Literature DB >> 31863658

PolyI:C Upregulated CCR5 and Promoted THP-1-Derived Macrophage Chemotaxis via TLR3/JMJD1A Signalling.

Xiaoxiao Yu1, Huayang Wang2, Hongjia Shao1, Cuijuan Zhang3, Xiuli Ju1, Jie Yang4.   

Abstract

OBJECTIVE: This study aimed to evaluate the specific roles of polyinosinic:polycytidylic acid (polyI:C) in macrophage chemotaxis and reveal the potential regulatory mechanisms related to chemokine receptor 5 (CCR5).
MATERIALS AND METHODS: In this experimental study, THP-1-derived macrophages (THP1-Mφs) induced from THP- 1 monocytes were treated with 25 μg/mL polyI:C. Toll-like receptor 3 (TLR3), Jumonji domain-containing protein (JMJD)1A, and JMJD1C small interfering RNA (siRNAs) were transfected into THP1-Mφs. Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) was used to detect the expression levels of TLR3, CCR5, 23 Jumonji C domain-containing histone demethylase family members, JMJD1A, and JMJD1C in THP1-Mφs with different siRNAs transfections. Western blot was performed to detect JMJD1A, JMJD1C, H3K9me2, and H3K9me3 expressions. A transwell migration assay was conducted to detect THP1-Mφ chemotaxis toward chemokine ligand 3 (CCL3). A chromatin immunoprecipitation (ChIP) assay was performed to detect H3K9me2-CCR5 complexes in THP1- Mφs.
RESULTS: PolyI:C significantly upregulated CCR5 in THP1-Mφs and promoted chemotaxis toward CCL3 (P<0.05); these effects were significantly inhibited by TLR3 siRNA (P<0.01). JMJD1A and JMJD1C expression was significantly upregulated in polyI:C-stimulated THP1-Mφs, while only JMJD1A siRNA decreased CCR5 expression (P<0.05). JMJD1A siRNA significantly increased H3K9me2 expression in THP1-Mφs but not in polyI:C-stimulated THP1-Mφs. The ChIP result revealed that polyI:C significantly downregulated H3K9me2 in the promoter region of CCR5 in THP1- Mφs.
CONCLUSION: PolyI:C can enhance THP1-Mφ chemotaxis toward CCL3 regulated by TLR3/JMJD1A signalling and activate CCR5 expression by reducing H3K9me2 in the promoter region of CCR5. Copyright© by Royan Institute. All rights reserved.

Entities:  

Keywords:  Chemokine Receptor 5; Chemotaxis; Macrophages; Polyinosinic:polycytidylic Acid

Year:  2019        PMID: 31863658      PMCID: PMC6947015          DOI: 10.22074/cellj.2020.6713

Source DB:  PubMed          Journal:  Cell J        ISSN: 2228-5806            Impact factor:   2.479


Introduction

Acute lung injury (ALI) is an inflammation characterized by the breakdown of the endothelial and epithelial lung barrier (1). Monocyte-derived macrophages are important in the pathogenesis of ALI. Under the pathological conditions of ALI, activated circulating monocytes infiltrate the alveolar space to form alveolar macrophages. Subsequently, alveolar macrophages may secrete several inflammatory mediators, such as cytokines and chemokines, to induce the migration of mature neutrophils and CD4+T cells into the alveolar space, thereby prompting an inflammation response that may kill pathogenic microbes (2, 3). A previous study showed that the depletion of circulating monocytes and subsequently recruited alveolar macrophages significantly suppressed ALI in mice (4). Therefore, the function and activity of macrophages are extremely important in the development and prognosis of ALI. Toll-like receptors (TLRs) are categorized as innate immune sensors, which play an important role in the process of antigen recognition for innate immune cells such as macrophages (5). It has been reported that TLR3 is upregulated in alveolar macrophages throughout the ALI pathogenesis (6). Chemokines comprise a class of cytokines that act as signalling molecules in the regulation of inflammatory response (7). Chemokine receptors (CCRs) are specific receptors for chemokines that are integral to the recruitment of alveolar macrophages (8). TLR3 and CCRs participate in ALI-induced inflammatory response through the recognition of pathogen-related molecular processes or the recruitment of macrophages; however, whether a direct regulating mechanism between CCRs and TLR3 exists in macrophages has not been thoroughly researched. Histone demethylation is an important form of epigenetic modification that is regulated by Jumonji C domaincontaining histone demethylases (JHDMs) (9). Histone demethylation is involved in the transcriptional repression and activation of target genes, and is closely associated with the inflammatory response of macrophages. It has been reported that Jumonji domain-containing protein 3 (JMJD3) influences transcriptional gene expression in lipopolysaccharide (LPS)-activated macrophages, and the regulatory role of JMJD3 is dependent upon H3K4me3 (10). An H3K27me3 inhibitor reduces LPS-induced proinflammatory cytokine production by macrophages, and this process is regulated by UTX and JMJD3 (11). Moreover, a pervious study reported that high glucose upregulates diverse inflammatory cytokines in macrophages, including IL-6, IL- 12p40, and MIP-1α/β; this process is closely associated with H3K9 methylation (12). However, the specific role of H3K9 methylation in TLR3 signalling for macrophage-involved inflammatory responses remains unknown. Polyinosinic:polycytidylic acid (PolyI:C) is a viral mimetic that mimics inflammatory responses to systemic viral infection (13). In this study, the effects of polyI:C on THP-1-derived macrophage (THP1-Mφ) chemotaxis, as well as potential regulatory mechanisms related to TLR3 and CCRs, are explored. The aim of this study is to provide new insight into the underlying regulatory mechanisms for macrophage participation in ALI.

