Characterization of microsatellite loci in Brighamia insignis and transferability to other genera in the Hawai'ian lobelioid group.

PREMISE: Microsatellite markers were developed to measure genetic diversity and relatedness of ex situ collections of Brighamia insignis (Campanulaceae). METHODS AND
RESULTS: Potential microsatellite markers were identified from two sources; 28 were developed for B. insignis and an additional 12 markers from a previously published study of Lobelia villosa. Primer pairs were tested on 30 individuals of B. insignis and 24 individuals of B. rockii to provide measures of genetic diversity and inbreeding. We assessed cross-species amplification in an additional 13 taxa that represented all six genera within the Hawai'ian lobelioid group to determine the broader applicability of the markers.
CONCLUSIONS: Results indicate that these primers will provide useful estimates of genetic diversity and relatedness of ex situ collections of both Brighamia species. In addition, we have also demonstrated the widespread applicability of these markers for use in population genetic studies of several species within the Hawai'ian lobelioid group.

With over 126 species, the Hawai‘ian lobelioids represent one of the best examples of adaptive radiation (Givnish et al., 2009). Unfortunately, for many species in this group, wild populations are so reduced that they are now of high conservation concern. For example, the genus Brighamia A. Gray is composed of two species, B. insignis A. Gray and B. rockii H. St. John, which were once found on multiple Hawai‘ian islands (Gemmill et al., 1998) but are currently reduced to only one individual of B. insignis and fewer than 100 individuals of B. rockii (Walsh, 2016). Fortunately, the National Tropical Botanical Garden began making collections in the 1970s and has distributed germplasm to botanic gardens around the world (Hannon and Perlman, 2002). According to the global plant collections database PlantSearch (https://tools.bgci.org/plant_search.php), at least 56 other botanic gardens maintain collections of this species. This conservation effort helped B. insignis escape extinction and could ultimately provide potential in situ restoration material. However, recent genetic analysis of the ex situ populations suggests a loss of genetic diversity and fitness declines associated with inbreeding depression (Walsh, 2015).

This loss of genetic diversity could be mitigated by developing a robust breeding program that incorporates genetic data into breeding decisions and ex situ management (Fant et al., 2016). An important first step in this process is to track the origins of all material in collections; however, the majority of individuals have uncertain parentage. Neutral molecular markers can be used to estimate relatedness of individuals with unknown parentage. Unfortunately, previous genetic markers used for Brighamia studies have revealed only a limited amount of genetic diversity (Gemmill et al., 1998; Walsh, 2015). Here we report 28 microsatellite markers developed for B. insignis and 12 published primers from Lobelia villosa (Rock) H. St. John & Hosaka (Tran et al., 2015) that were tested on B. insignis and B. rockii, as well as on an additional 13 taxa that represented all six genera in the Hawai‘ian lobelioid group.

METHODS AND RESULTS

Genomic DNA was extracted using the modified 2× cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). We tested all primers on 15 taxa that represented the six genera within the Hawai‘ian lobelioid group; for each taxon, one to two samples were tested. These included both species of Brighamia (B. insignis and B. rockii), two species of Clermontia Gaudich. (C. fauriei H. Lév. and C. samuelii C. N. Forbes subsp. hanaensis (H. St. John) Lammers), six species of Cyanea Gaudich. (C. fissa Hilldebr., C. hardyi Rock, C. hirtella Hilldebr., C. leptostegia A. Gray, C. pseudofauriei Lammers, and C. salicina H. Lév.), three species of Delissea Gaudich. (D. kauaiensis (Lammers) Lammers, D. rhytidosperma H. Mann, D. waianaeensis Lammers), as well as Lobelia niihauensis H. St. John and Trematolobelia kauaiensis Skottsb. The Brighamia sources were identified using the PlantSearch database, and the other Hawai‘ian lobelioids were obtained from the National Tropical Botanic Garden living collections and DNA Library (Appendix 1).

