was higher than in control group and vector group (Figure S2E). The migration distance and the number of cells through the Matrigel membrane in miR-RORα cells were higher than those in control group and in vector group (Figures 2C,D). RORα overexpression led to downregulation of MMP-9 and upregulation of TIMP3 (Figures 2E,F). Conversely, silencing of RORα increased the expression of MMP-9 and decreased the expression of TIMP3 (Figures 2G,H).
Figure 2

The effect of retinoid-related orphan receptor alpha (RORα) overexpression and knockdown on migration and invasion in gastric cancer cells. (A) Migration distance of RORα-overexpressing cells was lower (0.53 ± 0.11 cm) than those of control cells (1.32 ± 0.14 cm) and vector cells (1.37 ± 0.90 cm). (B) The number of cells through the Matrigel membrane in the RORα overexpression group was lower (37 ± 9) than those in the control group (147 ± 17) and in vector cells (144 ± 18). (C) Migration distance of miR-RORα cells was greater (1.76 ± 0.19 cm) than those in control cells (1.29 ± 0.17 cm) and vector cells (1.32 ± 0.14 cm). (D) The number of cells through the Matrigel membrane in the miR-RORα group was higher (172 ± 27) than those in the control group (147 ± 17) and vector group (149 ± 14). (E,F) The expression levels of MMP-9 and TIMP3 were detected in RORα-overexpressing cells via reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting. (G,H) The expression levels of MMP-9 and TIMP3 in miR-RORα cells were detected by RT-PCR and Western blotting. The pictures are representative of three individual experiments. *P < 0.05 vs. control.

The effect of retinoid-related orphan receptor alpha (RORα) overexpression and knockdown on migration and invasion in gastric cancer cells. (A) Migration distance of RORα-overexpressing cells was lower (0.53 ± 0.11 cm) than those of control cells (1.32 ± 0.14 cm) and vector cells (1.37 ± 0.90 cm). (B) The number of cells through the Matrigel membrane in the RORα overexpression group was lower (37 ± 9) than those in the control group (147 ± 17) and in vector cells (144 ± 18). (C) Migration distance of miR-RORα cells was greater (1.76 ± 0.19 cm) than those in control cells (1.29 ± 0.17 cm) and vector cells (1.32 ± 0.14 cm). (D) The number of cells through the Matrigel membrane in the miR-RORα group was higher (172 ± 27) than those in the control group (147 ± 17) and vector group (149 ± 14). (E,F) The expression levels of MMP-9 and TIMP3 were detected in RORα-overexpressing cells via reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting. (G,H) The expression levels of MMP-9 and TIMP3 in miR-RORα cells were detected by RT-PCR and Western blotting. The pictures are representative of three individual experiments. *P < 0.05 vs. control.

RORα Represses the Wnt/β-Catenin Pathway in GC Cells

RORα overexpression resulted in the downregulated expression levels of Wnt1 mRNA and protein in MGC803 cells, and the expression levels of β-catenin mRNA and protein were not significantly altered by RORα overexpression (Figures 3A,B). Co-IP showed that RORα binding to β-catenin and β-catenin binding to RORα were increased by RORα overexpression (Figure 3C). The intranuclear β-catenin and p-β-catenin levels were downregulated after RORα overexpression (Figure 3D). The expression of TCF-4 was decreased in RORα-overexpressing cells (Figure 3F). The above results indicated that RORα overexpression can downregulate the expression of Wnt1, repress β-catenin in the nucleus, decrease p-β-catenin, and decrease the expression of TCF-4, thus negatively regulating the Wnt/β-catenin pathway. These unexpected findings led us to explore RORα-mediated repression of Wnt/β-catenin target genes in MGC803 cells. The results revealed that the expression levels of Axin, c-Myc, and c-Jun were downregulated in RORα-overexpressing cells (Figures 3E,F). Additionally, c-Myc promoter activity was decreased (Figure 3G). These results demonstrate that RORα overexpression can represses the Wnt/β-catenin pathway and its target gene expression in GC cells.
Figure 3

Retinoid-related orphan receptor alpha (RORα) overexpression represses the Wnt/β-catenin pathway in GC cells. (A,B) The expression levels of Wnt1 and β-catenin mRNA and protein in RORα-overexpressing cells were assessed via reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting. (C) RORα binding to β-catenin or β-catenin binding to RORα in MGC803 cells was detected by coimmunoprecipitation (Co-IP). (D) The intranuclear β-catenin and p-β-catenin content in RORα-overexpressing cells was determined by Western blot. (E,F) The expression of TCF-4, Axin, c-Jun, and c-Myc in RORα-overexpressing cells was detected via RT-PCR and Western blotting. (G) c-Myc promotor activity in RORα-overexpressing cells was assessed with a luciferase reporter assay. The pictures are representative of three individual experiments. *P < 0.05 vs. control.