Materials and Methods

Cell culture and induction of THP-1-derived macrophages (THP1-Mφs)

In this experimental study, human THP-1 monocytes were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI- 1640 medium that contained 10% heat-inactivated foetal bovine serum (FBS, Gibco, USA) and 100 U/ mL penicillin-streptomycin. Cells were maintained in an atmosphere of 5% CO2 at 37˚C. Exponential-phase cells were used in the following assays. THP-1 monocytes were induced to differentiate into macrophages in vitro. Simply, THP-1 monocytes suspended in RPMI-1640 medium were seeded in 6-well plates at a density of 2×105 cells/mL. Then, 100 ng/mL phorbol-12- myristate acetate (PMA) (Sigma, St. Louis, MO, USA) was added to the THP-1 monocytes. After a 48-hour incubation period, the adherent macrophages were used in the following assays (THP1-Mφs). For polyI:C treatment, THP-1 monocytes were incubated with 100 ng/mL PMA for 6 hours, and then treated with 25 μg/mL polyI:C (R&D Systems, Minneapolis, MN, USA). After 42 hours of incubation, the adherent macrophages were used in the following assays (polyI:C-stimulated THP1-Mφs).

Quantitative real-time reverse transcriptase polymerase chain reaction

Total RNA was extracted from cells of different groups using TRIzol (Fermentas, Burlington, Ontario, Canada) and reverse-transcribed by RevertAid M-MuLV Reverse Transcriptase (Fermentas, Canada) in accordance with the manufacturer’s instructions. Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) was performed on a LightCycler 2.0 Instrument (Roche, Germany) using the SYBR Green PCR Kit (TaKaRa, Japan). The relative expression levels of target genes were calculated by 2-ΔΔCt, using GAPDH as an internal control. The primer sequences are shown in Table 1.

Flow cytometry

Flow cytometry was performed to detect chemokine receptor 5 (CCR5) expression in THP1-Mφs. Simply, cells were suspended in fresh RPMI-1640 medium and incubated with CCR5-PE antibody (R&D Systems, USA) in the dark for 30 minutes at room temperature. Data were collected using the FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) and analysed with CellQuest software (BD Biosciences).

siRNA transfection

siRNAs targeting TLR3, Jumonji domain-containing protein 1A (JMJD1A), and JMJD1C were obtained from Shanghai GeneChem Company (Shanghai, China), as follows: 5ˊ-CCUGAGCUGUCAAGCCACUACCUUU-3ʹ 5ʹ-GCAAUUGGCUUGUGGUUACUU-3ʹ 5ʹ-GCAAUUGGCUUGUGGUUACUU-3ʹ. After 6 hours of incubation with 100 ng/mL PMA, THP1-Mφs were incubated with specific siRNAs and Lipofectamine 2000 reagent (ThermoFisher, Waltham, MA, USA) for 6 hours. Transfected cells were treated with 25 μg/ mL polyI:C for an additional 42 hours. The efficacy of the TLR3 transfection was detected using qRT-PCR and flow cytometry as described above, while the efficacy of JMJD1A and JMJD1C siRNA-mediated gene silencing was monitored using Western blotting.

Transwell migration assay

THP1-Mφ chemotaxis toward chemokine ligand 3 (CCL3) was detected using transwell inserts. Transwell inserts with a pore size of 8 μm were placed into 24-well plates. Cells were suspended in serum-free RPMI-1640 medium and inoculated into the upper chamber at a density of 1×105 cells/mL. RPMI- 1640 medium that contained 100 ng/mL recombinant human CC chemokine ligand 3 (rhCCL3;#270-LD, R&D Systems, USA) and 10% FBS was added into the lower chamber. Following 12 hours of incubation at 37˚C, the non-migrated cells were removed from the upper chamber, and migrated cells in the lower chamber were fixed with methanol and stained with eosin. Five random fields of each well were observed using light microscopy, and the number of migrated cells was counted.