Genomic DNA from two B. insignis individuals was sent to the microsatellite‐development company Genetic Marker Services (Brighton, United Kingdom). Libraries were constructed by adapter‐ligation of digested genomic DNA, which was then screened with the following filter‐bonded synthetic repeat motifs: (AG)17, (AC)17, (AAC)10, (CCG)10, (CTG)10, and (AAT)10. These were transformed into E. coli, plated onto agar/ampicillin plates, and screened for motif‐positive clones, which were then isolated, cultured, and sequenced. The online primer design software Primer3 (Rozen and Skaletsky, 1999) was used to select primers that would minimize multi‐loading overlap ambiguities during sequencer genotyping. A total of 28 primer pairs were designed from the libraries, and these amplified products ranging from 100–250 bp. These, and an additional 12 published primers for L. villosa (Tran et al., 2015), were tested on all samples. To visualize and quantify allele sizes, the forward primer derived from B. insignis libraries was modified with WellRed Black (D2), Green (D3), or Blue (D4) fluorescent dye (Sigma‐Aldrich, St. Louis, Missouri, USA). Primers derived from L. villosa were modified at the 5′ end (5′‐CACGACGTTGTAAAACGAC‐3′) so they could be labeled separately (Schuelke, 2000). The PCR consisted of 10–50 ng of template DNA, 25 μM of modified forward and reverse primer, and Bioline PCR MasterMix 2× (Bioline USA, Taunton, Massachusetts, USA) and was performed at 94°C for 3 min; followed by 35 cycles of 94°C for 40 s, 57°C for 40 s, and 72°C for 90 s; with a final extension of 72°C for 10 min. For the L. villosa primers, the PCR reactions were stopped after 13 cycles to add 5 μL of labeled primer (CACGACGTTGTAAAACGAC [25 μM]) and returned to the thermocycler for the remaining 27 cycles. All products were analyzed and scored using a CEQ 8000 Genetic Analysis System V9.0 (Beckman Coulter, Brea, California, USA).

Of the 28 primers derived from the B. insignis libraries, 10 did not amplify in any species tested (GenBank accession no.: MK387345, MK387350, MK387353, MK387356, MK387359, MK387360, MK387361, MK387365, MK387368, MK387371); the remaining 18 primers produced bands in some species tested (Tables 1, 2). All 12 primers from L. villosa amplified in at least one species. Of the combined 30 primer pairs that amplified a product, 12 (seven from B. insignis and five from L. villosa) produced a maximum of two bands, consistent with amplifying a single locus, whereas the remaining 18 primer pairs (11 from B. insignis and seven from L. villosa) produced more than two bands in some species. This was expected because many of the Campanulaceae species are paleotetraploids (Lammers, 1988). Once we accounted for stutter, A‐tails, and spurious, non‐reproducible peaks, we assumed alleles clustered within a narrow range and separated from other alleles by a large range (20–30 bp) to be derived from a single locus. Although we could not do this reliably for every primer pair, we were able to cross‐reference our putative loci ranges by comparing them to species that amplified a single locus.

Table 1

Characteristics of 30 microsatellite loci used for screening in this study, including 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa

Species and locus	Primer sequences (5′–3′)	Repeat motif	Allele size range (bp)	Fluorescent label	GenBank accession no.a
Brighamia insignis
BRIN01	F: CTTGTTGCAGGATGGGAGTT	(GA)17	202–222	Green [D3‐PA]	MK387344
	R: GGGTATCCACCCTTTCCTTC
BRIN05	F: GAATGGTTTTCACTTTCCCAAC	(GT)17	181–207	Blue [D4‐PA]	MK387346
	R: ATCTCTTACCCCGGAAGCAC
BRIN07	F: TTCAGCACAGATCCCTTTTG	(TG)16(AG)7	167	Green [D3‐PA]	MK387347
	R: TCCAGATTCAGCTCCTCCAG
BRIN08	F: AGACGGCTCGGGGTATAACT	(TG)12	146–154	Blue [D4‐PA]	MK387348
	R: GTACCATTCTCGTATTTACCCA
BRIN10	F: CAGCTGTTACCGTCTTCTGC	(CT)11(CA)14	148–186	Blue [D4‐PA]	MK387349
	R: TTTCTAAAGTTACAAAATCAAGG
BRIN41	F: CAACGCTGATGATGATGATTG	(TG)14	111–125	Black [D2‐PA]	MK387352
	R: ACCCTTCGTTCCAAAGATCC
BRIN43	F: GGACCAACAATTGGAGAAACA	(CT)27	174–248	Blue [D4‐PA]	MK387354
	R: CTGATGCTGAACATCTGTAAACAA
BRIN44	F: ACTGGATTGAAAGCCTTACTTTG	(AG)14	142–162	Black [D2‐PA]	MK387355
	R: CTAATGCACATTTTTGGATTGCT
BRIN46	F: GGAAAACTGATGTGCGTTGA	(TC)13(AC)10	232–254	Blue [D4‐PA]	MK387357
	R: TTGCTTCATGACTTGAGCTTG
BRIN47	F: CCCCTCCATTTCAAGGTTCT	(GT)12	152–188	Green [D3‐PA]	MK387358
	R: CCTCAGCAGGGGAAAAGTAA
BRIN51	F: GACAAGGGACATGGCTGTTT	(CT)16(CA)12	170–208	Green [D3‐PA]	MK387362
	R: TGAGAGTTTGATCTGCACAAAA
BRIN53	F: GCTTGTTGCACAACATGAAA	(AG)12	165–177	Green [D3‐PA]	MK387363
	R: TGATAGTCACAGTTTGGCTGA
BRIN54	F: TGTGAATGGCTGGTTGGTAA	(GT)9	168–176	Green [D3‐PA]	MK387364
	R: GCCTAAAGGCAAAGAGTTTGAA
BRIN56	F: CGCGAAGTCCAGAAGAAAAC	(CA)11	104	Black [D2‐PA]	MK387366
	R: TTTTGTTTCACTCTTCGTCCA
BRIN57	F: TGGGAGAAAATTGAAAGCAAA	(GT)7(GA)22	223–233	Blue [D4‐PA]	MK387367
	R: GTACAAAGAATCCACTCACTCGC
BRIN59	F: ACCAGGGATTGTTCGCTAAG	(GA)29	—	Green [D3‐PA]	MK387351
	R: GGCTCTGTGGCATTCAAAGT
BRIN61	F: GTGAGCTGGGTGGTTGTTTT	(AG)14	183–191	Green [D3‐PA]	MK387369
	R: AGGAGGACCCCTCAACAATC
BRIN66	F: GTACTGCATGCCCTGTGTT	(GT)10(GA)10	157–181	Blue [D4‐PA]	MK387370
	R: GATGCGCTCAAACGAGAGTT
Lobelia villosa
LOVI4	F: ACGTCTAGGGGCACTGCCAAGCCAG	(AC)12	248–268	M13F‐green [D3‐PA]
	R: TCCAAATGGGAGACTACTGCAGAAAGG
LOVI23	F: TCTTTTGTCCATGCCAGCGTG	(AC)11	401–437	M13F‐blue [D4‐PA]
	R: AGGTACTCGGTCTGAGCGTTTCG
LOVI33	F: ACAGGGGGCAAAACTGGTCACC	(GT)8(GA)9	372–378	M13F‐black [D2‐PA]
	R: TGCAAGGATGACGAAGGGGCTC
LOVI34	F: ACAGGCGCTATGGCGTCCCT	(CA)10	155	M13F‐blue [D4‐PA]
	R: GTTGTATGCATCATGAGACCGTC
LOVI35	F: GCTTACAACAAATTGCCTC	(CA)17	230–256	M13F‐black [D2‐PA]
	R: AGCCTCGAAATCATCCGGCCCA
LOVI37	F: GGATCACTCAAGGATGAACTCGCAAGG	(GA)14	470–478	M13F‐green [D3‐PA]
	R: TGTGTAATGGACCTTGGGCTGTCTC
LOVI48	F: TCACCGAACGATTCATCGAACCA	(AC)7A(AC)5	400–420	M13F‐green [D3‐PA]
	R: ACGAGTGAGAGACTTTTGGGTGATCA
LOVI52	F: CGAATGATCTATTATTCCAGCC	(AC)11	—	M13F‐blue [D4‐PA]
	R: AGACACTTCCTCGAGTTGGTG
LOVI56	F: AGCATCAGCAAGACACTTGC	(CT)9(CA)14	536–640	M13F‐black [D2‐PA]
	R: AGTAAGGGATAAAGCAGACCTGG
LOVI73	F: TCACAAATGCTCCATCGCGAG	(CA)9	468–478	M13F‐black [D2‐PA]
	R: TGTAGCGGAAAGTACCGGATCCA
LOVI90	F: ACCGGCTGTAATCACGCGTTGG	(CA)12	200–206	M13F‐blue [D4‐PA]
	R: CTACTGTGTGAAGTCGGAAAACC
LOVI93	F: TCTAGCAGAAGCCTCACCCCGGA	(GT)10	287–397	M13F‐green [D3‐PA]
	R: CACCAGAACTCAAGCAAGGCGAC