Retinoid-related orphan receptor alpha (RORα) overexpression represses the Wnt/β-catenin pathway in GC cells. (A,B) The expression levels of Wnt1 and β-catenin mRNA and protein in RORα-overexpressing cells were assessed via reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting. (C) RORα binding to β-catenin or β-catenin binding to RORα in MGC803 cells was detected by coimmunoprecipitation (Co-IP). (D) The intranuclear β-catenin and p-β-catenin content in RORα-overexpressing cells was determined by Western blot. (E,F) The expression of TCF-4, Axin, c-Jun, and c-Myc in RORα-overexpressing cells was detected via RT-PCR and Western blotting. (G) c-Myc promotor activity in RORα-overexpressing cells was assessed with a luciferase reporter assay. The pictures are representative of three individual experiments. *P < 0.05 vs. control. In contrast, the expression of Wnt1 was upregulated in RORα-silenced cells (Figures 4A,B). RORα binding to β-catenin and β-catenin binding to RORα were decreased (Figure 4C). The intranuclear β-catenin and p-β-catenin levels were increased (Figure 4D). The expression of TCF-4 was increased (Figure 4F). The expression levels of Axin, c-Myc, and c-Jun were upregulated (Figures 4E,F), and c-Myc promoter activity was increased (Figure 4G). These results demonstrate that silencing RORα promoted the Wnt/β-catenin pathway and its target gene expression in GC cells.
Figure 4

Silencing retinoid-related orphan receptor alpha (RORα) promotes the Wnt/β-catenin pathway in gastric cancer (GC) cells. (A,B) Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the mRNA and protein levels of Wnt1 and β-catenin in RORα-silenced cells. (C) RORα binding to β-catenin or β-catenin binding to RORα in MGC803 cells was detected by coimmunoprecipitation (Co-IP). (D) The intranuclear β-catenin and p-β-catenin content in RORα-silenced cells was determined by Western blot. (E,F) The expression of TCF-4, Axin, c-Jun, and c-Myc in RORα-silenced cells was detected via RT-PCR and Western blotting. (G) c-Myc promotor activity in RORα-silenced cells was assessed with a luciferase reporter assay. The pictures are representative of three individual experiments. *P < 0.05 vs. control.

Silencing retinoid-related orphan receptor alpha (RORα) promotes the Wnt/β-catenin pathway in gastric cancer (GC) cells. (A,B) Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the mRNA and protein levels of Wnt1 and β-catenin in RORα-silenced cells. (C) RORα binding to β-catenin or β-catenin binding to RORα in MGC803 cells was detected by coimmunoprecipitation (Co-IP). (D) The intranuclear β-catenin and p-β-catenin content in RORα-silenced cells was determined by Western blot. (E,F) The expression of TCF-4, Axin, c-Jun, and c-Myc in RORα-silenced cells was detected via RT-PCR and Western blotting. (G) c-Myc promotor activity in RORα-silenced cells was assessed with a luciferase reporter assay. The pictures are representative of three individual experiments. *P < 0.05 vs. control.

The Effect of RORα Overexpression and Knockdown on EMT in MGC803 Cells

Phase-contrast microscopy showed that control and vector group cells showed a fibroblast-like shape and striking heteromorphism. In contrast, RORα-overexpressing cells were uniform in size, with a round or ellipsoid shape and less heteromorphism (Figure 5A). However, miR-RORα cells were different in size and shape, with an increase in fibroblast-like cells, and were predominantly heteromorphic (Figure 5B). Western blotting showed that RORα overexpression downregulated the expression of vimentin and Snail and upregulated the expression of E-cadherin (Figures 5C,D). Conversely, upregulation of vimentin and Snail and downregulation of E-cadherin were observed in miR-RORα cells (Figures 5E,F). These data together indicate that overexpression of RORα can retard EMT, and the absence of RORα may facilitate EMT in MGC803 cells.
Figure 5