Chromatin immunoprecipitation assay

The chromatin immunoprecipitation (ChIP) assay was performed to detect H3K9 methylation in THP1-Mφs. After being fixed in 1% formaldehyde, the chromatin was extracted from THP1-Mφs using sonication. Then, the chromatin was immunoprecipitated with H3K9me2 (Abcam, Cambridge, MA, USA) or H3K9me3 antibody (Abcam, USA) pre-bound Protein G-plus Agarose beads, overnight at 4˚C. Precipitated protein-DNA complexes were eluted in Tris-EDTA buffer that contained 2% sodium dodecyl sulfonate (SDS), and the crosslink was reversed through a 16 hour incubation period at 65˚C. The precipitated DNA fragments were analysed by qRT-PCR as described above. The primer sequences of CCR5-ChIP are shown in Table 1. qRT-PCR was performed on a LightCycler 2.0 Instrument (Roche, Germany) using TB Green Fast qPCR Mix (Code No. RR430S/A/B, TaKaRa, Japan). Sequences of specific primers used in quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)

Western blot

THP1-Mφs were lysed in RIPA buffer. Total proteins were separated by SDS-polyacrylamide gel electrophoresis on 10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The membrane was blocked with 5% skim milk in TBST for 2 hours and incubated with special primary antibody (anti-H3K9me2, anti-H3K9me3, Abcam, USA) at 4˚C for 12 hours. After there were washed three times with TBST, the membrane was incubated with horseradish peroxidase-conjugated secondary antibody (Abcam, USA) at 25˚C for 2 hours. Protein bands were visualized with the Image Station IS2000 (Kodak, Rochester, NY, USA).

Statistical analysis

All experiments were performed in triplicate, and all data are presented as means ± standard deviation. The statistical analysis conducted in this study was performed using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). The Shapiro-Wilk was used to test the normality of the distribution. For the data presenting a normal distribution, the mann-withney (two groups) and kruskal-wallis (more than two groups) were used to compare results among different groups. The Wilcoxon rank-sum test was used for non-normally distributed data. P<0.05 denoted statistically significant results.

Results

Polyinosinic:polycytidylic acid upregulated chemokine receptor 5 expression in THP-1-derived macrophages through toll-like receptor 3 signalling

The expression levels of diverse CCRs in THP-1 monocytes and THP1-Mφs were detected. As shown in Figure 1A, CCR1,CCR4,CCR5, and CCR6 were expressed in both THP-1 monocytes and THP1-Mφs. CCR1 expression was significantly higher in THP1-Mφs than in THP-1 monocytes (P=0.031). CCR2, CCR7, and CXCR4 expressions at the mRNA level were not detected in THP-1 monocytes and THP1-Mφs (Fig .1A). Then, the effects of polyI:C on CCR1, CCR4, CCR5, and CCR6 expressions were evaluated in THP-1 monocytes and THP1-Mφs. qRTPCR demonstrated that CCR5 expression was significantly elevated by polyI:C treatment in THP1-Mφs, while CCR5 expression was not significantly changed by polyI:C treatment in THP-1 monocytes (Fig .1B). The remarkably increased CCR5 expression in polyI:C-stimulated THP1- Mφs was also confirmed by flow cytometry (45.9% vs. 20.8%, P=0.017, Fig .1D).
Fig 1

Polyinosinic:polycytidylic acid (PolyI:C) upregulated chemokine receptor 5 (CCR5) expression in THP-1-derived macrophages (THP1-Mφs) through toll-like receptor 3 (TLR3) signalling. A. Expression profile of chemokine receptors in THP-1 monocytes and THP1-Mφs (Mφ) by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) (fold change at the mRNA level), B. CCR1, CCR4, CCR5, and CCR6 expressions in polyI:Cstimulated THP-1 monocytes and THP1-Mφs by qRT-PCR, C. CCR5 expression in polyI:C-stimulated THP1-Mφs by flow cytometry, D. TLR3 expression in THP1-Mφs with TLR3 siRNA by flow cytometry, E. Knockdown efficiency of TLR3 siRNA by qRT-PCR, and F. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with TLR3 siRNA. *; P<0.05 and **; P<0.01

