S Mehdi Ebrahimi1, S Zahra Bathaie1, Nassim Faridi1, Mohammad Taghikhani1, Manouchehr Nakhjavani2, Soghrat Faghihzadeh3. 1. Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran. 2. Endocrinology and Metabolism Research Center (EMRC), Vali-Asr Hospital, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. 3. Department of Statistics, Zanjan University of Medical Sciences, Zanjan, Iran.
Abstract
Hyperglycemia is a hallmark of diabetes, which is associated with protein glycation and misfolding, impaired cell metabolism and altered signaling pathways result in endoplasmic reticulum stress (ERS). We previously showed that L-lysine (Lys) inhibits the nonenzymatic glycation of proteins, and protects diabetic rats and type 2 diabetic patients against diabetic complications. Here, we studied some molecular aspects of the Lys protective role in high glucose (HG)-induced toxicity in C2C12 myotubes and 3T3-L1 adipocytes. C2C12 and 3T3-L1 cell lines were differentiated into myotubes and adipocytes, respectively. Then, they were incubated with normal or high glucose (HG) concentrations in the absence/presence of Lys (1 mM). To investigate the role of HG and/or Lys on cell apoptosis, oxidative status, unfolded protein response (UPR) and autophagy, we used the MTT assay and flow cytometry, spectrophotometry and fluorometry, RT-PCR and Western blotting, respectively. In both cell lines, HG significantly reduced cell viability and induced apoptosis, accompanying with the significant increase in reactive oxygen species (ROS) and nitric oxide (NO). Furthermore, the spliced form of X-box binding protein 1 (XBP1), at both mRNA and protein levels, the phosphorylated eukaryotic translation initiation factor 2α (p-eIf2α), and the Light chain 3 (LC3)II/LC3I ratio was also significantly increased. Lys alone had no significant effects on most of these parameters; but, treatment with HG plus Lys returned them all to, or close to, the normal values. The results indicated the protective role of Lys against glucotoxicity induced by HG in C2C12 myotubes and 3T3-L1 adipocytes.
Hyperglycemia is a hallmark of diabetes, which is associated with protein glycation and misfolding, impaired cell metabolism and altered signaling pathways result in endoplasmic reticulum stress (ERS). We previously showed that L-lysine (Lys) inhibits the nonenzymatic glycation of proteins, and protects diabetic rats and type 2 diabeticpatients against diabetic complications. Here, we studied some molecular aspects of the Lys protective role in high glucose (HG)-induced toxicity in C2C12 myotubes and 3T3-L1 adipocytes. C2C12 and 3T3-L1 cell lines were differentiated into myotubes and adipocytes, respectively. Then, they were incubated with normal or high glucose (HG) concentrations in the absence/presence of Lys (1 mM). To investigate the role of HG and/or Lys on cell apoptosis, oxidative status, unfolded protein response (UPR) and autophagy, we used the MTT assay and flow cytometry, spectrophotometry and fluorometry, RT-PCR and Western blotting, respectively. In both cell lines, HG significantly reduced cell viability and induced apoptosis, accompanying with the significant increase in reactive oxygen species (ROS) and nitric oxide (NO). Furthermore, the spliced form of X-box binding protein 1 (XBP1), at both mRNA and protein levels, the phosphorylated eukaryotic translation initiation factor 2α (p-eIf2α), and the Light chain 3 (LC3)II/LC3I ratio was also significantly increased. Lys alone had no significant effects on most of these parameters; but, treatment with HG plus Lys returned them all to, or close to, the normal values. The results indicated the protective role of Lys against glucotoxicity induced by HG in C2C12 myotubes and 3T3-L1 adipocytes.
Hyperglycemia is a major hallmark of diabetes mellitus and exerts deleterious or toxic effects in vivo and on different cell types. High glucose (HG) concentration results in the glucotoxicity that characterized by dysfunction of the cells and eventually ends to diabetes complications [1]. The circulating HG not only alters vascular endothelial smooth muscle cells (VSMCs) [2], but also other cell types, including skeletal muscle cells and adipocytes [3, 4]. In the normal situation, insulin stimulates glucose (Glc) uptake by both muscle and fat cells [5], the process that was distorted in the absence of insulin or in insulin resistance.HG can trigger a series of cellular responses and induces direct damage to biological macromolecules including lipids, proteins, and DNA [6]. The nonenzymatic glycation of proteins induced by HG alters protein folding and function, and has been known as the main cause of protein misfolding and damage, which is the source of many diabetes complications [7, 8]. On the other hand, the accumulation of the misfolded proteins in the cells induces endoplasmic reticulum stress (ERS) and unfolded protein response (UPR), which are involved in the development of several conditions including diabetes complications [9-11]. HG can also activate autophagy via ERS signaling [12, 13] that may subsequently lead to the autophagic-induced apoptosis.The eukaryotic initiation factor 2α (eIF2α) has been known as the important sensor of the ERS. In response to environmental stresses, a family of protein kinases phosphorylate eIF2α to alleviate cellular injury or alternatively induce apoptosis. This process has been introduced as one of the three arms of the UPR [14]. Another arm of the UPR is XBP1 splicing, which is also activated as a cellular response to ERS [15]. Activation of both of these arms mainly led to the cell apoptosis.Previous studies have confirmed the destructive roles of reactive oxygen and nitrogen species (superoxide anion/ROS and peroxynitrite, respectively) in tissues and cells under HG condition [16]. Overproduction of nitric oxide (NO) in the presence of superoxide, rapidly forms peroxynitrite, which is a very strong oxidant and has been detected in heart, kidney, nerve and retina of diabetic subjects [17].Chemical chaperones are small molecules that protect proteins against different types of stresses (such as glycation), stabilize and conserve protein structure, and inhibit protein aggregation [18]. Amino acids are one of the main families of chemical chaperones. L-lysine (Lys), arginine, proline and glycine are the major amino acids in the chemical chaperone family. The free amino group(s) in the amino acids acts as a chemical decoy for reducing sugars [19-21]. So that, in the HG conditions, the free amino acids bind to Glc and competitively inhibit the reaction between Glc and the free amino groups in the side chain or at the N-terminal of proteins. In this case, they prevent protein misfolding and/or unfolding. Lys with a long side chain and two free amino groups shows no toxicity in the rat up to 5% w/w in oral intake [22], inhibits the nonenzymatic glycation of proteins, protects the protein structure and conserves the folding of many proteins in both in vitro experiments [19, 23–25] and in the rat model of diabetes [19, 26]. Lys treatment has also shown some improvement against complications in type 2 diabeticpatients [24, 25]. Continuing with our previous studies regarding the study of the toxic effects of HG in different biological processes and the protective role of chemical chaperones (especially Lys), here we investigated the effect of Lys on HG-induced stresses in C2C12 myotubes and 3T3-L1 adipocytes. Therefore, in addition to HG-induced oxidative stress and cell death, the effect of Lys on some markers of the UPR (phosphorylation of eIF2α and splicing of XBP1) and autophagy (Light chain 3 (LC3) accumulation) in HG condition were investigated.
Materials and methods
Materials
The C2C12 and 3T3-L1 cell lines were purchased from the Iranian Biological Resource Center (IBRC, Tehran, Iran). Penicillin-streptomycin (C-A4122) was purchased from Biosera (Biosera, UK). Bovineserum albumin (BSA) (A2153), insulin (I1882), Lys (L8662), Oil Red O (O0625), dexamethasone, 3-isobutyl-1-methylxanthine (IBMX) (I7018), RIPA buffer (R0278), and protease inhibitor (P8340) were purchased from Sigma Chem. Co., St. Louis, USA. Glucose (Glc) (K1665937) was bought from Merck (Darmstadt, Germany). Fetal bovineserum (FBS) (S0115) was purchased from Biochrom, Berlin. Dulbecco’s modified Eagle’s medium (DMEM/low (1803391X) and HG (H1674879)) were purchased from Life Technology, (Gibco), CA. Annexin V-FITC-PI apoptosis detection kit (BMS500FI-100) was purchased from eBioscience (San Diego, US). Horseserum was bought from Veterinary Medicine Faculty, University of Tehran, Iran. The biotin-HRP-labeled anti-rabbit IgG as a secondary antibody were purchased from Kermanshah University of Medical Sciences. The antibody against XBP1s (sc-7160) was from Santa Cruz, USA; and the antibodies against p-eIF2α (phospho-Ser51) (ab32157), eIF2α (ab5369), β-actin (ab227387), and LC3 (48394) were bought from Abcam Inc., Cambridge, MA. ECL plus Western blotting kit (RPN2232) and polyvinylidene difluoride membrane (PVDF) (3010040001) were bought from Amersham Biosciences, Stockholm, Sweden. All other materials and reagents were of analytical grade.
Cell culture
Mouse skeletal myoblast cell line C2C12 was seeded in 60-mm-diameter culture dishes and grown in 5.5 mM Glc as a normal glucose (NG) or 25 mM Glc as a HG medium in DMEM supplemented with 10% FBS, 1% penicillin 50 U /streptomycin 50 μg/ml (pen/strep) and 2 mM L-glutamine in a 5% CO2 humidified incubator at 37°C (CO2 incubator). The NG and HG conditions for 3T3-L1 cells were 25 and 50 mM Glc, respectively.