— = no amplified product.

Accession numbers are provided for loci developed for Brighamia insignis. Loci for Lobelia villosa were previously published in Tran et al. (2015).

Table 2

Allele size ranges for the 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa, tested on 15 taxa from the Hawai‘ian lobelioid complex.a

Locus	Brighamia insignis (n = 30)	Brighamia rockii (n = 24)	Clermontia fauriei (n = 2)	Clermontia samuelii (n = 1)	Cyanea fissa (n = 2)	Cyanea hardyi (n = 2)	Cyanea leptostegia (n = 2)	Cyanea hirtella (n = 2)	Cyanea pseudofauriei (n = 2)	Cyanea salicina (n = 1)	Delissea kauaiensis (n = 2)	Delissea rhytidosperma (n = 2)	Delissea waianaeensis (n = 1)	Lobelia niihauensis (n = 2)	Trematolobelia kauaiensis (n = 2)
BRIN01	202–208 218–222	192–206 214–218	134–144 172–194	144 194	132–142 179–197	138	138	142 156–672	138	140–142 162	140–158	—	140–142	154	142
BRIN05	181–207	181–205	187–194	194	189–195	186	186	190–196	154–162 186	191	145–149 181	181	181	180	195–200
BRIN07	167	149–173	153–160 187–191	165 194	156–163 196	185	—	158–169	—	—	—	175–187	181	165–179	144–152 195–197
BRIN08	146–154	146–148	111–131	123	123–146	152–154	159–161	146	155–163	146	146	141–143	146	152	152
BRIN10	148–170 174–186	150–152 168–178	146–154	154	149–165	160	267	149 165–171	160	149 165	175	—	154–171	149–151 169	143 163–171
BRIN41	111–125	115–125	—	—	—	—	—	—	—	100	103–106	—	122	110	100
BRIN43	174–190 228–248	188–218 228–234	198–201 215–232	198 206–225	201–208	193 209	183 203–209	191 201–205	189–193 201–215	185–199	190–198	197–205 210–213	209–219	183	187–192
BRIN44	142–148 152–162	126–138	215–217 224	182	182	160	223–230	182	211	182	197–215 238–240	195 207–224	224–228	205–215	185–220
BRIN46	232–254	234–252	244–248	240	263	209–218 224–234	240–260	228–238 260	209 230–240	245–249	250–266	250	268	241–258	228–230
BRIN47	152–178 182–188	150–164 174–188	167–170 181–184	169 182	—	—	—	—	—	172	170–180	167–183	167–180	—	160 170
BRIN51	170–174 180–208	164–176 182–186	172–176 184–198	173 190–210	160–172	168	172 198	172 188	153–165 184	172 182	156 180–182	156 172–182	156 184–196	170–182 188–198	182 194–228
BRIN53	165–177	171–177	—	173	—	161	—	161	158–162	160	188	185–190	188	145–161	146–161
BRIN54	168–176	158–180	—	160	168–172	163	165	168–172	163	168	166	163–166	167	156–158	166
BRIN56	104	114–116	92–108	104	101–107	98–105	97–103	109–115	98–112	107–113	97–109	106	92–114	85–91	96–115
BRIN57	223–233	219–248	204–206	202	160	218–222	210–222	161–167	218–228	138–161	218	—	222	205	241–247
BRIN59	—	—	178–204 220–240	182–195 200–210	168–192	—	—	172–190	—	—	—	—	—	—	—
BRIN61	183–191	181–193	—	193	181–190	—	193–208	181–193	191–193 250–268	181	181–201	—	181–205 293	181 205–215	182 207–209
BRIN66	157–181	157–177	—	161	—	157–175	—	158–174	156–173	173–175	157–159	159	173	174–176	148–150
LOVI04	248 268	248	253–259 260–266	253–259	241–287	254 290–294	250–289	242–282	255	252–260 277–288	252	253–261	—	249–259 269–276	255 269
LOVI23	401–411 417–437	397 415–417	401 419	402 423	400 421–423	401–403 412	400–403	—	393–403	400 424	417 430–445	419	415–429	403–412	403 422–434
LOVI33	372–378	368–382	355	257	350	348–359	356–360	350–352	358	350–354	368	384	362	367–395	346
LOVI34	155	151–165	—	—	156–160	156	155	156–160	156	156–160	—	154–165	154–161	—	—
LOVI35	230–236 256	236–242 256	—	—	261–275	260–271	254	260–265	254–264	261	—	234–255	231	—	—
LOVI37	470–478	476–484	—	429–433 452	471–497	—	—	460–494	481	490–502	409–420	480–490	472	428–448	425
LOVI48	400–420	376–404	—	422–428	402–425	410–430	424–434	413	412–418	—	—	—	401	403–408	406
LOVI52	—	157–173 194–204	—	171 210	171–199 208–222	—	172 208–218	172	170–199 208–218	172–199 224–242	—	—	—	—	—
LOVI56	536–558 618–640	520–546 618–620	—	552 620	544–550 618–623	548–554 622	548–550 622	546 622	548 622	546 623	541 620	545–562 620	535 620	573–581	564–572
LOVI73	468–478	468–478	467	465	—	467	467	467	—	467	466–475	473	477	452–474	459
LOVI90	200–206	200	201–211	203	—	200	203–215	204–206	—	205–209	180	200	200	184–204	200–212
LOVI93	287 391‐397	287 393	382–390	394–402	—	365	375	340	—	310	342	377	288	356–376	—

— = no data available; n = number of individuals tested.

For primers amplifying more than one locus (>2 bands), the predicted allele ranges are listed separately for each locus. Ranges were determined based on allele sizes in a homozygous state (only two bands produced—one from each loci), presence of a large breaks in allele size ranges (suggesting no overlap), and cross referencing with other species (assuming common origins of loci).