The effect of retinoid-related orphan receptor alpha (RORα) overexpression and silencing on correlated epithelial-to-mesenchymal transition (EMT) markers in MGC803 cells. (A) Representative images were captured by phase-contrast microscopy to evaluate changes in the morphology of RORα overexpression cells (×400 magnification). (B) The morphological changes in RORα-silenced cells were examined by phase-contrast microscopy (×400 magnification). (C,D) Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the expression of vimentin, E-cadherin, and Snail in RORα-overexpressing cells. (E,F) The expression of Snail, vimentin, and E-cadherin in miR-RORα cells was detected by RT-PCR and Western blotting. The pictures are representatives of three individual experiments. *P < 0.05 vs. control.

The effect of retinoid-related orphan receptor alpha (RORα) overexpression and silencing on correlated epithelial-to-mesenchymal transition (EMT) markers in MGC803 cells. (A) Representative images were captured by phase-contrast microscopy to evaluate changes in the morphology of RORα overexpression cells (×400 magnification). (B) The morphological changes in RORα-silenced cells were examined by phase-contrast microscopy (×400 magnification). (C,D) Reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were performed to detect the expression of vimentin, E-cadherin, and Snail in RORα-overexpressing cells. (E,F) The expression of Snail, vimentin, and E-cadherin in miR-RORα cells was detected by RT-PCR and Western blotting. The pictures are representatives of three individual experiments. *P < 0.05 vs. control.

In vivo Tumor Growth of MGC803 Cell After Overexpression and Knockdown of RORα

We performed in vitro experiments to explore the biological effect of RORα on MGC803 cell growth. The results showed that the growth of xenograft tumors in the RORα group was decreased compared to that in the control and miR-RORα group, and the growth of xenograft tumors in miR-RORα was accelerated compared with that of tumors in the control group (Figure 6A). The weight of transplanted tumors was reduced in the RORα group by 26.55%, and the weight of transplanted tumors in the miR-RORα group was increased by 14.12% (Figures 6B,C). In addition, the expression levels of Ki-67, Snail, vimentin, and CD34 were decreased in the RORα group, and the expression of E-cadherin was increased (Figure 6D). Whereas, the expression levels of Ki-67, Snail, vimentin, and CD34 was increased, the expression of E-cadherin was decreased in miR-RORα cells (Figure 6D). These data indicated that RORα may play an important role in EMT in MGC803 cells in vivo.
Figure 6

Assessment of in vivo tumor growth of MGC803 cell xenografts with retinoid-related orphan receptor alpha (RORα) overexpression and knockdown. (A) The growth of xenograft tumors in the RORα-overexpressing group was markedly decreased compared with that in the RORα-silenced MGC803 cell group, and the tumor growth in the RORα-silenced group was markedly accelerated relative to that in the MGC803 cell group (n = 5 per group). (B,C) The transplanted tumor was removed, and the mean ± SD of the tumor weights in each group was measured at 70 days. The tumor weight in the RORα-overexpressing group was significantly decreased compared with those in the MGC803 cell group and the RORα-silenced group (*P < 0.05), and the tumor weight in the RORα-silenced group was significantly higher than that in the MGC803 cell group (#P < 0.05). (D) Immunohistochemistry was performed to detect the expression of Ki-67, vimentin, E-cadherin, and CD34 in the tumor tissue specimens obtained from the xenografts (×400 magnification).

Assessment of in vivo tumor growth of MGC803 cell xenografts with retinoid-related orphan receptor alpha (RORα) overexpression and knockdown. (A) The growth of xenograft tumors in the RORα-overexpressing group was markedly decreased compared with that in the RORα-silenced MGC803 cell group, and the tumor growth in the RORα-silenced group was markedly accelerated relative to that in the MGC803 cell group (n = 5 per group). (B,C) The transplanted tumor was removed, and the mean ± SD of the tumor weights in each group was measured at 70 days. The tumor weight in the RORα-overexpressing group was significantly decreased compared with those in the MGC803 cell group and the RORα-silenced group (*P < 0.05), and the tumor weight in the RORα-silenced group was significantly higher than that in the MGC803 cell group (#P < 0.05). (D) Immunohistochemistry was performed to detect the expression of Ki-67, vimentin, E-cadherin, and CD34 in the tumor tissue specimens obtained from the xenografts (×400 magnification).