Cell differentiation induction
To induce differentiation of C2C12 from myoblasts to myotubes, when the cells were 60% confluent, the growth medium was switched to differentiation medium, which was containing 2% horseserum supplemented with insulin [27]. After 48 h of differentiation, the medium was changed every day up to 6 days. After that, the creatine kinase (CK) activity was determined in the C2C12 myoblasts to confirm their differentiation into myotubes [28]. After 6 days, cells were washed twice with calcium- and magnesium-free, ice-cold phosphate-buffered saline (PBS), scraped from the plates into 1 ml PBS and centrifuged at 16,000 × g for 10 min at 4°C and subjected to the enzymatic assay for determination of the CK specific activity.The CK activity was measured in units using reagents from Biovision (USA Cat: K777). Then, the total protein in each sample was determined by the Bradford method [29], and the CK specific activity was reported as Unit/μg total protein.To induce the differentiation of preadipocyte cell line, 3T3-L1, to adipocytes, the cells were grown in 6-well plate in DMEM containing the same components as above. After reaching the confluence, they were extensively rinsed and adipocyte cell differentiation was induced by changing the medium to DMEM containing 10% FBS, 1% pen/strep, 0.5 mM methyl isobutyl xanthine (IBMX), 0.25 μM dexamethasone, 100 μM indomethacin, and 1 μg/ml insulin, for 2 to 3 weeks. Intracellular lipid accumulation due to the progression of the cell differentiation was microscopically assessed using Oil Red O staining, by the method was described by Ramírez-Zacarías et al. [30].
Effect of HG and/or Lys treatment on the cell viability
For investigating the effect of HG/ Lys on the cell viability, the differentiated cells, C2C12 and 3T3-L1 were plated in the 96-well at 2.5×104 cells/well exposed to either NG or HG with different concentrations of Lys (0.5, 1, 2, 5, and 10 mM), and incubated up to 48 h. Then, the viability of the cells was evaluated by MTT assay [31].Briefly, after 48 h, the medium was carefully removed; and then, 200 μl of medium containing 20 μl MTT (5 mg/ml) was added to each well. The cells were then incubated for 4 hours at 37°C. Then, the medium of wells was removed and 100 μl DMSO was added to each well. Finally, the color intensity of formazan solution was monitored by Multi-Mode Microplate Reader (Cytation™3, Biotek, USA) at 570 nm. In this experiment, the control cells were assumed 100% viable and the viability of the treated cells was calculated relative to the control and expressed as the percentages (%) of viable cells.Then, other sets of experiments were designed to investigate the cytotoxicity of HG, Lys (1 mM) plus HG (HG+Lys) in comparison with the control group in NG at different time intervals of 0, 2, 4 and 6 h of incubation, and various parameters were evaluated in these cells.
Apoptosis detection by flow cytometry
Annexin V-FITC apoptosis detection kit was used to detect the apoptosis in the cells at different conditions. The treated cells were finally trypsinized and pelleted by centrifugation at room temperature, 1200 rpm for 5 min, and then, they were washed twice with cold PBS. Cell suspensions were incubated with Annexin V- FITC and propidium iodide (PI) for 15 min at room temperature in the dark and analyzed by BD FACSCantoTM II flow cytometer (USA). The obtained raw results were analyzed by FlowJo software version 7.6 and expressed as the percentage of cells undergoing apoptosis.
Measuring the ROS and NO production
Total intracellular ROS was determined by the permeable fluorescent probe, 70-dichlorohydrofluorescein diacetate (CM-H2DCFDA) [32, 33]. The CM-H2DCFDA dye in the presence of ROS converts to fluorescent DCF, which can be considered as a measure of ROS. The excitation and emission wavelengths of DCF were 490 and 520 nm, respectively [32, 33]. The fluorescence intensity (FI) of DCF in the cells was read and expressed as arbitrary unit (AU).NO production in the mentioned cells was determined by Sigma-Aldrich 23479 Nitrate/nitrite Assay Kit Colorimetric (St Louis, USA) in both cell lines, in the presence of HG and/ or Lys. Total NO (NO2- + NO3-) was determined using Griess reagent that produces the azo compound with maximum absorption at 570 nm. The standard curves were then plotted using different concentrations of nitrite and nitrate in the similar reagent and at the same wavelength. Then, the concentration of total NO was calculated by interpolating of the sample absorbency using the linear standard curve.
Total mRNA extraction and RT-PCR
Total RNA extraction was performed from the Lys treated C2C12 myotubes and 3T3-L1 adipocytes using the protocol supplied with the RiboExTM kit (GeneAll®, Korea) according to the manufacturer’s instructions. Total RNA (2 μg) was reverse transcribed (RT) with HyperscriptTM RT Mastermix Kit (GeneAll, Korea). The final PCR products were electrophoresed on 1–1.5% agarose gels containing EB along with DNA Ladder (SMOBIO DM2300 ladder). The expression and splicing of XBP1 mRNA was determined using RT-PCR. The cDNA sample was amplified using Taq DNA Polymerase Master Mix, Red (Amplicon) in the presence of the XBP1 mRNA primer pair (forward primer: TTACGAGAGAAAACTCATGGCC and reverse primer: GGGTCCAAGTTGTCCAGAATGC). Briefly, the reaction conditions consisted of 2 μl of cDNA and 0.2 μM primers in a final volume of 20 μl of master mix. Each cycle consisted of denaturation at 95°C for 15 s, annealing at 60°C for 5 s and extension at 72°C for 10 s, respectively. Amplified fragments covering flanking exon fragments consist sXBP1 (spliced XBP1) and uXBP1 (unspliced XBP1) were separated on 1–1.5% agarose gels containing EB along with DNA Ladder (SMOBIO DM2300 ladder). The measurements were performed by three independent experiments in triplicate. The intensity of the PCR product bands was assessed in the Image J software (NIH approved) and semiquantitative data were obtained.
Western blot analysis
The expression levels of p-eIf2α, XBP1 and LC3 in the mentioned cells at different conditions and times was investigated by Western blotting.Cells were rinsed with PBS and then solubilized in a lysis buffer containing a complete cocktail of protease inhibitors. In order to remove any insoluble material and clarify cell lysate, the lysate was immediately centrifuged at 13000 ×g for 10 min at 4°C, the supernatants were collected and stored at -80°C. The total sample protein content was determined by the Bradford protein assay. Equal amounts of crude protein homogenates (30 μg) from whole-cell extracts were combined with Laemmli sample buffer and fractionated by SDS-PAGE (8–15%). After electrophoresis, the proteins were transferred to a PVDF for Western blot analysis. Membranes were blocked with 5% BSA in Tris-buffered saline containing 0.1% Tween-20 (TBST). After that, the membranes were incubated with the primary antibodies diluted in TBST and 3% bovineserum albumin overnight at 4°C. Then, the membranes were washed three times in TBST and incubated with the appropriate concentration of secondary antibody coupled with horseradish peroxidase diluted in TBST with a 5% BSA (1:10,000) for 1 h, at room temperature. After an additional three times washing, immune complexes were visualized through autoradiography using ECL. The films were scanned with an image scanner using LabScan software and quantified with the Image J analysis software.
Statistical analysis
Data were indicated as mean ± SD of at least three independent repeats. Statistical analysis was carried out using the repeated-measures ANOVA followed by Tukey's Post Hoc analysis between different groups, and at different time intervals. The P-value <0.05 was considered as statistically significant value. The statistical analysis of the data between groups was presented in the results section and showing by stars in the figures. The within group analyses at different time intervals and the p-values, if statistically significant, were also shown in the figures.
Results
Differentiated phenotypes of C2C12 myotube and 3T3L1 adipocyte
As shown in Fig 1, the CK specific activity was significantly (p = 0.027) increased in C2C12 cells after six-day incubation in the differentiation media. S1A and S1B Fig show the C2C12 cells before and after differentiation, respectively.
Fig 1
Biochemical assessment of the C2C12 differentiation.
The creatine kinase specific activity in the cell lysates at first and after 6 days of incubation in the differentiation media. The data was statistically analyzed by t-test and the P-value was shown in the figure.
Biochemical assessment of the C2C12 differentiation.
The creatine kinase specific activity in the cell lysates at first and after 6 days of incubation in the differentiation media. The data was statistically analyzed by t-test and the P-value was shown in the figure.Oil Red O staining was used to show the differentiation of the 3T3-L1 cells. Before differentiation there was no or very rare lipid droplet in the cells. Thus, the cells are colorless (figure not shown). However, as S2A and S2B Fig show, after two- to three-week incubation in the induction media and differentiation, a significant increase in the accumulation of lipid droplets was observed in the cells.
Lys attenuates the HG-induced cell death
Fig 2A shows the results of the MTT assay in both differentiated cells treated with Lys, which indicates no significant toxicity of different Lys concentrations (0.5 to 10 mM) against both C2C12 myotubes and 3T3-L1 adipocytes. However, avoiding any other toxicity, we used the mild Lys concentration (1 mM) for further experiments, in both cell lines.
Fig 2
The in vitro viability assay of the cells in different media.
(A) Graphical representation of the MTT assay of C2C12 myoblasts and 3T3L-1 adipocytes after 24 hours incubation with 0.5 to 10 mM Lys. As the figure indicated, there is no toxicity of different concentrations of Lys against these cells. Thus Lys 1 mM was used in all other experiments. (B) and (C) show the effect of HG and HG+Lys on cell viability at different time intervals of 2, 4 and 6 hours, which was determined by MTT assay in C2C12 myotubes and 3T3L-1 adipocytes, respectively. Time zero, 0, was considered as control.
The in vitro viability assay of the cells in different media.