Once primer pairs had been characterized across the 15 taxa, we tested them on a larger subset of B. insignis (n = 30) and B. rockii (n = 24) samples. Of the 30 primer pairs tested, one did not amplify reliably in either species (locus BRIN59, GenBank accession no. MK387351) and one did not amplify in B. insignis (LOVI52; Tran et al., 2015). With the remaining primer pairs, one (LOVI4) was monomorphic in both species, three were monomorphic only in B. insignis (BRIN07, BRIN56, and LOVI34), and two were monomorphic only in B. rockii (LOVI90 and LOVI93). Of the primer pairs that were polymorphic in one species, 18 produced a maximum of two peaks consistent with amplifying a single locus, and 12 produced multiple bands. Of the 12 primer pairs producing multiple bands, nine produced more than two peaks in both species (BRIN01, BRIN10, BRIN43, BRIN47, BRIN51, LOVI23, LOVI35, LOVI56, and LOVI93), two (BRIN44, LOVI04) produced more than two bands only in B. insignis, and one (LOVI52) produced more than two peaks only in B. rockii. For all 30 loci, we report the following descriptive parameters: range, number of alleles, effective number of alleles, observed and expected heterozygosity, and inbreeding coefficient (Table 3; calculated in GenAlEx [Peakall and Smouse, 2006]). As most of the individuals within ex situ collections are related, they violate the expectation of random mating required to detect deviation from Hardy–Weinberg equilibrium, null alleles, and linkage disequilibrium.

Table 3

Genetic characterization of 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa across 30 B. insignis individuals and 24 B. rockii individuals

Locus	B. insignis (n = 30)						B. rockii (n = 24)
	Range (bp)	A	A e	H o	H e	F	Range (bp)	A	A e	H o	H e	F
BRIN01	202–208	2	1.1	0.00	0.07	1.00	192–206	4	2.3	0.27	0.56	0.51
	218–222	3	1.5	0.15	0.31	0.53	214–218	2	1.0	0.05	0.05	−0.02
BRIN05	181–207	7	2.5	0.33	0.61	0.45	181–205	9	5.9	0.39	0.83	0.53
BRIN07	167	1	1.0	—	—	—	149–173	7	3.0	0.43	0.67	0.36
BRIN08	146–154	4	2.0	0.18	0.50	0.64	146–148	2	1.8	0.11	0.43	0.76