Discussion

Previous studies have indicated that the expression of RORα is correlated with tumor development. Brozyna et al. showed that the expression of RORα was lower in melanoma than in nevi and normal skin and correlated with pTNM and poor prognosis (13). Fu et al. disclosed that RORα expression was downregulated in hepatocellular cancer (HCC) and concerned with serum AFP, pathology grade, tumor recurrence, invasion, and prognosis in HCC (10). Kano et al. revealed that RORα1 expression was downregulated in colorectal cancer and cells; moreover, hypomethylation of the RORα1 promoter was correlated with TNM stage (14). Wang et al. found that RORα expression was reduced in GC and associated with tumor size, differentiation, T stage, TNM stage, and lymph node metastasis (9). We showed that RORα levels were downregulated and associated with differentiation, tumor size, TNM stage, lymph node metastasis, and poor prognosis in GC. These findings suggest that downregulation of RORα may contribute to carcinogenesis, progression, and poor prognosis in GC. Moreover, RORα expression in GC cells was lower than that in GES-1 cells. Therefore, it is important to explore whether RORα plays a key role in GC cells. Much evidence has demonstrated that RORα acts as a tumor suppressor gene in many cancers. RORα can inhibit proliferation, induce cell cycle arrest, and reduce invasion and migration, thus, RORα might serve as a target for the development of chemotherapy in prostate cancer (15–17). It has been shown that RORα promotes apoptosis via the AMPK-RORα in GC cells (9). RORα regulates proliferation, apoptosis, and invasion through the canonical and non-canonical nuclear receptor pathways (8). And RORα suppressed invasion by the RORα-SEMA3F in breast cancer cells (12). RORα binding to E2F1 inhibits E2F1 target genes and proliferation via the nuclear receptor pathway (18). RORα is a p53 regulator that exerts its role in increased apoptosis via p53 (19). RORα inhibited hepatoma growth and reduced the expression of PDK2 and p-PDK2 (20). Our study showed that the proliferation, migration, and invasion ability were decreased, and G2/M blockade was induced in overexpressing RORα. Furthermore, RORα overexpression downregulated MMP-9 and upregulated TIMP3. Conversely, knockdown of RORα promoted proliferation, migration, and invasion by increasing the expression of MMP-9 and decreasing the expression of TIMP3. Numerous studies have indicated that the Wnt/β-catenin signaling is involved in the development and progression of a significant proportion of GC (21). Nuclear accumulation of β-catenin drives cancer cell proliferation (22). Phosphorylated RORα induced by the Wnt5a/PKC pathway attenuated the Wnt signaling through binding of RORα to β-catenin to suppress the target genes in colon cancer (11). RORα attenuates Wnt target gene expression by PGE2/PKCα-dependent phosphorylation in colon cancer (23). We found that the expression of Wnt1 was downregulated, RORα binding to β-catenin was increased, and the expression levels of nuclear β-catenin and p-β-catenin were decreased, the expression of TCF-4 and the target genes of the Wnt/β-catenin pathway were reduced by RORα overexpression. It is widely acknowledged that the Wnt/β-catenin signaling is involved in EMT in GC. During embryonic development, cell transition between epithelial and mesenchymal states in a highly plastic and dynamic manner. A shift toward the mesenchymal modifies the expression of adhesion molecules in the cell, allowing it to adopt a migratory and invasive behavior (24). Major signaling pathways involved in EMT include TGF-β, Wnt-β-catenin, Notch, Hedgehog, and receptor tyrosine kinases. These pathways converge on several transcription factors, including the zinc finger proteins Snail and Slug and Twist, ZEB, and Smads. EMT contributes to the progression of cancer, and therapeutic control of EMT may prevent cancer metastasis (24–26). The Wnt/β-catenin pathway dominates numerous cellular processes, including proliferation, differentiation, and EMT, which play crucial roles in cancer (27). A number of the Wnt/β-catenin pathways have been reported in GC. Such as DDAH1 (28), silencing of Notch4 (29), knockdown of KIAA1199 (30), knockdown of UBE2C (31), inhibition of AURKA (32), VGLL4 (33), inhibition of PRRX1 by XAV939 (34), and SOX10 (35) can inhibit invasion and EMT by suppressing the Wnt/β-catenin pathway in GC. Thus far, it remains unknown whether RORα inhibits EMT and invasion of GC cells through the Wnt/β-catenin pathway. In the present study, the results showed that RORα-overexpressing cells exhibited fibroblast-like epithelial transformation. Downregulation of Snail and vimentin, upregulation of E-cadherin, and the growth and weights of xenograft tumors in RORα-overexpressing cells were decreased. In contrast, it was shown that the number of fibroblast-like cells after knockdown of RORα, upregulation of Snail and vimentin, downregulation of E-cadherin, and the growth and weights of xenograft tumors were increased. Together, these data indicate that overexpression of RORα can retard EMT, and the absence of RORα may facilitate EMT in MGC803 cells. Based on these observations, further investigations of activation of RORα and restraint of EMT may lead to the development of novel therapeutic drugs and RORα agonists for GC. SR1078, a synthetic agonist for RORα, may be used to activate RORα (36). SH-SY5Y cells treated with SR1078 exhibited an increase in the expression of RORα target genes (37). MLN4924 may stabilize RORα to suppress proliferation and induce apoptosis in osteosarcoma cells (38). Pantoprazole inhibited the proliferation, self-renewal, and chemoresistance of GC stem cells via the EMT/β-catenin pathway (39); reversed the aggressiveness and EMT marker expression of SGC7901/ADR cells; and suppressed the Wnt/β-catenin pathway (40). Curcumin inhibited the proliferation and the target genes of Wnt/β-catenin in GC cells (41). EGCG ((-)-Epigallocatechin-3-gallate) suppressed the proliferation and decreased the expression of p-β-catenin, p-GSK3β, and β-catenin target genes by inhibiting Wnt/β-catenin signaling in GC cells (42). We showed that diallyl disulfide (DADS) could suppress the proliferation and induce apoptosis in GC cells through the Wnt-1 signaling via upregulation of miR-200b and miR-22 (43). Moreover, DADS upregulated RORα and downregulated LIMK1 in GC cells (44). Furthermore, DADS suppressed EMT, invasion, and proliferation through downregulation of LIMK1 in GC cells by inhibiting the Rac1-Pak1/Rock1 pathway (45). Nevertheless, determining whether upregulation of RORα by DADS may inhibit EMT and invasion of GC cells via the Wnt/β-catenin pathway will require further investigation. In conclusion, the downregulation of RORα was related to tumorigenesis, differentiation, tumor size, TNM stage, and lymph node metastasis in GC. RORα could be a potent tumor suppressor and a potential therapeutic target for GC. The overexpression of RORα could inhibit the proliferation, EMT, and invasion through Wnt/β-catenin pathway in vivo and in vitro in MGC803 cells. The silence of RORα could promote the proliferation, EMT, and invasion through Wnt/β-catenin pathway in MGC803 cells in vivo and in vitro. Hopefully, utilization of RORα agonist or activator would be a potential therapeutic strategy for the treatment of GC.