(A) Graphical representation of the MTT assay of C2C12 myoblasts and 3T3L-1 adipocytes after 24 hours incubation with 0.5 to 10 mM Lys. As the figure indicated, there is no toxicity of different concentrations of Lys against these cells. Thus Lys 1 mM was used in all other experiments. (B) and (C) show the effect of HG and HG+Lys on cell viability at different time intervals of 2, 4 and 6 hours, which was determined by MTT assay in C2C12 myotubes and 3T3L-1 adipocytes, respectively. Time zero, 0, was considered as control.Fig 2B and 2C show the effect of HG and HG+Lys, respectively, on viability of both C2C12 myotubes and 3T3-L1 adipocytes at different time courses (2, 4 and 6 h). These figures indicate a significant decrease (p = 0.000) in the cell viability due to the HG treatment in comparison with the control cells. Lys treatment significantly overcomes the HG toxicity. So that, the significant differences in the cell viabilities were observed between groups treated with Lys+HG and groups treated with HG in C2C12 myotubes (p = 0.034) and in 3T3-L1 adipocytes (p = 0.038). Despite the improvement effect of Lys, the viability of the cells treated with Lys+HG was significantly (p = 0.000) lower than control cells, in both cell lines. The statistical differences in cell viability within the groups at different time intervals in both cell types are shown in these figures.
HG induces and Lys inhibits the apoptotic cell death
To demonstrate the apoptosis induction in the cells due to HG and in the presence of both HG+Lys, we applied Annexin V and PI staining using Flow Cytometry. Fig 3A and 3B show the percentages of C2C12 and 3T3-L1 cells, respectively, at each quarter. So that, the population and percentages of alive cells (both Annexin V and PI negative, left bottom), at early apoptosis (positive for Annexin V and negative for PI, left upper), late apoptosis (negative for Annexin V and positive PI, right upper), and necrosis (both Annexin V and /PI positive, right bottom) are shown at each condition. The numeric estimates of the alive and apoptotic (the sum of both early and late apoptosis) cells after 6 h incubation are tabulated in Table 1. As the data indicate, the cell viability of both differentiated C2C12 and 3T3-L1 cells were significantly (p = 0.000) decreased due to the exposure to HG. However, Lys treatment attenuates significantly (p = 0.000) both early and late apoptosis in both cell types, after 6 h.
Fig 3
The panel of the flow cytometry data of the cells in different conditions.
Q1, early apoptotic cells (annexin V+/PI−); Q2, late apoptotic cells (annexin V+/PI+); Q3, necrotic cells (annexin V−/PI+) and Q4, live cells (annexin V−/PI−). (A) The upper figures show the flow cytometry results of C2C12 myotubes and (B) the bottom show the data of 3T3-L1 adipocytes after 6 h incubation in the medium containing normal Glc (Control), high Glc (HG) and both HG and Lys (HG+Lys). The control cells are shown at the left, the cells treated with HG and HG+Lys are shown in the middle and right, respectively. The percentages of the cells in each state are shown in the figures, and the overall data of the alive and apoptotic cells (early+late) are shown in Table 1.
Table 1
The flow cytometry data of C2C12 myotubes and 3T3-L1 adipocytes after 6 h incubation in different conditions.
Living Cells
(Early + Late) Apoptotic Cells
C2C12
Control
92.5
6.94
HG
48.6
51.28
HG + Lys
75.6
24.16
3T3-L1
Control
97.5
1.44
HG
36.5
55.9
HG + Lys
75.5
23.75
The statistical differences between all groups were significant, p = 0.000.
The panel of the flow cytometry data of the cells in different conditions.
Q1, early apoptotic cells (annexin V+/PI−); Q2, late apoptotic cells (annexin V+/PI+); Q3, necrotic cells (annexin V−/PI+) and Q4, live cells (annexin V−/PI−). (A) The upper figures show the flow cytometry results of C2C12 myotubes and (B) the bottom show the data of 3T3-L1 adipocytes after 6 h incubation in the medium containing normal Glc (Control), high Glc (HG) and both HG and Lys (HG+Lys). The control cells are shown at the left, the cells treated with HG and HG+Lys are shown in the middle and right, respectively. The percentages of the cells in each state are shown in the figures, and the overall data of the alive and apoptotic cells (early+late) are shown in Table 1.The statistical differences between all groups were significant, p = 0.000.
Inhibitory effect of Lys on ROS and NO production
Fig 4A and 4B show the fluorescence intensity (FI) of DCF as a measure of ROS production in both cell lines in the medium containing HG in the presence or absence of Lys. The statisticl analysis shows significant increase (p = 0.000) in the ROS production in HG groups in comparison with the controls of both cell types. Due to Lys treatment, significant decrease (p = 0.000) in the ROS levels was observed in HG+Lys groups in comparison with HG groups in both C2C12 myotubes and 3T3-L1 adipocytes.
Fig 4
The oxidative stress markers.
The fluorescence intensity (FI) of DCF as arbitrary units (AU) are shown in (A) C2C12 myotubes and (B) 3T3-L1 adipocytes in the control cells (normal Glc = NG), and in the presence of HG or HG+Lys after 2, 4 and 6 h of incubation. The total NO concentrations are shown in (C) C2C12 myotubes and (D) 3T3-L1 adipocytes, after 2, 4 and 6 h of incubation in different conditions. The maximum NO was produced after 2 h of HG treatment in both cells. The p-values of the differences within groups, at different time intervals, are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and Lys groups (p = 0.009). **** indicates the differences between control and Lys groups (p = 0.000).
The oxidative stress markers.
The fluorescence intensity (FI) of DCF as arbitrary units (AU) are shown in (A) C2C12 myotubes and (B) 3T3-L1 adipocytes in the control cells (normal Glc = NG), and in the presence of HG or HG+Lys after 2, 4 and 6 h of incubation. The total NO concentrations are shown in (C) C2C12 myotubes and (D) 3T3-L1 adipocytes, after 2, 4 and 6 h of incubation in different conditions. The maximum NO was produced after 2 h of HG treatment in both cells. The p-values of the differences within groups, at different time intervals, are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and Lys groups (p = 0.009). **** indicates the differences between control and Lys groups (p = 0.000).Fig 4C and 4D show the effect of HG and /or Lys on NO production in C2C12 and 3T3-L1 cells, respectively. In 3T3-L1 adipocytes, a statistical analysis shows the significant differences (p = 0.000) between the NO in all four groups (control, HG, HG+Lys and Lys); however, the magnitudes of the NO were higher in the HG group than the others and due to the treatment with Lys (in HG+Lys groups) it was decreased significantly. In C2C12 myotubes the differences in the NO between control, HG and HG+Lys groups were significant (p = 0.000). Lys increased significantly (p = 0.009) the NO level in C2C12 myotubes, too. These changes were also time dependent and the maximum value in each group was observed after 2 h of treatment. The statistical differences within groups at different time intervals are shown in the figures.
Lys suppresses ERS response
Some UPR markers were investigated in this study. XBP1 splicing was studied at two levels of mRNA and protein expression. The agarose gel electrophoresis of the final PCR products of each cell line, Fig 5A and 5B, have obviously indicated the increasing amount of the spliced form of XBP1 (XBP1s) mRNA below the unspliced one (XBP1u) by increasing time from 2 to 6 hours of incubation of the cells in HG. Semiquantitative analysis of these bands using Image J software and the obtained ratios of the spliced XBP1/ unspliced XBP1 (XBP1s/ XBP1u) mRNA were shown in Fig 5C and 5D for C2C12 myotubes and 3T3-L1 adipocytes, respectively. The analysis of the data in both cell types, using repeated-measures ANOVA, indicated the significant (p = 0.000) increase in the XBP1s in HG groups in comparison with the control. This value (the spliced form of XBP1 mRNA) was significantly decreased (p = 0.000) after Lys treatment in the HG+Lys groups of both cell types.
Fig 5
RT-PCR analysis of XBP1 mRNA splicing in different conditions.
The gel electrophoresis pattern of the spliced and unspliced (XBP-1s and XBP-1u, respectively) amplicons as studied by RT-PCR in (A) C2C12 myoblasts and (B) 3T3-L1 adipocytes with no treatment (control), in the presence of HG or HG+Lys after 2, 4 and 6 h of incubation. The semiquantitative analysis of the XBP1s and XBP1u mRNA values, obtained by ImageJ analysis, and the ratio of XBP1s/XBP1u mRNA are shown in figures (C) C2C12 myoblasts and (D) 3T3L1 adipocytes. The data represent as mean ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1 mRNA splicing within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000).
RT-PCR analysis of XBP1 mRNA splicing in different conditions.
The gel electrophoresis pattern of the spliced and unspliced (XBP-1s and XBP-1u, respectively) amplicons as studied by RT-PCR in (A) C2C12 myoblasts and (B) 3T3-L1 adipocytes with no treatment (control), in the presence of HG or HG+Lys after 2, 4 and 6 h of incubation. The semiquantitative analysis of the XBP1s and XBP1u mRNA values, obtained by ImageJ analysis, and the ratio of XBP1s/XBP1u mRNA are shown in figures (C) C2C12 myoblasts and (D) 3T3L1 adipocytes. The data represent as mean ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1 mRNA splicing within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000).The Western blot results of two ERS markers using the specific antibodies against the mentioned proteins are shown in Fig 6A (C2C12 myotubes) and 7A (3T3-L1 adipocytes).
Fig 6
Western blotting data of the stress responses of C2C12 myoblasts in different conditions.