Since macrophages can recognize polyI:C stimulation through TLR3 signalling. The effects of TLR3 silencing on CCR5 expression were detected in polyI:C-stimulated THP1-Mφs. Flow cytometry and qRT-PCR showed that TLR3 siRNA transfection significantly inhibited TLR3 expression in polyI:C-stimulated THP1-Mφs (80.2% vs. 48.8%, P=0.011, Fig .1C, E). CCR5 expression was significantly inhibited by TLR3 siRNA transfection in polyI:C-stimulated THP1-Mφs (P=0.044, Fig .1F). Polyinosinic:polycytidylic acid (PolyI:C) upregulated chemokine receptor 5 (CCR5) expression in THP-1-derived macrophages (THP1-Mφs) through toll-like receptor 3 (TLR3) signalling. A. Expression profile of chemokine receptors in THP-1 monocytes and THP1-Mφs (Mφ) by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) (fold change at the mRNA level), B. CCR1, CCR4, CCR5, and CCR6 expressions in polyI:Cstimulated THP-1 monocytes and THP1-Mφs by qRT-PCR, C. CCR5 expression in polyI:C-stimulated THP1-Mφs by flow cytometry, D. TLR3 expression in THP1-Mφs with TLR3 siRNA by flow cytometry, E. Knockdown efficiency of TLR3 siRNA by qRT-PCR, and F. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with TLR3 siRNA. *; P<0.05 and **; P<0.01

Polyinosinic:polycytidylic acid promoted THP-1- derived macrophage chemotaxis toward chemokine ligand 3 through toll-like receptor 3 signalling

Since CCR5 can be activated by CCL3, THP1-Mφ chemotaxis toward CCL3 was analysed. As shown in Figure 2A, THP1-Mφs easily migrated to rhCCL3 (P=0.0005). PolyI:C significantly increased THP1-Mφ chemotaxis toward rhCCL3 (P=0.0006, Fig .2A). In addition, TLR3 siRNA transfection significantly inhibited polyI:C-stimulated THP1-Mφ chemotaxis toward rhCCL3 (P=0.0029, Fig .2B).
Fig 2

Polyinosinic:polycytidylic acid (PolyI:C) promoted THP-1-derived macrophage (THP1-Mφ) chemotaxis to chemokine ligand 3 (CCL3) via toll-like receptor 3 (TLR3) signalling. A. THP1-Mφs migration toward CCL3 by polyI:C treatment and B. PolyI:C-stimulated THP1-Mφ migration toward CCL3 by TLR3 siRNA transfection. **; P<0.01.

Polyinosinic:polycytidylic acid upregulated Jumonji domain-containing protein 1A and JMJD1C in THP- 1-derived macrophages

Since histone methylation is involved in the inflammatory response of macrophages, the expression levels of 23 JHDM family members were observed in polyI:C-stimulated THP1-Mφs by qRTPCR. As shown in Figure 3A, polyI:C significantly increased JMJD1A, JMJD1C, JMJD2A, JARID1A, and HSPBAP1 expressions in THP1-Mφs (all P<0.01, Fig .3A). Notably, two JHDM2 subgroup members, JMJD1A and JMJD1C, were highly expressed and abundant in polyI:C-stimulated THP1-Mφs. In addition, TLR3 siRNA transfection significantly reversed the upregulatory effect of polyI:C on JMJD1A and JMJD1C on THP1-Mφs (JMJD1A, P=0.002; JMJD1C, P=0.018, Fig .3B). Therefore, JMJD1A and JMJD1C were chosen as the targets for the following investigative processes.
Fig 3

Jumonji C domain-containing histone demethylase (JHDM) family members expression in polyinosinic:polycytidylic acid (polyI:C)-stimulated THP-1- derived macrophages (THP1-Mφs). A. The expression levels of 23 JHDM family members in polyI:C-stimulated THP1-Mφs by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR,fold change at mRNA level) and B. Jumonji domain-containing protein (JMJD)1A and JMJD1C expression in polyI:C-stimulated THP1-Mφs transfected with toll-like receptor 3 (TLR3) siRNA. *; P<0.05 and **; P<0.01.

Polyinosinic:polycytidylic acid (PolyI:C) promoted THP-1-derived macrophage (THP1-Mφ) chemotaxis to chemokine ligand 3 (CCL3) via toll-like receptor 3 (TLR3) signalling. A. THP1-Mφs migration toward CCL3 by polyI:C treatment and B. PolyI:C-stimulated THP1-Mφ migration toward CCL3 by TLR3 siRNA transfection. **; P<0.01. Jumonji C domain-containing histone demethylase (JHDM) family members expression in polyinosinic:polycytidylic acid (polyI:C)-stimulated THP-1- derived macrophages (THP1-Mφs). A. The expression levels of 23 JHDM family members in polyI:C-stimulated THP1-Mφs by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR,fold change at mRNA level) and B. Jumonji domain-containing protein (JMJD)1A and JMJD1C expression in polyI:C-stimulated THP1-Mφs transfected with toll-like receptor 3 (TLR3) siRNA. *; P<0.05 and **; P<0.01.