BRIN10	148–170	6	1.4	0.07	0.30	0.75	150–152	2	2.0	0.09	0.50	0.83
	174–186	5	1.5	0.07	0.32	0.77	168–178	3	2.4	0.33	0.58	0.43
BRIN41	117–125	4	1.9	0.11	0.47	0.77	115–125	2	1.9	0.05	0.48	0.89
BRIN43	—	0	—	—	—	—	188–218	9	2.1	0.50	0.53	0.05
	228–248	5	3.6	0.09	0.72	0.87	228–234	3	2.9	0.11	0.65	0.84
BRIN44	142–148	4	1.9	0.14	0.48	0.70	126–138	5	2.1	0.71	0.52	−0.36
	152–162	4	1.7	0.10	0.42	0.77	—	0	—	—	—
BRIN46	232–254	4	2.1	0.17	0.53	0.69	234–254	5	2.7	0.14	0.63	0.77
BRIN47	152–178	6	2.4	0.18	0.58	0.69	150–164	5	2.3	0.77	0.57	−0.36
	182–188	3	1.1	0.04	0.12	0.65	174–188	5	4.0	0.50	0.75	0.33
BRIN51	170–174	2	1.4	0.00	0.28	1.00	164–176	4	2.1	0.20	0.52	0.61
	180–208	4	1.5	0.04	0.32	0.87	182–186	2	1.1	0.10	0.10	−0.05
BRIN53	165–177	4	2.1	0.12	0.51	0.77	171–177	3	1.7	0.00	0.41	1.00
BRIN54	168–176	3	1.9	0.07	0.46	0.85	158–180	3	1.4	0.18	0.31	0.41
BRIN56	104	1	1.0	—	—	—	114–116	2	1.1	0.00	0.10	1.00
BRIN57	223–233	4	3.0	0.25	0.67	0.63	219–248	9	4.2	0.36	0.76	0.52
BRIN61	183–191	3	1.3	0.13	0.23	0.44	181–193	5	2.9	1.00	0.65	−0.53
BRIN66	157–181	8	2.7	0.07	0.63	0.89	157–177	7	2.0	0.32	0.51	0.38
LOVI04	248	1	1.0	—	—	—	248	1	1.0	—	—	—
	268	1	1.0	—	—	—	—	0	—	—	—	—
LOVI23	401–411	4	1.8	0.50	0.45	−0.11	397	1	1.0	—	—	—
	417–437	4	3.7	0.25	0.73	0.66	415–417	2	1.2	0.05	0.15	0.64
LOVI33	372–378	2	1.5	0.14	0.34	0.58	368–382	3	1.9	0.07	0.47	0.85
LOVI34	155	1	1.0	—	—	—	151–165	2	1.5	0.39	0.31	−0.24
LOVI35	230–236	2	1.2	0.14	0.13	−0.08	236–242	4	2.5	0.07	0.59	0.88
	256	1	1.0	—	—	—	256	1	1.0	—	—	—
LOVI37	470–478	3	1.8	0.21	0.44	0.53	476–484	3	2.3	0.23	0.56	0.59
LOVI48	400–420	2	1.1	0.00	0.08	1.00	376–404	3	2.1	0.00	0.51	1.00
LOVI52	—	0		—	—	—	157–173	5	3.8	0.57	0.73	0.22
	—	0		—	—	—	194–204	2	1.1	0.00	0.12	1.00
LOVI56	536–558	5	1.7	0.00	0.42	1.00	520–546	6	4.9	0.20	0.80	0.75
	618–640	4	1.4	0.00	0.27	1.00	618–620	2	1.2	0.00	0.15	1.00
LOVI73	468–478	2	1.2	0.00	0.17	1.00	468–478	c2	1.6	0.05	0.36	0.85
LOVI90	200–206	3	1.5	0.04	0.35	0.88	200	1	1.0	—	—	—
LOVI93	287	1	1.0	—	—	—	287	1	1.0	—	—	—
	391–397	3	2.2	0.26	0.54	0.52	393	1	1.0	—	—	—