(A) The Western blot data of whole-cell lysates of C2C12 myoblasts subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to different antibodies. The β-actin served as a loading control. (B and C) Show the ratio of the spliced XBP1 (XBP1s)/β-actin and p-eIF2α/eIF2α, respectively, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1s/β-Actin and p-eIF2α/eIF2α ratios within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and Lys groups (p = 0.032).
Western blotting data of the stress responses of C2C12 myoblasts in different conditions.
(A) The Western blot data of whole-cell lysates of C2C12 myoblasts subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to different antibodies. The β-actin served as a loading control. (B and C) Show the ratio of the spliced XBP1 (XBP1s)/β-actin and p-eIF2α/eIF2α, respectively, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1s/β-Actin and p-eIF2α/eIF2α ratios within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and Lys groups (p = 0.032).Figs 6B and 7B show the XBP1s/β-Actin ratios in the mentioned cells, at different times of incubation. These results also confirm the obtained data of XBP1 mRNA splicing. It means that the ratios of the spliced forms of XBP1 protein to β-actin were significantly increased (p = 0.000) after HG treatment in comparison with the control groups in both cells. However, this parameter was significantly (p = 0.000) decreased due to the treatment with Lys in the HG+Lys groups in both cells. There was a slight difference between the control and Lys groups in the C2C12 (p = 0.032), but this difference was not significant in 3T3-L1.
Fig 7
Western blotting data of the stress responses of 3T3-L1 adipocytes in different conditions.
(A) The Western blot data of whole-cell lysates of 3T3-L1 adipocytes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to different antibodies. The β-actin served as a loading control. (B) and (C) Show the ratio of the spliced XBP1 (XBP1s)/ β-actin and p-eIF2α/eIF2α, respectively, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1s/β-Actin and p-eIF2α/eIF2α ratios within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000 for XBP1/β-Actin and p = 0.003 for p-eIF2α/eIF2α ratios).
Western blotting data of the stress responses of 3T3-L1 adipocytes in different conditions.
(A) The Western blot data of whole-cell lysates of 3T3-L1 adipocytes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to different antibodies. The β-actin served as a loading control. (B) and (C) Show the ratio of the spliced XBP1 (XBP1s)/ β-actin and p-eIF2α/eIF2α, respectively, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences (p-value) in the XBP1s/β-Actin and p-eIF2α/eIF2α ratios within the groups at different time intervals are shown in the figures. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000 for XBP1/β-Actin and p = 0.003 for p-eIF2α/eIF2α ratios).Another marker of the UPR is p-eIF2α. Fig 6C shows the ratio of p-eIF2α/eIF2α in C2C12 myotubes at different conditions and time intervals. Fig 7C shows the results of the same parameters in 3T3-L1 adipocytes. All of these data indicated a significant increase (p = 0.000) in the eIF2α phosphorylation at Ser51 in the presence of HG in comparison with the NG in the control groups, in both cell types. Lys treatment significantly (p = 0.000 and p = 0.003) reversed these changes in the groups treated with HG+Lys in comparison with HG in C2C12 myotubes and 3T3-L1 adipocytes, respectively. There were no significant differences between control and Lys groups of both cell types.
Lys inhibits HG-induced autophagy
The effect of HG and/or Lys treatment on the expression of LC3I and LC3II is shown in Figs 8A and 9A in the C2C12 myotubes and 3T3-L1 adipocytes, respectively. The LC3-II/LC3I ratios at different conditions are also shown in Figs 8B and 9B, in the mentioned cell types. These data indicate a significant increase (p = 0.000) in this ratio due to the HG treatment in comparison with the untreated group, it means the LC3II accumulation. These changes were significantly (p = 0.000) reversed by Lys treatment in the HG+Lys groups in both cell types. However, the LC3-II/LC3I ratios were still higher in the HG+Lys treated groups (p = 0.000 and p = 0.006) than the control groups in C2C12 and 3T3-L1, respectively. Lys alone had no significant effect on this parameter in the mentioned cell types.
Fig 8
Western blotting data of the autophagy marker in C2C12 myotubes in different conditions.
(A) The Western blot data of whole-cell lysates of C2C12 myotubes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to the LC3 antibody. (B) Shows the ratios of the LC3II/LC3I at different conditions, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences in the LC3II/LC3I ratio within groups, at different time intervals are shown in the figure. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000).
Fig 9
Western blotting data of the autophagy marker in 3T3-L1 adipocytes in different conditions.
(A) The Western blot data of whole-cell lysates of 3T3-L1 adipocytes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to the LC3 antibody. (B) Shows the ratios of the LC3II/LC3I at different conditions, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences in the LC3II/LC3I ratio within groups, at different time intervals are shown in the figure. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and HG+Lys groups (p = 0.006).
Western blotting data of the autophagy marker in C2C12 myotubes in different conditions.
(A) The Western blot data of whole-cell lysates of C2C12 myotubes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to the LC3 antibody. (B) Shows the ratios of the LC3II/LC3I at different conditions, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences in the LC3II/LC3I ratio within groups, at different time intervals are shown in the figure. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000).
Western blotting data of the autophagy marker in 3T3-L1 adipocytes in different conditions.
(A) The Western blot data of whole-cell lysates of 3T3-L1 adipocytes subjected to Lys (1 mM) and/ or HG treatments at different times of incubation that exposed to the LC3 antibody. (B) Shows the ratios of the LC3II/LC3I at different conditions, as determined by semiquantitative analysis of the bands in (A). All data are represented as means ± SD of three independent experiments. The data of the named four independent groups at different time intervals were analyzed by repeated-measures ANOVA. The significant differences in the LC3II/LC3I ratio within groups, at different time intervals are shown in the figure. The statistical differences between the groups are shown by stars in the figures and defined as follows: * indicates the differences between control and HG groups (p = 0.000). ** indicates the differences between HG and HG+ Lys groups (p = 0.000). *** indicates the differences between control and HG+Lys groups (p = 0.006).
Discussion
We found here that Lys prevents the HG-induced cell death in both C2C12 myotubes and 3T3-L1 adipocytes. The beneficial effects of Lys in these cells were through the reduction of oxidative stress and regulation of the UPR and autophagy.In the present study, we have been applying different concentrations of Lys from 0.5 to 10 mM in both C2C12 myotubes and 3T3-L1 adipocytes. Physiologic concentration of Lys has been reported about 201 to 253 μM according to the type of food intake [34] or 92 ± 6 μM [35]. We used Lys above physiologic concentration and there was no toxicity against the studied cells. However, a previous study indicated the toxicity of high Lys concentration (10 mM) against HK-2 kidney cells [36]. Therefore, we applied the mild Lys concentration (1 mM) in further experiments to avoid any possible toxicity.The importance of oxidative stress in the pathogenesis of diabetes and diabetic complications have been extensively studied for years and all the data based on animal models and diabeticpatients indicated the role of oxidative stress in this disease. Chronic hyperglycemia has been known as a major source of oxidative stress and de novo free radical generation, which in order depletes the activity of the antioxidative defense system [37, 38]. Our results show the direct inductive effect of HG on ROS production and the protective role of Lys on this parameter, in both C2C12 myotubes and 3T3-L1 adipocytes.Another important mechanism causing cell dysfunction in diabetes is related to NO production. It is produced due to the enzymatic reaction catalyzed by three different nitric oxide synthases (NOSs). Among these isozymes, the inducible NOS (iNOS) is known to be involved in production of the most NO and O2- in diabetes [39-41]. In addition, the role of liver NO at the early stage of diabetes and its importance in aging has been reported [42]. The presence of high concentration of NO and some ROS products, such as the superoxide radical (O2-), may lead to the production of another highly reactive oxidant species, peroxynitrite (ONOO-), resulted into more aggressive oxidative and nitrosative stresses [43].The role of Lys as a selective inhibitor of iNOS has been introduced in the endotoxic shock [44]. We have also shown the anti-diabetic and antioxidant activities of Lys in animal model and human [19, 24–26]. Here, we searched about the effect Lys treatment on the two mentioned oxidative parameters and two important pathways in the in vitro models of diabetes.At first, the role of HG on the cell viability and cell death was investigated. The MTT assay indicated the HG-induced cell death, and the flow cytometry results showed the apoptosis induction in both cell lines. These processes were mediated by a significant increase in the ROS and total NO levels in both C2C12 myotubes and 3T3L adipocytes due to the exposure to HG. The maximum ROS and NO levels were observed at 4 and 2 h of cells exposure, respectively. Although both ROS and NO levels decreased by increasing the incubation time in both differentiated cell lines, they were still significantly higher than the control. Lys alone had no significant effect on ROS production, but significantly increased NO production, especially in 3T3-L1 adipocytes. When Lys co-treated with HG (Lys+ HG), the ROS and NO levels were significantly lower than the HG alone. It means that Lys significantly prevented the ROS and NO production in both cell lines. These results are compatible with our previous data about the antioxidant activity of Lys in diabetic rats [19] and in acute pancreatitis in mice [45]. Furthermore, these results are completely compatible with that reported previously about the role of Lys as an inhibitor of L-arginine uptake and NO synthesis in rat [44].As mentioned in the introduction, our previous in vitro and in vivo studies indicated that chronic hyperglycemia affects the structure and function of many proteins, including extracellular proteins (such as fibrinogen [24] and lysozyme [23, 25]), intracellular proteins, including cytosolic proteins (hemoglobin) [19] and even, nuclear proteins (histone H1 [46]), as well as molecular chaperones (α-crystallin) [26]. Other studies indicated that membrane proteins also affected by this harmful condition [47, 48]. The quality control systems in the ER are responsible for the detection of misfolded proteins and leading them toward the editing systems for refolding or degradation. Therefore, UPR is an important mechanism in the ER, which is responsible for determining the fate of proteins, leading the cell toward the apoptosis or survival. ROS production and ER stress activate three arms of UPR in the cell. Among them, activation of two arms, IRE1α (Inositol Requiring Enzyme1) and PERK (PKR-like Endoplasmic Reticulum Kinase), result in the splicing of XBP1 and phosphorylation of eIf2α, respectively, which ultimately led to cell apoptosis [49, 50]. While, the ATF6 pathway slows the pace of protein translation, reduces the load of protein into the ER, and induces the production of molecular chaperones.Since the obtained data in this study confirmed HG-induced ROS and NO production and apoptosis induction in the studied cells, we investigated two processes of XBP1 splicing and eIf2α phosphorylation as the possible mechanisms of apoptosis induction through UPR.As shown in the results, the ratio of XBP1s/XBP1u (in both mRNA and protein levels) and the ratio of p-eIf2α/eIf2α were significantly increased in the HG-treated C2C12 myotubes and 3T3-L1 adipocytes, suggesting that ER stress induced by HG may lead the cells to apoptosis. Both of these markers were significantly decreased due to the Lys treatment. Previous studies have shown the role of Lys as an antioxidant that upregulates the anti-inflammatory factors [19, 45] and reduces the glycoxidation markers in rat model of diabetes-atherosclerosis [51].eIF2α has been known to play a very important role in the UPR-induced autophagy [52]. Due to the UPR activation, phosphorylated form of eIF2α (p-eIF2α) decreases general protein synthesis and permits the transcription of genes involved in autophagy and apoptosis [53]. Thus, p-eIF2α was investigated as one of the ER stress sensors [54, 55].Autophagy is a complex mechanism that under specific circumstances follows a “cell survival” or a “cell-killing” strategy. Actually, autophagy involves the sequestration of damaged organelles and misfolded/aggregated proteins [56, 57]. The conversion of LC3 I to LC3II, the cytosol to membrane transition and accumulation of LC3II protein has been introduced as an autophagy marker [58, 59]. Previous studies indicated a relation and crosstalk between UPR, autophagy and apoptosis in cancer cells [60]. So that, one of the mechanisms involved in the ER homeostasis regeneration and UPR modification is autophagy stimulation. In addition, persistent or sever ER stress can shift the cytoprotective functions of both UPR and autophagy into cell death promoting mechanisms [61].Activation of autophagic pathways has been shown in mouse embryos and oocytes in response to a hyperglycemic environment [12]. Sato et al. have also shown that 10 mM Lys decreased the ratio of LC3II/LC3I in C2C12 myotubes and inhibited autophagic–lysosomal system activity [62]. Here, investigation of the LC3 accumulation indicated that following treatment of the cells with HG, the level of LC3II and the LC3II/LC3I ratio was significantly increased; these are implying the autophagy activation in both myotubes and adipocytes. These data accompanying with the data about the elevation of apoptosis in these cells, confirming the role of autophagy-induced apoptosis. Lys treatment decreased significantly the LC3II/LC3I ratio in both cells, indicating the inhibitory role of Lys in this pathway.Sato et al. has shown that 5–10 mM Lys stimulated the rate of protein synthesis in C2C12 myotubes and introduced Lys as a regulator of protein synthesis [63]. Here, we showed the inhibition of autophagy by 1 mM Lys. It means that Lys at lower concentrations, at least, prevents protein degradation through autophagy. This effect was mostly shown at the first hours of HG treatment.Finally, Lys significantly increased the cell survival and decreased the HG-induced apoptosis after 6 h of treatment. But, there were significant differences between these cells and control cells. It is possible that by increasing the time course of the experiment to 12 or 24 h these improvement effect is intensified. The subject that should be studied in the near future. The results of the present study are consistent with the previously reported data and indicated that Lys acts through different mechanisms. Like a chemical chaperone, Lys inhibits protein glycation and misfolding; and like an antioxidant, inhibits the oxidative stress. In addition, it acts as a regulator of UPR and autophagy, and controls the protein turnover in the cells. Further studies are needed to evaluate these mechanisms in the in vivo, and in different tissues.In conclusion, the presented data indicated that Lys, as an antioxidant and a regulator of UPR and autophagy, protects C2C12 myotubes and 3T3-L1 adipocytes against damages induced by HG.
Representative images of C2C12 cells.
(A) in control medium and (B) in differentiation medium after 6 days.(TIF)Click here for additional data file.
Oil Red O staining of 3T3-L1 cells.
(A) The 3T3-L1 cells staining at first, and (B) after 2 weeks incubation in differentiation media. A significant increase in the lipid droplets stained with Oil Red O, in the peri-nuclear region, indicating the differentiation of 3T3-L1 cells to 3T3-L1 adipocytes. The white marker on the right bottom of the figures indicating a 25 μm scale.(TIF)Click here for additional data file.
The raw images of all PCR and Western blot data.
Each figure was named according to the related figure in the text.(PDF)Click here for additional data file.14 Aug 2019PONE-D-19-20629L-Lysine Protects C2C12 and 3T3-L1 Cells Against High Glucose Damages and StressesPLOS ONEDear Professor Bathaie,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Your manuscript was reviewed by two knowledgeable referees in this area, and their comments are appended. As you will see, they both had numerous concerns that will need to be addressed by the authors before I can proceed further. The authors need to properly addressed all these concerns to satisfy our reviewers.We would appreciate receiving your revised manuscript by Sep 28 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Makoto Kanzaki, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf1.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: 1.Fig.1, the CK specific activity was significantly increased in C2C12 cells after 6 days. Whether there is statistical difference between the two groups, if the difference is statistically significant, it should be labeled.2.Fig.3A, the results showed that Lys was not toxic to C2C12 myotubes and 3T3-L1 adipocytes at different concentrations (0.5 to 10 mM). Therefore, the authors used 1 mM Lys in other experiments. The authors do not show the reason for choosing the concentration of 1 mM,this is confusing for readers to understand.3."Figs. 3B and 3C show the effect of HG and HG+Lys, respectively, on viability of both C2C12 myotubes and 3T3-L1 adipocytes at different time courses (2, 4 and 6 h).These figures indicate a time dependent and significant decreases (p= 0.000) in the cell viability due to the HG treatment in comparison with the control cells. Lys treatment significantly overcomes the HG toxicity. So that, the p values of the differences in the cell viabilities between groups treated by Lys+HG and groups treated with HG were p= 0.013 C2C12 myotubes and were p= 0.008 in 3T3-L1 adipocytes. However, there are still significant differences between Lys+HG groups and control groups in both cell lines (p= 0.000), which possibly compensated by increasing time up to 24 h." There are statistically significant differences between the groups, the authors should be labeled p value in the figure 3 B and C.4.Fig.5A and 5B, in the result, the author’s description is that " The repeated measurement shows significant increase (p=0.000) in the ROS production in HG groups in comparison with the controls of both cell types. " and "Due to Lys treatment, significant decrease (p=0.000) in the ROS levels was observed in HG+Lys groups in comparison with HG groups in both C2C12 and 3T3-L1 cells. " However, the labeled in the figure does not match with the result description.5.Fig.5Cand 5D, the labeled in the figure does not match with the result description.6.Fig.6Cand 6D, in the result, the author’s description is that “indicated the significant (p=0.000) increase in the XBP1s in HG groups in comparison with the control. This value (the spliced form of XBP1 mRNA) was significantly decreased (p=0.000) after Lys treatment in the HG+Lys groups of both cells.” However, the labeled in the figure does not match with the result description.7.Fig. 7B,C,D and 8B,C,D, the labeled in the figure does not match with the result description.8.In Fig. 7A and 8A, labeled is p-eIF2α, but in Fig. 7C and 8C, labeled is eIF2α.9.What does that mean "a,b,c,d,e and f " in Table 1?10.The authors should proofread for grammatical and punctuation.Reviewer #2: The authors investigated the effect of L-Lysine (Lys) on high glucose induce damages in C2C12 and 3T3-L1 cells. They suggested that the Lys prevents HG-induced detrimental effects of following parameters ROS, NO, apoptosis, a spliced form of XBP1, p-elf2a, and LC3II/LC3I ratio. However, although the findings are valuable, they are not well described or discussed and even overstated or misinterpreted at times. There are many other minor errors of syntax and grammar throughout the text, which need to be fixed. The manuscript needs to remove the multiple inaccuracies and inconsistencies, improve the logical flow, and reformat for better clarity. There are some suggestions and concerns which should be addressed.Major comments:1. Abstract: Must be rewritten within the scope of the study. Without any rationale given for the parameters studied, the abstract creates an impression that the study describes random outcomes of random in vitro treatments. Clear hypothesis and logical explanation of the results are often lacking throughout the paper, although they are essential for the scientific method. Conclusion: “These results provide new insights…..” does not make logical sense.2. Introduction last paragraph: (lines 73-79): “Continuing with our previous studies,………” it means reference [24, 25] and those studies conducted on fibrogenic activity (hyperglycemia) and lysosome glycation in diabetic condition and protective effect of Lys. In what these studies continuing with the previous observations apart from hyperglycemia or diabetic condition, neither fibrosis or lysosome glycation studied in the current manuscript. Avoid misinterpret and overstate, strict