Polyinosinic:polycytidylic acid-mediated Jumonji domain-containing protein 1A upregulated chemokine receptor 5 by inhibiting H3K9me2

In order to investigate whether the promoted expression of JMJD1A and JMJD1C is involved in the regulation of CCR5 expression, JMJD1A and JMJD1C were silenced in THP1-Mφs. As shown in Figure 4A, the protein expressions of JMJD1A and JMJD1C were significantly reduced in THP1-Mφs with JMJD1A or JMJD1C siRNA transfection. In addition, JMJD1A siRNA transfection significantly decreased CCR5 expression in both THP1-Mφs (P=0.007, Fig .4B) and polyI:C-stimulated THP1-Mφs (P=0.013, Fig .4B). However, CCR5 expression was not significantly influenced by JMJD1C siRNA transfection (Fig .4B). The downregulation of CCR5 expression induced by JMJD1A siRNA was also confirmed in polyI:Cstimulated THP1-Mφs by flow cytometry (43.8 vs. 32.6%, P<0.05, Fig .4C).
Fig 4

Polyinosinic:polycytidylic acid (PolyI:C)-mediated Jumonji domain-containing protein 1A (JMJD1A) upregulated chemokine receptor 5 (CCR5) by reducing H3K9me2. A. JMJD1A and JMJD1C expression in THP-1-derived macrophages (THP1-Mφs) treated with JMJD1A or JMJD1C siRNA by Western blot, B. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA and JMJD1C siRNA by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) (fold change at the mRNA level), C. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA by flow cytometry, D. H3K9me2 and H3K9me3 expression in polyI:C-stimulated THP1-Mφs by Western blot (protein level), E. H3K9me2 and H3K9me3 expressions in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA by Western blot (protein level), and F. H3K9me2 expression in the promoter region of CCR5 in THP1-Mφs by chromatin immunoprecipitation (ChIP) analysis. *; P<0.05 and **; P<0.01.

Since H3K9 is known to be the substrate of JMJD1A, we sought to determine if the regulatory role of JMJD1A in CCR5 expression was dependent on H3K9 methylation. As shown in Figure 4D, H3K9me2 expression was decreased in polyI:C-treated THP1- Mφs, while H3K9me3 expression was not significantly changed. In addition, H3K9me2 was significantly upregulated by JMJD1A siRNA transfection in THP1-Mφs. However, H3K9me3 expression was not influenced by JMJD1A siRNA transfection in polyI:Cstimulated THP1-Mφs (Fig .4E). In addition, polyI:C treatment downregulated H3K9me2 expression in the promoter region of CCR5 in THP1-Mφs (Fig .4F). Polyinosinic:polycytidylic acid (PolyI:C)-mediated Jumonji domain-containing protein 1A (JMJD1A) upregulated chemokine receptor 5 (CCR5) by reducing H3K9me2. A. JMJD1A and JMJD1C expression in THP-1-derived macrophages (THP1-Mφs) treated with JMJD1A or JMJD1C siRNA by Western blot, B. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA and JMJD1C siRNA by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) (fold change at the mRNA level), C. CCR5 expression in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA by flow cytometry, D. H3K9me2 and H3K9me3 expression in polyI:C-stimulated THP1-Mφs by Western blot (protein level), E. H3K9me2 and H3K9me3 expressions in polyI:C-stimulated THP1-Mφs transfected with JMJD1A siRNA by Western blot (protein level), and F. H3K9me2 expression in the promoter region of CCR5 in THP1-Mφs by chromatin immunoprecipitation (ChIP) analysis. *; P<0.05 and **; P<0.01.