Data Availability Statement

All datasets generated for this study are included in the article/Supplementary Material.

Ethics Statement

The use of clinical samples was approved by the ethics committee of the University of South China, and informed consent was obtained from all patients. The study methodologies conformed to the standards set by the Declaration of Helsinki.

Author Contributions

JS and BS proposed the hypothesis and designed the experiments. BS and HX performed the data analysis and wrote the manuscript. JS, YS, YZ, and XZe carried out the tissue microarray, immunohistochemical staining, and immunofluorescence assays. JL and FL performed animal models, cell migration, and invasion assays. XZh and JZ performed Western blot analysis and RT-PCR. HL participated in the design of the study. YW and QS conceived the study, participated in its design and coordination, and helped edit the manuscript.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  45 in total

1.  Activation of the orphan nuclear receptor RORalpha induces growth arrest in androgen-independent DU 145 prostate cancer cells.

Authors:  R M Moretti; M M Marelli; M Motta; D Polizzi; S Monestiroli; G Pratesi; P Limonta
Journal:  Prostate       Date:  2001-03-01       Impact factor: 4.104

2.  Retinoic acid-related orphan receptor alpha reprograms glucose metabolism in glutamine-deficient hepatoma cells.

Authors:  Jun-Kyu Byun; Yeon-Kyung Choi; Yu Na Kang; Byoung Kuk Jang; Koo Jeong Kang; Yong Hyun Jeon; Ho-Won Lee; Jae-Han Jeon; Seung-Hoi Koo; Won-Il Jeong; Robert A Harris; In-Kyu Lee; Keun-Gyu Park
Journal:  Hepatology       Date:  2015-01-28       Impact factor: 17.425

3.  DNA damage-induced RORα is crucial for p53 stabilization and increased apoptosis.

Authors:  Hyunkyung Kim; Ji Min Lee; Gina Lee; Jinhyuk Bhin; Se Kyu Oh; Kyeongkyu Kim; Ki Eun Pyo; Jason S Lee; Hwa Young Yim; Keun Il Kim; Daehee Hwang; Jongkyeong Chung; Sung Hee Baek
Journal:  Mol Cell       Date:  2011-12-09       Impact factor: 17.970

4.  Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathway by up-regulation of miR-200b and miR-22.