with the scope of the study.3. Materials and methods: Justification must be included in materials and methods for the treatment doses used (Lys 1mM) and even though cells not shown any cytotoxic effect with a range between 0.5-10mM (supraphysiologic) Lys in both cells; it is not around physiology Lys levels?. Moreover, the rationale for Lys instead of well-known Cys and Gly (precursor for major antioxidant Glutathione).Line 136: Is the percentage of viable cells out of total cells counted? Please specify.Line 148:” The obtained raw results were analyzed by FlowJo software”….Sentence not completed…How it expressed? Mention that on the next line — same applicable to “Measuring the ROS and NO production” also.Line 163-180: What was the internal control used for RT-PCR and how it normalized? “No loading control in gels ?”Line 183: “The expression levels of elf2a…..” elf2a antibody not mentioned in materials method only phosphorylated form mentioned and in blot also p-elf2a mentioned but quantified bar diagram for elf2a. Why this error all over the manuscript?Line 201-207: Statistical Analysis: What Post Hoc analysis used?4. Subtitles for Results section poor: say for example, “Cell culture and differentiation, Cell viability Assay, Apoptosis detection, ….The results of RT-PCR and Western blotting” seems methods title rewrite according to the observed parameter for results. The results have to precisely and entirely describe the findings in the figures.5. Beyond ROS and NO assays; the essential relevant hydrogen peroxide assay, protein carbonyl, and GSH or total antioxidant capacity are of remarkable to validate the oxidative damage point of the study. It is interesting to see those data in the present study; the authors may include those parameters to validate the present observations.6. Discussion: The discussion as a whole lacks logical clarity and needs to be rewritten to discuss how the described findings fit in the hypothesis and what their implications for the future are?.Line: 362-369 “This paragraph consists of what seems like random facts without a logical connection between them.” Apoptosis and autophagy are two different opposite entity; how could authors explain this contradictory in their study? Justification need and discussion must be included in this aspect.“Line 323….the pseudo-diabetic condition” What was that? What it mean?.7. The title, aim of the study, abstract conclusion, introduction conclusion, and looks different and often overstated than what was observed. Line:375-378. The conclusion is overstated in discussion “As the presented data here………..induced by HG” This is purely an in vitro study on two cell lines and few parameters studies to elucidate the beneficial role of Lys on HG-induced damages. The conclusion should be drawn from the significant outcome of the study. Hence, the conclusion must be rewritten more precisely with the outcome from the observations. “Correct the conclusion points in the abstract and introduction also.” It applies to the title; it is better to avoid overstating.8. Legends often confusing must be rewritten.8. Multiple inaccuracies in the Figures:Fig 1 and 2: Is not a novel one, it has been shown many times in literature? Moreover, myotubes images may be included, and oil o red must be quantified. Moreover, suggestive of combining these known results and may be provided as supplementary.Fig 3. Significant missing on the top of the bar diagram. Sub figure a, b, c marking also missing and it is good to mention an insert whether it is C2C12 or 3T3-L1 data inside in all figures.Fig 4. Repetition of Table 1. Either one should move to supplementary data. Moreover, what is replicated for the flow cytometry apoptosis experiment?Fig 5. How the groups are compared only between time points not between groups? It is better to analyze two-way ANOVA for analysis of different time points and groups.Fig 6. It was early mentioned that Gels lacks internal controls. This is not acceptable.Fig 7 and 8. Western blot bands are not representative; provide representative blot images and bands seem oversaturated; it is advisable to reduce the loading protein concentration.Why different groups cropped separately whether those samples run on different gels separately?p-elf2a must be normalized with elf2a, not with b-actin. Check the axis for p-elf2a it was mentioned elf2a/b-action. This is not acceptable.Poor figure resolution was challenging to see data and labels.Other:Provide correct company name, place, and catalog for all chemicals and assay kits.Even though the scale bar is presented in figures, it is good to provide magnification in legends along with scale bar for all microscope images.Along with CK activity; Why not myotubes images provided? It would be interesting similar like differentiated adipocytes.PCR and blotting experiments are three independent biological replicates, and what was the technical replicate?All the abbreviations have to be spelled out in the abstract. In the main body of the manuscript, the full name and abbreviation of the name have to be spelled out on the first mention only, with just the abbreviated form used for the rest of the text. The manuscript is peppered with many abbreviations changing back and forth between their full and abbreviated versions throughout the text, which makes reading confusing at times. Why glucose abbreviated as Glc? Avoid non-standard abbreviations throughout the manuscript.Please double-check grammar and English in the manuscript and check for typo errors. These must be avoided throughout the manuscript.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.2 Oct 2019Responses to the Reviewers' comments:Thank you very much for your kind considerations, positive view to the manuscript and very good comments.5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)We would like to say thank you very much to both of the reviewers for their time and constructive comments. We understand and sympathize with the request for more details from the reviewers.Below we addressed all comments and suggestions (reviewer’s comments in black, our reply in blue). We have considered the various suggestions made by the reviewers and have accordingly revised and rewritten the manuscript. Hopefully it is fulfilled the editor and reviewers’ expectations and be accepted for publication.Reviewer #1:1.Fig.1, the CK specific activity was significantly increased in C2C12 cells after 6 days. Whether there is statistical difference between the two groups, if the difference is statistically significant, it should be labeled.Yes, you are right. The scale bar and the statistical difference was shown in the figure. Please look at Line 220.2.Fig.3A, the results showed that Lys was not toxic to C2C12 myotubes and 3T3-L1 adipocytes at different concentrations (0.5 to 10 mM). Therefore, the authors used 1 mM Lys in other experiments. The authors do not show the reason for choosing the concentration of 1 mM, this is confusing for readers to understand.Physiologic concentration of Lys has been reported about 232 µM (European Journal of Clinical Nutrition (2016) 70, 306–312) or 92 ± 6 µM (Boyvin et al., 2017). However, determination of the ratio of LC3-II/I in C2C12 myotubes has been shown that 10 mM Lys inhibited autophagic–lysosomal system activity (Sato et al., 2014). Then, the authors showed that Lys regulates protein synthesis and at 5 – 10 mM stimulated the rate of protein synthesis in C2C12 myotubes (Sato et al., 2016). High Lys concentration has also shown toxicity against HK-2 kidney cells (Verzola et al., 2012). These explanations and references were added in the text.In the present study, although Lys showed similar viability at concentrations 1 and 5 mM, and even at 10 mM, for avoiding the above mentioned side effects and toxicity, we used the minimum pharmacologic concentration, in all other experiments. Please look at Lines 321-327.3."Figs. 3B and 3C show the effect of HG and HG+Lys, respectively, on viability of both C2C12 myotubes and 3T3-L1 adipocytes at different time courses (2, 4 and 6 h). These figures indicate a time dependent and significant decreases (p= 0.000) in the cell viability due to the HG treatment in comparison with the control cells. Lys treatment significantly overcomes the HG toxicity. So that, the p values of the differences in the cell viabilities between groups treated by Lys+HG and groups treated with HG were p= 0.013 C2C12 myotubes and were p= 0.008 in 3T3-L1 adipocytes. However, there are still significant differences between Lys+HG groups and control groups in both cell lines (p= 0.000), which possibly compensated by increasing time up to 24 h." There are statistically significant differences between the groups; the authors should be labeled p value in the figure 3 B and C.The mentioned Figs. that converted to Figures 2B and 2C in the revised version, were labeled. According to your comments about other figures (4 to 8 of the previous version), we revisited the statistical analysis with the help of Professor Faghihzadeh and all parts was rewritten for more clarity.4.Fig. 5A and 5B, in the result, the author’s description is that " The repeated measurement shows significant increase (p=0.000) in the ROS production in HG groups in comparison with the controls of both cell types. " and "Due to Lys treatment, significant decrease (p=0.000) in the ROS levels was observed in HG+Lys groups in comparison with HG groups in both C2C12 and 3T3-L1 cells. " However, the labeled in the figure does not match with the result description.5.Fig. 5C and 5D, the labeled in the figure does not match with the result description.6.Fig. 6C and 6D, in the result, the author’s description is that “indicated the significant (p=0.000) increase in the XBP1s in HG groups in comparison with the control. This value (the spliced form of XBP1 mRNA) was significantly decreased (p=0.000) after Lys treatment in the HG+Lys groups of both cells.” However, the labeled in the figure does not match with the result description.7.Fig. 7B,C,D and 8B,C,D, the labeled in the figure does not match with the result description.In response to the comments 4 to 7, we should say that, we used repeated-measures ANOVA for statistical analysis of the differences between different groups (C, HG, HG+Lys and Lys) at different times (0, 2, 4 and 6 h). In the previous version we wrote these results separately in the results and Figs. But, for answering your valuable questions and for more clarity of the statistical analysis and data, we asked Prof. Faghihzadeh to help us and we added his name in the paper. Please note to the new analysis and writing of the statistics in the results and all Figures.8.In Fig. 7A and 8A, labeled is p-eIF2α, but in Fig. 7C and 8C, labeled is eIF2α.You are right. It was our fault. We edited it and added the data of eIF2α. Thus, the p-eIF2α/ eIF2α ratio at different treatment condition was added in the results.9.What does that mean "a,b,c,d,e and f " in