Discussion

Macrophage chemotaxis is an important component of ALI pathogenesis. It is known that viral infections can induce alveolar macrophage recruitment, but the regulatory mechanisms of viral infection (polyI:C) on monocyte-derived macrophages are still unclear. Thus, in this study, we have explored the regulatory mechanisms of polyI:C on THP1-Mφs. The results showed that polyI:C significantly upregulated CCR5 in THP1-Mφs and promoted THP1-Mφ chemotaxis toward CCL3 via TLR3 signalling. In addition, polyI:C-upregulated CCR5 was mediated by JMJD1A, and H3K9me2 was downregulated in the promoter region of CCR5 in THP1-Mφs. Since CCRs are important in macrophage chemotaxis, the expression levels of diverse CCRs were examined in THP1- Mφs after polyI:C treatment. Our results demonstrated that only CCR5 was significantly upregulated by polyI:C treatment in THP1-Mφs. CCR5 is a cell surface G proteincoupled receptor that is involved in inflammatory response via interaction with specific chemokine ligands, including CCL3, CCL4, and CCL5 (14-16). The activation of CCR5 and CCL5 is required to prevent the apoptosis of virusinfected macrophages (17). In addition, CCR5 is involved in obesity-induced adipose tissue inflammation via regulation of macrophage recruitment (18, 19). Moreover, it has been reported that polyI:C-treated macrophages can promote CCR5 expression (20), which is consistent with the findings of our study. It was supposed that CCR5 is involved in polyI:C-induced inflammation in THP1-Mφs. Subsequently, THP1-Mφ chemotaxis toward CCL3 (a ligand of CCR5) was investigated. The results suggest that polyI:C significantly increased THP1-Mφ chemotaxis toward CCL3. A previous study reported that CCL3 expression was significantly elevated in the lung of a murine model of LPS-induced ALI and mediated an enhanced inflammatory injury-possibly by recruiting macrophages (21). Therefore, polyI:C-upregulated CCR5 contributes to the promotion of macrophage chemotaxis by interacting with CCL3. Moreover, our results also suggest that TLR3 siRNA transfection significantly suppressed CCR5 expression in polyI:C-stimulated THP1-Mφs and inhibited chemotaxis toward CCL3. TLR-3 is responsible for anti-viral immunity against several virus infections via double-stranded RNA recognition and the activation of multiple antiviral factors in macrophages (20). Similarly, TLR-3 is activated in macrophages in response to encephalomyocarditis infection via type 1 IFN production. It has been reported that CCR5 may participate in virus replication and acts as the primary receptor for regulating encephalomyocarditis infection in mediating inflammatory response–related genes in macrophages (22). These results indicate that macrophages may recognize polyI:C stimulation through TLR3 signalling. PolyI:C may upregulate CCR5 expression and promote THP1-Mφ chemotaxis toward CCL3 through TLR3 signalling. Histone demethylation, dynamically regulated by JHDMs, is implicated in the regulation of inflammatory response of macrophages (23). Previous studies have reported that JMJD3 is over-expressed in LPS-activated macrophages, which regulates diverse genes involved in LPS-induced immune and inflammatory responses (10, 24). However, few studies have focused on the regulatory mechanisms of polyI:C in histone demethylation in macrophages. In this study, the expression levels of 23 JHDM family members were detected in polyI:Cstimulated THP1-Mφs. The expression levels of JMJD1A, JMJD1C, JMJD2A, JARID1A, and HSPBAP1 were significantly increased by polyI:C in THP1-Mφs, while that of JMJD3 was not significantly changed. These results indicated that the effects of polyI:C on inflammatory responses of macrophages might differ from LPS. Since JMJD1A and JMJD1C could be regulated by TLR3 in polyI:C-stimulated THP1-Mφs, the regulatory roles of JMJD1A and JMJD1C on CCR5 were further analysed in this study. It was revealed that CCR5 was significantly downregulated by JMJD1A siRNA transfection in polyI:Cstimulated THP1-Mφs, while CCR5 expression was not significantly influenced by JMJD1C siRNA transfection. The regulatory role of JMJD1A has been found to affect the proliferation, migration, and invasion of cancer cells in various cancer types (25-27). It has been reported that JMJD1A inhibition suppresses tumour growth by downregulating angiogenesis and macrophage infiltration (28). Our findings indicate that polyI:C treatment may induce a similar macrophage inflammatory response with cancer; PolyI:C may enhance CCR5 expression by upregulating JMJD1A in THP1-Mφs. Since JMJD1A is a H3K9 demethylase, the H3K9 methylation state of CCR5 was analysed in polyI:Cstimulated THP1-Mφs. Our results showed that H3K9me2 expression was significantly decreased by polyI:C treatment in THP1-Mφs. H3K9me2 downregulation might have attributed to the upregulation of JMJD1A. However, H3K9me3 expression was not significantly influenced by polyI:C treatment. Our findings indicate that the regulatory role of JMJD1A on CCR5 was dependent on H3K9me2. In addition, H3K9me2 was upregulated by JMJD1A siRNA transfection in THP1-Mφs, while H3K9me2 expression was not significantly influenced by JMJD1A siRNA in polyI:C-stimulated THP1-Mφs. This may be explained by the fact that some other upregulated JHDMs induced by polyI:C, such as JMJD1C, and JMJD2A may share a target with JMJD1A. JMJD1C and JMJD2A exhibit redundant effects on H3K9me2 expression. The presence of H3K9me2 in the promoter region of target genes typically results in reduced expressions of its targets. A previous study has reported that H3K9 exhibits a low methylation level in response to the activation of dendritic cells and is erased from the promoters of some activated inflammatory genes (29). Consistent with the results of that study, our results reveal that H3K9me2 expression was significantly reduced by polyI:C treatment in the promoter region of CCR5 in THP1-Mφs. We suspected that polyI:C-mediated JMJD1A upregulation may upregulate CCR5 by reducing H3K9me2 in the promoter region of CCR5. Interestingly, JMJD1A is also a hypoxiainducible gene that has been found to be upregulated in hypoxia-stimulated macrophages. However, hypoxia treatment decreases CCR5 expression via H3K9me2 upregulation in the promoter region of CCR5 (30). This may be explained by the effects of hypoxia-induced repressive JMJDs, which can overwhelm the effects of JMJD1A.

