| Literature DB >> 31847070 |
Aline B Negreiros1, Geice R Silva1, Francisca A S Oliveira2, Helder C Resende3, Tânia M Fernandes-Salomão3, Rodrigo Maggioni2, Fabia M Pereira4, Bruno A Souza4, Maria T R Lopes4, Fábio M Diniz5.
Abstract
The species Melipona rufiventris Lepeletier, 1836 is a Brazilian native stingless bee that is part of a species complex known as the 'rufiventris group', making it difficult to distinguish between the different species. Populations in this group are facing a severe decline, leading to the risk of local extinction, and therefore, their conservation should be treated as a major concern. This study describes the first set of tri- and tetranucleotide microsatellite markers, using next-generation sequencing technology for use in the identification of genetic diversity and population structure in the 'rufiventris group'. A total of 16 microsatellite loci displayed polymorphism. Analysis of the whole data set (n = 50) detected 63 alleles in all loci, ranging from 2 to 7 with a mean of 3.9 alleles/locus. A genetic diversity analysis revealed high values for population differentiation estimates (FST = 0.252, RST = 0.317, and DEST = 0.284) between the Atlantic Forest, Cerrado, and Caatinga biomes. An additional evidence for genetic divergence among populations was also found in the 'rufiventris group'; these should be treated as separate conservation units or even as separate species. These microsatellite markers have demonstrated a strong potential for assessing population discrimination in this threatened stingless bee group.Entities:
Keywords: Illumina platform; NGS technology; conservation; genetic differentiation; molecular markers; population genetics
Year: 2019 PMID: 31847070 PMCID: PMC6955984 DOI: 10.3390/insects10120450
Source DB: PubMed Journal: Insects ISSN: 2075-4450 Impact factor: 2.769
Figure 1Sampling locations of the ‘Melipona rufiventris group’ in Brazilian continental biomes. Atlantic Forest (▲), Caatinga (■), and Cerrado (υ). The map of Brazil used for the elaboration of Figure 1, and the shapefile to generate it, were extracted from the database of public domain of the Brazilian Institute of Geography and Statistics-IBGE (http://mapas.ibge.gov.br/bases-e-referenciais.html), and was further modified using Inkscape 0.91 (https://inkscape.org/en/).
Location and number of Melipona rufiventris (‘rufiventris group’) colonies and worker bees sampled within three Brazilian continental biomes.
| Localities | State | Biome | Latitude/Longitude | Number of Colonies (Worker Bees) |
|---|---|---|---|---|
| Guimarânia | Minas Gerais | Cerrado | −18°50′/−46°47′ | 4 (4) |
| Araguari | Minas Gerais | Cerrado | −18°38′/−48°11′ | 3 (3) |
| Patos de Minas | Minas Gerais | Cerrado | −18°34′/−46°31′ | 1 (1) |
| Uberlândia | Minas Gerais | Cerrado | −18°55′/−48°16′ | 1 (1) |
| Águas do Paraíso | Minas Gerais | Cerrado | −20°19′/−45°27′ | 1 (1) |
| Iguatama | Minas Gerais | Cerrado | −20°10′/−45°42′ | 2 (2) |
| Tapiraí | Minas Gerais | Cerrado | −19°53′/−46°01′ | 1 (1) |
| Bambuí | Minas Gerais | Cerrado | −20°00′/−45°58′ | 1 (1) |
| Arcos | Minas Gerais | Cerrado | −20°16′/−45°32′ | 4 (4) |
| Lagoa da Prata | Minas Gerais | Cerrado | −20°01′/−45°32′ | 1 (1) |
| Córrego Danta | Minas Gerais | Cerrado | −19°49′/−45°54′ | 1 (1) |
| Caçu | Goiás | Atlantic Forest | −18°33′/−51°07′ | 5 (15) |
| Murici dos Portelas | Piauí | Caatinga | −03°19′/−42°05′ | 3 (4) |
| Campo Maior | Piauí | Caatinga | −04°49′/−42°10′ | 2 (5) |
| Castelo do Piauí | Piauí | Caatinga | −05°19′/−41°33′ | 1 (3) |
| Guadalupe | Piauí | Caatinga | −06°47′/−43°34′ | 1 (3) |
| Total | - | - | - | 32 (50) |
Characteristics and amplification of 16 polymorphic microsatellite markers developed for Melipona rufiventris (N = 50).