Table 1?Since all the data were statistically significant, p=0.000, we deleted them.10.The authors should proofread for grammatical and punctuation.The proofreading was performed in the manuscript and we tried to edit all the writing errors. Hope it is acceptable, now.Reviewer #2:The authors investigated the effect of L-Lysine (Lys) on high glucose induce damages in C2C12 and 3T3-L1 cells. They suggested that the Lys prevents HG-induced detrimental effects of following parameters ROS, NO, apoptosis, a spliced form of XBP1, p-elf2a, and LC3II/LC3I ratio. However, although the findings are valuable, they are not well described or discussed and even overstated or misinterpreted at times. There are many other minor errors of syntax and grammar throughout the text, which need to be fixed. The manuscript needs to remove the multiple inaccuracies and inconsistencies, improve the logical flow, and reformat for better clarity. There are some suggestions and concerns which should be addressed.Thank you very much for your kind consideration and good suggestions. As you suggested, grammatical and syntax errors was carefully checked, revised and improved. We hope the revised manuscript meets your expectations.Major comments:1. Abstract: Must be rewritten within the scope of the study. Without any rationale given for the parameters studied, the abstract creates an impression that the study describes random outcomes of random in vitro treatments. Clear hypothesis and logical explanation of the results are often lacking throughout the paper, although they are essential for the scientific method. Conclusion: “These results provide new insights…..” does not make logical sense.The Abstract was revised and remodeled. We tried to include the hypothesis and logical explanation of the results.2. Introduction last paragraph: (lines 73-79): “Continuing with our previous studies,………” it means reference [24, 25] and those studies conducted on fibrogenic activity (hyperglycemia) and lysosome glycation in diabetic condition and protective effect of Lys. In what these studies continuing with the previous observations apart from hyperglycemia or diabetic condition, neither fibrosis or lysosome glycation studied in the current manuscript. Avoid misinterpret and overstate, strict with the scope of the study.You are right. Although in the present study we have not investigated all the processes we investigated previously, one by one, we believe that stress induction by HG has an important role in all of the diabetic complications and we focused here on some markers indicating the stress induction by HG and suppressive effect of Lys, in these two cell lines. As you suggested, we have corrected the sentence.3. Materials and methods: Justification must be included in materials and methods for the treatment doses used (Lys 1mM) and even though cells not shown any cytotoxic effect with a range between 0.5-10mM (supraphysiologic) Lys in both cells; it is not around physiology Lys levels?.Physiological level of Lys in the serum is about 232 µM (European Journal of Clinical Nutrition (2016) 70, 306–312) or 92 ± 6 µM (Boyvin et al., 2017). Thus, we used higher concentrations in this study. Sato et al. used 0.1 to 10 mM of Lys for C2C12 myotubes (Bioscience, Biotechnology, and Biochemistry, 2016 Vol. 80, No. 11, 2168–2175).Furthermore, 5- 10 mM of Lys induced the protein synthesis, and Lys 10 mM has been introduced as a potent suppressor of autophagy, while Lys 0.1 mM had no effect on autophagy (Bioscience, Biotechnology, and Biochemistry, 2016 Vol. 80, No. 11, 2168–2175).The toxicity of 5, 10 and 20 mM of Lys against cancer cell through induction of H2O2 production has been also shown (J. Phys. D: Appl. Phys. 49 (2016) 274001 (7pp)).A decrease in HK-2 cell viability has been reported with high Lysine (10-15 mM) concentration (J Inherit Metab Dis., DOI 10.1007/s10545-012-9468-z).However, as shown in Figs.2 A & B, Lys showed a slight toxicity against both cells at 10 mM up to 6 h, which may increase by time. Since there was no autophagic induction in very low Lys concentration (0.1 mM) and we would like to suppress HG-induced autophagy in the cells, with no more toxicity, we used 1 mM in all other experiments.These explanations and references were added in the text.Moreover, the rationale for Lys instead of well-known Cys and Gly (precursor for major antioxidant Glutathione).We used previously several amino acids in our studies (References 1 & 2). Although all of them was effective, we obtained the best values for Lys in the diabetes treatment. Thus, in the present study we applied Lys.Line 136: Is the percentage of viable cells out of total cells counted? Please specify.Yes, the viable cells in the control was assumed as 100 and the viability in the treated cells was calculated relative to the control. It was explained in the text (Lines 143-144).Line 148:” The obtained raw results were analyzed by FlowJo software”….Sentence not completed…How it expressed? Mention that on the next line — same applicable to “Measuring the ROS and NO production” also.Thanks for your careful reading the manuscript and valuable comments. They were completed Please look at Lines 155-156 for Software, Lines 163-164 for ROS and Lines 169-171 for NO.Line 163-180: What was the internal control used for RT-PCR and how it normalized? “No loading control in gels?”We measured RNA concentrations of samples with a NanoDrop device. In addition, the integrity and purity of the RNA samples was evaluated via ethidium bromide visualization of intact 18S and 28S RNA bands after agarose gel electrophoresis.For normalization, the same cDNA concentration of different samples was determined by NanoDrop.The internal control, HPRT, was also used but, we did not report the data. Since our goal was showing the splicing of the XBP1 gene, and compare it with the unspliced form, we did not report the data of HPRT. Please note that both of the spliced and unspliced forms, if exist, are seeing in one run and in a gel. Other references in the literature that have not used internal control are include: (J Clin Invest. 2008;118(6):2148-2156. https://doi.org/10.1172/JCI33777) and (Blood, 2012, 119:5772-5781; doi: https://doi.org/10.1182/blood-2011-07-366633).However, if you think we must report it, we will do.Line 183: “The expression levels of elf2a…..” elf2a antibody not mentioned in materials method only phosphorylated form mentioned and in blot also p-elf2a mentioned but quantified bar diagram for elf2a. Why this error all over the manuscript?We apologize for the confusion and thank you for pointing out this problem. We added the data of elf2a in the revised version and the sentence in the paper was corrected accordingly. Please look at Line 100.Line 201-207: Statistical Analysis: What Post Hoc analysis used?We used Tukey analysis. It was added in the manuscript. Please look at Line 212.4. Subtitles for Results section poor: say for example, “Cell culture and differentiation, Cell viability Assay, Apoptosis detection, ….The results of RT-PCR and Western blotting” seems methods title rewrite according to the observed parameter for results. The results have to precisely and entirely describe the findings in the figures.Thank you for the great suggestions. Because of your suggestion, we changed the subtitles that precisely describe the findings in each section.5. Beyond ROS and NO assays; the essential relevant hydrogen peroxide assay, protein carbonyl, and GSH or total antioxidant capacity are of remarkable to validate the oxidative damage point of the study. It is interesting to see those data in the present study; the authors may include those parameters to validate the present observations.Yes, you are right. But in the present study our main goal was ERS and autophagy, we focused on the mentioned parameters. Since other parameters was extensively reported in the literature and even by us, we only examined and reported two parameters (ROS and NO) for confirmation and other reports were referenced.6. Discussion: The discussion as a whole lacks logical clarity and needs to be rewritten to discuss how the described findings fit in the hypothesis and what their implications for the future are?Thank you very much for your advice. The discussion has rewritten and revised to clarify the logical processes. We have considered your suggestions and have accordingly rewritten the manuscript to describe findings fit in the hypothesis and their implications for the future.Line: 362-369 “This paragraph consists of what seems like random facts without a logical connection between them.” Apoptosis and autophagy are two different opposite entity; how could authors explain this contradictory in their study? Justification need and discussion must be included in this aspect.Autophagy is a complex mechanism that under specific circumstances follows a “cell survival” or a “cell-killing” strategy. Actually, autophagy involves the sequestration of damaged organelles and misfolded/aggregated proteins. Some more explanation was added in Lines 386-397 of the revised manuscript.“Line 323….the pseudo-diabetic condition” What was that? What it mean?Thank you for pointing out that mistake. It was not suitable here and we replaced it with “in vitro model of diabetes”. Please look at Line 346.7. The title, aim of the study, abstract conclusion, introduction conclusion, and looks different and often overstated than what was observed. Line:375-378. The conclusion is overstated in discussion “As the presented data here………..induced by HG” This is purely an in vitro study on two cell lines and few parameters studies to elucidate the beneficial role of Lys on HG-induced damages. The conclusion should be drawn from the significant outcome of the study. Hence, the conclusion must be rewritten more precisely with the outcome from the observations. “Correct the conclusion points in the abstract and introduction also.” It applies to the title; it is better to avoid overstating.We have revised and rewritten the conclusion points of abstract and introduction section by adding and deleting some sentences.8. Legends often confusing must be rewritten.Yes, you are right. Please accept our apology. All of them were amended.8. Multiple inaccuracies in the Figures:Fig 1 and 2: Is not a novel one, it has been shown many times in literature? Moreover, myotubes images may be included, and oil o red must be quantified. Moreover, suggestive of combining these known results and may be provided as supplementary.Yes, you are right. We omitted these figures from the manuscript.Fig 3. Significant missing on the top of the bar diagram. Sub figure a, b, c marking also missing and it is good to mention an insert whether it is C2C12 or 3T3-L1 data inside in all figures.Thank you. All of them were edited.Fig 4. Repetition of Table 1. Either one should move to supplementary data. Moreover, what is replicated for the flow cytometry apoptosis experiment?Figure show the