Authors:  Hailin Tang; Yanan Kong; Jiaoli Guo; Yi Tang; Xinhua Xie; Lu Yang; Qi Su; Xiaoming Xie
Journal:  Cancer Lett       Date:  2013-07-09       Impact factor: 8.679

5.  PRRX1 promotes epithelial-mesenchymal transition through the Wnt/β-catenin pathway in gastric cancer.

Authors:  Jinbao Guo; Zhongxue Fu; Jinlai Wei; Weidong Lu; Jihong Feng; Shouru Zhang
Journal:  Med Oncol       Date:  2014-11-27       Impact factor: 3.064

6.  RORα binds to E2F1 to inhibit cell proliferation and regulate mammary gland branching morphogenesis.

Authors:  Gaofeng Xiong; Ren Xu
Journal:  Mol Cell Biol       Date:  2014-06-02       Impact factor: 4.272

7.  Activation of the orphan nuclear receptor RORalpha counteracts the proliferative effect of fatty acids on prostate cancer cells: crucial role of 5-lipoxygenase.

Authors:  Roberta M Moretti; Marina Montagnani Marelli; Angelo Sala; Marcella Motta; Patrizia Limonta
Journal:  Int J Cancer       Date:  2004-10-20       Impact factor: 7.396

8.  RORA, a large common fragile site gene, is involved in cellular stress response.

Authors:  Y Zhu; S McAvoy; R Kuhn; D I Smith
Journal:  Oncogene       Date:  2006-05-11       Impact factor: 9.867

9.  DDAH1 mediates gastric cancer cell invasion and metastasis via Wnt/β-catenin signaling pathway.

Authors:  Jianxin Ye; Jie Xu; Yun Li; Qiang Huang; Jinsheng Huang; Jinzhou Wang; Wenjing Zhong; Xinjian Lin; Wannan Chen; Xu Lin
Journal:  Mol Oncol       Date:  2017-06-22       Impact factor: 6.603

10.  SOX10, a novel HMG-box-containing tumor suppressor, inhibits growth and metastasis of digestive cancers by suppressing the Wnt/β-catenin pathway.

Authors:  Xin Tong; Lili Li; Xiaoyan Li; Lei Heng; Lan Zhong; Xianwei Su; Rong Rong; Shi Hu; Wenjia Liu; Baoqing Jia; Xing Liu; Geng Kou; Jun Han; Shangjing Guo; Yi Hu; Cheng Li; Qian Tao; Yajun Guo
Journal:  Oncotarget       Date:  2014-11-15
View more
  3 in total

1.  POU6F1 cooperates with RORA to suppress the proliferation of lung adenocarcinoma by downregulation HIF1A signaling pathway.

Authors:  Wenjing Xiao; Wei Geng; Mei Zhou; Juanjuan Xu; Sufei Wang; Qi Huang; Yice Sun; Yumei Li; Guanghai Yang; Yang Jin
Journal:  Cell Death Dis       Date:  2022-05-03       Impact factor: 9.685

2.  Epigenetic modifications inhibit the expression of MARVELD1 and in turn tumorigenesis by regulating the Wnt/β-catenin pathway in pan-cancer.

Authors:  Jingchun Zhang; Qingwei Li; Qinliang Sun; Bojun Wang; Ying Cui; Changjie Lou; Yuanfei Yao; Yanqiao Zhang
Journal:  J Cancer       Date:  2022-01-01       Impact factor: 4.207

Review 3.  Regulation of Wnt Signaling through Ubiquitination and Deubiquitination in Cancers.

Authors:  Hong-Beom Park; Ju-Won Kim; Kwang-Hyun Baek
Journal:  Int J Mol Sci       Date:  2020-05-30       Impact factor: 5.923

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.