| Locus | Primer Sequence (5′–3′) | Motifs | PCR | Ta (°C) | Size |
| GenBank |
|---|---|---|---|---|---|---|---|
| F: CAGTCGCCCAAGTAAATACG | (AGCC)8 | PCRSTD1 | 54 | 142–166 | 6 | MK133898 | |
| F: GTTACGTTGGCAGGAGAGC | (TGCT)8 | PCRSTD1 | 52 | 146−166 | 6 | MK133901 | |
| F: AGTGAAATCCGAGAGTGGGTT | (AGAA)9 | PCRSTD1 | 51 | 154−170 | 4 | MK133902 | |
| F: GTGCCTCGTTACCACCTTCTC | (CT)9N13(GTCT)6 | PCRSTD1 | 54 | 106−110 | 2 | MK133903 | |
| F: CATCGTCCTCCCGTGAATATAG | (GCTG)10 | PCRSTD1 | 50 | 102−122 | 5 | MK133905 | |
| F: TATACTTACGAGAGCGCACGAG | (AACG)9 | PCRSTD1 | 55 | 118−140 |
| MK133906 | |
| F: TGTGACGTTTTGGACGTAATTC | (TTTA)13 | PCRSTD2 | 48 | 112−124 | 4 | MK133908 | |
| F: GCTAGGGGACCTTCTTCTTCTT | (TTC)12 | PCRSTD1 | 50 | 100−106 | 2 | MK133910 | |
| F: AAGTGGGGAGCTAATAAGGGAG | (TTC)12 | PCRSTD3 | 51 | 157−172 | 4 | MK133912 | |
| F: GTCGAGGACGACTACACAACAA | (ACG)15 | PCRSTD1 | 52 | 161−173 | 3 | MK133914 | |
| F: AAGCGGACAAGCAGATCACT | (AAT)9 | PCRSTD1 | 52 | 108−126 | 6 | MK133915 | |
| F: CACTGTCTTGTATTTAGACGCAATC | (TTG)14 | PCRSTD1 | 55 | 125−134 | 2 | MK133916 | |
| F: CGGGTAGTATTAAGGGAATTGA | (ATT)9 | PCRSTD1 | 54 | 184−193 |
| MK133917 | |
| F: CTACCGAGAGTAGCGACGACAT | (ACG)11 | PCRSTD1 | 54 | 150−162 | 2 | MK133918 | |
| F: CGACTTCGCGTGGTGCTAC | (ACG)9 | PCRSTD1 | 54 | 125−131 | 2 | MK133919 | |
| F: AACAAGAGCAAAGTAACGACGA | (ACG)7N11(GAA)13 | PCRSTD3 | 51 | 137–155 | 6 | MK133922 |
Ta: Annealing temperature; NA: Number of alleles; PCRSTD1: (94 °C–5 min; 30 cycles (94 °C–40 s; Ta–30 s; 72 °C–40 s); 72 °C–7 min); PCRSTD2: (94 °C–5 min; 45 cycles (94 °C–40 s; Ta–30 s; 72 °C–40 s); 72 °C–7 min); PCRSTD3: (94 °C–5 min; 40 cycles (94 °C–40 s; Ta–30 s; 72 °C–40 s); 72 °C–7 min).
Variability of 16 microsatellite loci and genetic diversity estimates in the ‘Melipona rufiventris group’.
|
| Minas Gerais (n = 20) | Goiás (n = 15) | Piauí (n = 15) |
|
|
| ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| PIC | pHWE | Null |
| PIC | pHWE | Null |
| PIC | pHWE | Null | |||||||
| 1.0 | 0.000/0.000 | 0.000 | - | 0.000 | 3.5 | 0.286/0.664 | 0.569 | 0.001 * | 0.216 | 4.6 | 0.357/0.762 | 0.689 | 0.001 * | 0.218 | 0.288 ¶ | 0.279 ¶ | 0.333 ¶ | |
| 2.9 | 0.500/0.472 | 0.410 | 0.664 | −0.027 | 3.6 | 0.786/0.643 | 0.562 | 0.473 | −0.102 | 3.0 | 0.429/0.593 | 0.501 | 0.224 | 0.091 | 0.329 ¶ | 0.676 ¶ | 0.622 ¶ | |
| 2.0 | 0.077/0.212 | 0.183 | 0.118 | 0.106 | 3.0 | 0.615/0.625 | 0.532 | 0.025 | −0.009 | 3.0 | 0.429/0.569 | 0.485 | 0.355 | 0.077 | 0.287 ¶ | 0.428 ¶ | 0.357 ¶ | |
| 2,0 | 0.917/0.518 | 0.373 | 0.014 | −0.281 | 1.0 | 0.000/0.000 | 0.000 | − | 0.000 | 2.0 | 1.000/0.520 | 0.375 | 0.001 * | −0.333 | 0.270 ¶ | 0.270 ¶ | 0.229 ¶ | |
| 2,0 | 0.400/0.337 | 0.269 | 1.000 | −0.061 | 2.6 | 0.385/0.335 | 0.290 | 1.000 | −0.047 | 3.8 | 0.500/0.540 | 0.482 | 0.166 | 0.011 | 0.433 ¶ | 0.363 ¶ | 0.508 ¶ | |