percentages of four different stages of the cells, but in Table we presented the overall percentage of apoptosis, i.e. both early and late apoptosis together. We think it helps to better understanding the situation.Fig 5. How the groups are compared only between time points not between groups? It is better to analyze two-way ANOVA for analysis of different time points and groups.Actually, the two-way ANOVA compares the mean differences between groups with two independent variables. On the other word, a two-way ANOVA is designed to assess the interrelationship of two independent variables on a dependent variable.In our study, time dependency of changes is not an independent variable. Thus, we used repeated-measures ANOVA for statistical analysis of the differences between different groups (C, HG, HG+Lys and Lys) at different times (0, 2, 4 and 6 h). In the previous version we wrote these results separately in the results and Figures. But, for answering your valuable question and for more clarity of the statistical analysis and data, we asked Prof. Faghihzadeh to help us and we added his name in the paper. Please note to the new analysis and writing the statistics.Fig 6. It was early mentioned that Gels lacks internal controls. This is not acceptable.As responded to the above mentioned comments about Lines 163-180, our goal was showing the induction of XBP1 splicing and the ratio of spliced form to the unspliced form was important for us. The same as you expected for p-eIf2α and its ration against the unphosphorylated form.Fig 7 and 8. Western blot bands are not representative; provide representative blot images and bands seem oversaturated; it is advisable to reduce the loading protein concentration.You are right; since we repeated the experiment several times, other representative images of western blot were replaced.Why different groups cropped separately whether those samples run on different gels separately?Yes, we have electrophoresis system (Mini-PROTEANTetra Cell of Bio-Rad) with a 10-well system; but, we had 12 samples (C, HG, HG+Lys and Lys at different times of 2, 4 and 6 h). Thus, we run C, HG and HG+Lys groups in one gel and Lys was run on another gel.p-elf2a must be normalized with elf2a, not with b-actin. Check the axis for p-elf2a it was mentioned elf2a/b-action. This is not acceptable.Yes, you are right. It was our fault. We included the data of elf2α and the data of p-elf2α was normalized with it.Poor figure resolution was challenging to see data and labels.We apologize for the poor figure resolution. We have improved it in the revised paperOther:Provide correct company name, place, and catalog for all chemicals and assay kits.The company name, place, and catalog number for all chemicals and assay kits was included in the text. Please look at Lines 88-103.Even though the scale bar is presented in figures, it is good to provide magnification in legends along with scale bar for all microscope images.The magnification of scale bar for all microscope images was included in legends.Along with CK activity; Why not myotubes images provided? It would be interesting similar like differentiated adipocytes.Please look at the response to comment 8 and Fig. 1S. As reviewer suggested the myotubes images was included.PCR and blotting experiments are three independent biological replicates, and what was the technical replicate?All PCR and blotting experiments were also technically duplicate or triplicate.All the abbreviations have to be spelled out in the abstract. In the main body of the manuscript, the full name and abbreviation of the name have to be spelled out on the first mention only, with just the abbreviated form used for the rest of the text. The manuscript is peppered with many abbreviations changing back and forth between their full and abbreviated versions throughout the text, which makes reading confusing at times. Why glucose abbreviated as Glc? Avoid non-standard abbreviations throughout the manuscript.All the abbreviations were spelled out in the abstract and in the text at first time using.https://www.researchgate.net/figure/Abbreviations-Glc-glucose-GlcA-glucuronic-acid-Gal-galactose-Ac-acetyl_fig1_266325670glucose abbreviation glchttps://www.google.com/search?rlz=1C1GCEA_enUS863US863&sxsrf=ACYBGNQ1kKFBmrcPS8KCTG1tcNwUolLHBQ:1569501820772&q=glucose+abbreviation+glc&sa=X&ved=2ahUKEwi-jYH0we7kAhWJy6QKHSYoB0UQ1QIoAHoECA0QAQhttps://www.ccrc.uga.edu/~rcarlson/SugAbr.pdfhttp://www.jbc.org/site/misc/abbrev.xhtmlGlcNAcN-acetylglucosamineAs it is seen in the above mentioned Web Sites, Glc has been introduced as the abbreviation of glucose. In chemistry, it is usually used and even JBC (Journal of Biological Chemistry) has been introduced GlcNAc. In addition, we defined it in both abstract and throughout the text. However, if you think it is not standard, we can change it to glucose in all the text.Please double-check grammar and English in the manuscript and check for typo errors. These must be avoided throughout the manuscript.We did it again and hope that it is acceptable.References:1) F. Bahmani, S.Z. Bathaie, S.J. Aldavood, A. Ghahghaei (2012). "Glycine therapy inhibits progression of cataract in streptozotocin-induced diabetic rats." Molecular Vision, 18, 439-448.2) S. Mahdavifard, S.Z. Bathaie, M. Nakhjavani, H. Heidarzadeh (2014). “L-cysteine is a potent inhibitor of protein glycation on both albumin and LDL, and prevents the diabetic complications in diabetic-Atheroscleroticrat.” Food Research International, 96, 909-916.Submitted filename: Response to Reviewers 98-07-10.docxClick here for additional data file.17 Oct 2019PONE-D-19-20629R1L-Lysine Protects C2C12 and 3T3-L1 Cells Against High Glucose Damages and StressesPLOS ONEDear Professor Bathaie,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Your revised paper was reviewed by the original referees and their comments are appended. As you will see the reviewer #1 kindly raised several issues that will need to be properly addressed by the reviewers. The authors need to carefully address all his/her concerns to fully satisfy the reviewer.We would appreciate receiving your revised manuscript by Dec 01 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Makoto Kanzaki, Ph.D.Academic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: (No Response)Reviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This study investigated the effect of Lys on intracellular signaling pathways in the C2C12 myotubes and 3T3-L1 adipocyte. And found that Lys prevents the induced HG-cell death in both C2C12 myotubes and 3T3-L1 adipocytes through the reduction of oxidative stress and regulation of the UPR. I have some specific comments for the authors to consider in revising their manuscript.1.”These figures indicate a significant decrease (p= 0.000) in the cell viability due to the HG treatment in comparison with the control cells.” and “Despite the improvement effect of Lys, the viability of the cells treated with Lys+HG was significantly (p= 0.000) lower than control cells, in both cell lines.” Which is” the control cells”, not explicitly stated in the manuscript. Figure 2 didn't show which were control cells.2."Figures 3A and 3B show the percentages of C2C12 and 3T3-L1 cells, respectively, at each quarter." However, A and B are not marked in Figure 3.3.In Figures 4 and 5, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.4.In Figures 6BC and 7BC, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.5.Western blot data should show loading control (β-Actin) in Figures 8 and 9.6.In Figures 8A, molecular weight of LC3-I/LC3-II wrong labeled.7.In Figures 8 and 9, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.8.Image and digital resolutions are unclear.9.The authors should double-check grammatical and punctuation.Reviewer #2: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.26 Oct 2019Reviewer #1: This study investigated the effect of Lys on intracellular signaling pathways in the C2C12 myotubes and 3T3-L1 adipocyte. And found that Lys prevents the induced HG-cell death in both C2C12 myotubes and 3T3-L1 adipocytes through the reduction of oxidative stress and regulation of the UPR. I have some specific comments for the authors to consider in revising their manuscript.1.”These figures indicate a significant decrease (p= 0.000) in the cell viability due to the HG treatment in comparison with the control cells.” and “Despite the improvement effect of Lys, the viability of the cells treated with Lys+HG was significantly (p= 0.000) lower than control cells, in both cell lines.” Which is” the control cells”, not explicitly stated in the manuscript. Figure 2 didn't show which were control cells.Thank you very much for your kind consideration and very useful comments. We included the explanation about the control in the legend of Figure. 1. Actually, time zero (0) was considered as control with no treatment.2."Figures 3A and 3B show the percentages of C2C12 and 3T3-L1 cells, respectively, at each quarter." However, A and B are not marked in Figure 3.You are right. I am so sorry. The labels were added to Figure 3.3.In Figures 4 and 5, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.4.In Figures 6BC and 7BC, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.To avoid any confusion, we did not. But, as the respected reviewer suggested, Figures 4, 5, 6BC and 7BC were additionally labeled with stars; and the stars were defined in the legends.5.Western blot data should show loading control (β-Actin) in Figures 8 and 9.We added the loading control (β-Actin) in Figures 8 and 9.6.In Figures 8A, molecular weight of LC3-I/LC3-II wrong labeled.Thank you very much. It was corrected.7.In Figures 8 and 9, only showed the p-value of the difference between the time points, but the p-value of the difference between the groups is not labeled.As reviewer suggested, Figures 8 and 9 were additionally labeled with stars; and the stars were defined in the legends.8.Image and digital resolutions are unclear.They were clarified.9.The authors should double-check grammatical and punctuation.Thanks for your suggestions. The grammatical and punctuation mistakes in the manuscript have been carefully checked and corrected.Submitted filename: Answer to Reviewer 98-08-04.docxClick here for additional data file.15 Nov 2019L-Lysine Protects C2C12 Myotubes and 3T3-L1 Adipocytes Against High Glucose Damages and StressesPONE-D-19-20629R2Dear Dr. Bathaie,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Makoto Kanzaki, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No12 Dec 2019PONE-D-19-20629R2L-Lysine protects C2C12 myotubes and 3T3-L1 adipocytes against high glucose damages and stressesDear Dr. Bathaie:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Makoto KanzakiAcademic EditorPLOS ONE
Authors: David C Rubinsztein; Ana Maria Cuervo; Brinda Ravikumar; Sovan Sarkar; Viktor Korolchuk; Susmita Kaushik; Daniel J Klionsky Journal: Autophagy Date: 2009-07-23 Impact factor: 16.016