— = no data available; A = number of alleles; A e = number of effective alleles; F = inbreeding coefficient; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals tested.

CONCLUSIONS

Eighteen microsatellite loci developed in B. insignis and 12 derived from L. villosa (Tran et al., 2015) were polymorphic and amplified reliably in at least one species. These loci reveal low levels of diversity and high inbreeding in both species, although less so in B. rockii. Nonetheless, in combination, these 30 loci can provide insights into the relatedness of individuals in the captive population. In addition, these loci also cross‐amplified in taxa that span the Hawai‘ian lobelioid group, revealing polymorphism in most species, despite low sample sizes. These loci will be useful for assessing patterns of gene flow, genetic diversity, and structure within and among populations of all species in the lobelioid complex.

Species	Institution	Sample size	Accession no.
Brighamia insignis		30
	Bishop Museum	2	842, 1475
	Heidelberg University Botanical Garden	1	107707
	National Tropical Botanical Garden	22	020036, 050681, 050682, 060024, 090445 (×2), 100231, 100651, 100652, 1000714, 120043, 920440, 950232, 990833, 990836, 990836, 990839, 990840, 990942, 990945, 20150354 (+1 no record)
	National Tropical Botanical Garden Herbarium	2	538, 10438
	Sukkulenten‐Sammlung Zürich	1	991001
	University of California Botanical Garden at Berkeley	2	NA
Brighamia rockii		24
	Bishop Museum	1	444245
	Ganna Walska Lotusland	1	2005‐192
	Maui Nui Botanical Garden	2	Bri Roc‐Mo‐EHU‐A
	Puu O Hoku Ranch	7	F2 from Huelo islet stock
	National Tropical Botanical Garden	5	110072, 1102283, 950402 (×2), 950422
	National Tropical Botanical Garden Herbarium	8	8031, 8033, 8034, 14025, 14027, 14794, 14025b, 14027b

NA = not available.