| 3.9 | 0.294/0.709 | 0.630 | 0.000 * | 0.234 | 4.8 | 0.800/0.766 | 0.701 | 0.351 | −0.035 | 3.9 | 0.556/0.732 | 0.631 | 0.036 | 0.080 | 0.058 | 0.160 | 0.193 ¶ | |
| 4.0 | 1.000/0.779 | 0.696 | 0.010 | −0.147 | 3.8 | 0.786/0.717 | 0.633 | 0.000 * | −0.056 | 4.0 | 0.667/0.752 | 0.657 | 0.050 | 0.025 | 0.030 | −0.014 | 0.083 | |
| 2.0 | 0.933/0.515 | 0.374 | 0.002 * | −0.291 | 2.0 | 0.818/0.506 | 0.367 | 0.066 | −0.226 | 2.0 | 1.000/0.524 | 0.375 | 0.003 * | −0.333 | 0.002 | 0.002 | 0.002 | |
| 3.1 | 0.714/0.521 | 0.433 | 0.430 | −0.141 | 2.7 | 0.308/0.283 | 0.255 | 1.000 | −0.028 | 2.8 | 0.400/0.416 | 0.347 | 0.223 | −0.004 | 0.053 | 0.085 | 0.035 ¶ | |
| 1.0 | 0.000/0.000 | 0.000 | - | 0.000 | 1.0 | 0.000/0.000 | 0.000 | - | 0.000 | 2.0 | 0.462/0.492 | 0.361 | 1.000 | 0.008 | 0.850 ¶ | 0.771 ¶ | 0.847 ¶ | |
| 2.4 | 0.053/0.437 | 0.354 | 0.000 * | 0.261 | 4.0 | 0.833/0.775 | 0.695 | 0.005 | −0.052 | 2.7 | 0.917/0.562 | 0.432 | 0.013 | −0.246 | 0.309 ¶ | 0.333 ¶ | 0.613 ¶ | |
| 2.0 | 0.850/0.501 | 0.369 | 0.002 * | −0.243 | 2.0 | 1.000/0.517 | 0.375 | 0.000 * | −0.333 | 2.0 | 1.000/0.517 | 0.375 | 0.000 * | −0.333 | 0.005 | 0.005 | 0.005 | |
| 2.0 | 0.500/0.386 | 0.305 | 0.526 | −0.091 | 2.0 | 0.308/0.271 | 0.226 | 1.000 | −0.038 | 1.0 | 0.000/0.000 | 0.000 | − | 0.000 | 0.106 | 0.106 | 0.033 | |
| 2.0 | 0.375/0.315 | 0.258 | 1.000 | −0.054 | 2.0 | 0.636/0.455 | 0.340 | 0.481 | −0.141 | 2.0 | 0.250/0.233 | 0.195 | 1.000 | −0.026 | 0.019 | 0.019 | 0.012 | |
| 2.0 | 0.800/0.513 | 0.375 | 0.022 | −0.200 | 2.0 | 0.692/0.471 | 0.350 | 0.208 | −0.165 | 2.0 | 0.333/0.287 | 0.239 | 1.000 | −0.044 | 0.112 ¶ | 0.112 ¶ | 0.083 ¶ | |
| 3.5 | 0.813/0.579 | 0.498 | 0.206 | −0.162 | 3.0 | 0.500/0.633 | 0.511 | 0.322 | 0.059 | 3.0 | 0.700/0.532 | 0.442 | 0.503 | −0.130 | 0.278 ¶ | 0.649 ¶ | 0.491 ¶ | |
| Mean | 2.4 | 0.514/0.425 | 0.345 | - | 2.7 | 0.547/0.479 | 0.400 | - | 2.7 | 0.563/0.502 | 0.412 | - | 0.252 ¶ | 0.317 ¶ | 0.284 ¶ | |||
: Allelic richness; : Observed heterozygosity; HE: Expected heterozygosity; PIC: Polymorphic Information Content; pHWE: probabilities of departure from Hardy–Weinberg equilibrium; Null: Null alleles frequency. * Locus that deviated significantly from HWE after Bonferroni correction (adjusted critical p < 0.0029). Significant (p < 0.05). Negative null-allele frequencies are a software artefact and can be interpreted as zero.
Figure 2(a) Determination of the best number of genetic clusters from STRUCTURE analysis for microsatellite loci in ‘Melipona rufiventris group’ colonies; K is the number of clusters. (b) Bar plot from inferred population structure using the Bayesian grouping admixture model-based program STRUCTURE (K = 2). (c) Scatter-plot of the principal coordinate analysis (PCoA) using SSR loci. υ Minas Gerais (Cerrado); ▲ Goiás (Atlantic Forest); and ■ Piauí (Caatinga).