Conclusion

The present study revealed that polyI:C upregulated JMJD1A expression in THP1-Mφs, thereby elevating the CCR5 expression by reducing H3K9me2 in the promoter region of CCR5 via TLR3 signalling. However, this study is still limited to the cellular level, and the validation of these results in animal models is required in future research.
Table 1

Sequences of specific primers used in quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)


Gene Primer sequence (5ˊ-3ˊ)

CCR1F: CGAAAGCCTACGAGAGTGGAA
R: CGGACAGCTTTGGATTTCTTCT
CCR2F: GAGCCATACCTGTAAATGCC
R: GAGCCCAGAATGGTAATGTG
CCR4F: CATGAACCCCACGGATATAGCA
R: CTACTCCCCAAATGCCTTGATG
CCR5F: TGTCCCCTTCTGGGCTCACTAT
R: TGGACGACAGCCAGGTACCTA
CCR6F: TCGCCATTGTACAGGCGACTA
R: CGCTGCCTTGGGTGTTGTAT
CCR7F: CCTGGGGAAACCAATGAAAAGC
R: GAGCATGCCCACTGAAGAAGC
CXCR4F: TTCCTGCCCACCATGTAGTC
R: TCGATGCTGATCCCAATGTA
FBXL10F: CAGTGGGTGGAGGGACTAAA
R: ACTGAGGTGGAGCTTGGAGA
FBXL11F: ATAACCAACCGTTCCCACCT
R: TGCCCAGTCCATCATAATCC
JMJD1AF: ATGCCCACACAGATCATTCC
R: CTGCACCAAGAGTCGATTTT
JMJD1BF: AACTTCCTCAAACCCCCTTG
R: CCCATCACCATCTCCTTCAC
JMJD1CF: TCCAGAATCCCAGTCACCAC
R: CAGCAAATCCCGTAAGGTTG
JMJD2AF: CAGAGGACCAAGCCATTGAT
R: ATTGGCTGAACACCGAGAAC
JMJD2BF: GGGGAGGAAGATGTGAGTGA
R: CTATGGGTGCCTCCTTCTCA
JMJD2CF: TGCCTGAGGTTCTGTCCATT
R: GCTGCTATCTGGCTTGTGGT
JMJD2DF: AAATATGTACGGGGCAACCA
R: TACTCAGACCTGGGGGTACG
JMJD3F: CTGATGCTAAGCGGTGGAAG
R: TGTTGATGTTGACGGAGCAG
JMJD4F: ACTGGGTCAATGGCTTCAAC
R: AGGACCAGGAGCCTCTTCTC
JMJD5F: ACATCAGCATCCCCGACTAC
R: AGGGTACAGAGCCCCTGACT
JARID1AF: TGAACGATGGGAAGAAAAGG
R: AGCGTAATTGCTGCCACTCT
JARID1BF: TTGGGATTGAAAAGGAAGCA
R: CAGCAATTTCCCTTCATTGG
JARID1CF: CAGGGCTTACTGGAGAATGG
R: TTCTCATCCAGGGTCACCTC
JARID1DF: ACTGAACTCCGGGTCCTTCT
R: GCTTCAGGCACCTCTACACC
JARID2F: CTGTCTGGAGTGTGCTCTGC
R: ACGTCCACTGTCGCTCTCTT
UTXF: CGTGTCGTATCAGCAGGAAA
R: CACCCCAGTAACCTTCAGGA
HRF: CAGTCAGCGTCACTCAGCA
R: CGATCCCAGACACCTAGCA
HSPBAP1F: AAGCTCAAAGACATGCGGTTA
R: CAGGCTCTGGTATTTTGTGGA
HIFANF: ACAATCCCGACTACGAGAGGT
R: GCCACTTTCTGATGAGCTTTG
MINAF: ACTTTGGCTCCTTGGTTGG
R: CCCGGCTTCAGCATAAAC
PHF2F: ATCTTTAAGTCCCGGTCGAAG
R: TTCCTCTTGGCACTCTTTT
PHF8F: CTGATGATGATGACCCTGCTT
R: TTCTTCTTTTGGGCCTTCTGT
PHF20F: ACCCGGCTCCCCAAAGGTGA
R: CTGCCACTGGTGCTGGGAGC
CCR5-ChIPF: TGTGGGCTTTTGACTAGATGA
R: TAGGGGAACGGATGTCTCAG
GAPDHF: CAACTGGTCGTGGACAACCAT
R: GCACGGACACTCACAATGTTC

  29 in total

1.  Ccr5 regulates inflammatory gene expression in response to encephalomyocarditis virus infection.

Authors:  Benjamin S Christmann; Jason M Moran; Jennifer A McGraw; R Mark L Buller; John A Corbett
Journal:  Am J Pathol       Date:  2011-10-11       Impact factor: 4.307

2.  CCL5-CCR5 interaction provides antiapoptotic signals for macrophage survival during viral infection.

Authors:  Jeffrey W Tyner; Osamu Uchida; Naohiro Kajiwara; Edy Y Kim; Anand C Patel; Mary P O'Sullivan; Michael J Walter; Reto A Schwendener; Donald N Cook; Theodore M Danoff; Michael J Holtzman
Journal:  Nat Med       Date:  2005-10-02       Impact factor: 53.440

Review 3.  Role of chemokines in the pathogenesis of acute lung injury.

Authors:  Madhav Bhatia; Rachel L Zemans; Samithamby Jeyaseelan
Journal:  Am J Respir Cell Mol Biol       Date:  2012-02-09       Impact factor: 6.914

4.  A critical function of toll-like receptor-3 in the induction of anti-human immunodeficiency virus activities in macrophages.

Authors:  Yu Zhou; Xu Wang; Manqing Liu; Quan Hu; Li Song; Li Ye; Dunjin Zhou; Wenzhe Ho
Journal:  Immunology       Date:  2010-07-16       Impact factor: 7.397

Review 5.  Chemokine receptor CCR5: insights into structure, function, and regulation.

Authors:  Martin Oppermann
Journal:  Cell Signal       Date:  2004-11       Impact factor: 4.315

6.  CCL2/CCR2, but not CCL5/CCR5, mediates monocyte recruitment, inflammation and cartilage destruction in osteoarthritis.

Authors:  Harini Raghu; Christin M Lepus; Qian Wang; Heidi H Wong; Nithya Lingampalli; Francesca Oliviero; Leonardo Punzi; Nicholas J Giori; Stuart B Goodman; Constance R Chu; Jeremy B Sokolove; William H Robinson
Journal:  Ann Rheum Dis       Date:  2016-12-13       Impact factor: 19.103

7.  JMJD1A promotes tumorigenesis and forms a feedback loop with EZH2/let-7c in NSCLC cells.

Authors:  Min Zhan; Feiqiu Wen; Lijuan Liu; Zebin Chen; Hong Wei; Honghao Zhou
Journal:  Tumour Biol       Date:  2016-03-05

8.  CCR5 plays a critical role in obesity-induced adipose tissue inflammation and insulin resistance by regulating both macrophage recruitment and M1/M2 status.

Authors:  Hironori Kitade; Kazuki Sawamoto; Mayumi Nagashimada; Hiroshi Inoue; Yasuhiko Yamamoto; Yoshimichi Sai; Toshinari Takamura; Hiroshi Yamamoto; Ken-ichi Miyamoto; Henry N Ginsberg; Naofumi Mukaida; Shuichi Kaneko; Tsuguhito Ota
Journal:  Diabetes       Date:  2012-04-03       Impact factor: 9.461

9.  TLR4 signaling induces TLR3 up-regulation in alveolar macrophages during acute lung injury.

Authors:  Xibing Ding; Shuqing Jin; Yao Tong; Xi Jiang; Zhixia Chen; Shuya Mei; Liming Zhang; Timothy R Billiar; Quan Li
Journal:  Sci Rep       Date:  2017-02-15       Impact factor: 4.379

Review 10.  Mechanisms of Regulation of the Chemokine-Receptor Network.

Authors:  Martin J Stone; Jenni A Hayward; Cheng Huang; Zil E Huma; Julie Sanchez
Journal:  Int J Mol Sci       Date:  2017-02-07       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.