Overexpression of miR-222-3p Promotes the Proliferation and Inhibits the Apoptosis of Diffuse Large B-Cell Lymphoma Cells via Suppressing PPP2R2A.

PURPOSE: This study aimed to investigate the effects of microRNA-222-3p on activated B cell-like-type diffuse large B-cell lymphoma cells and the regulatory relationship between microRNA-222-3p and phosphatase 2 regulatory subunit B alpha.
METHOD: The expression of microRNA-222-3p was detected in activated B cell-like-type diffuse large B-cell lymphoma tissues and cells by quantitative reverse transcription polymerase chain reaction. The regulatory effects of microRNA-222-3p on the proliferation, invasion, and apoptosis of activated B cell-like-type diffuse large B-cell lymphoma cells were analyzed by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT), colony formation, flow cytometry, and Transwell assay. The regulatory relationship between microRNA-222-3p and phosphatase 2 regulatory subunit B alpha was determined by luciferase reporter gene and RNA pull-down assay. In addition, the effects of microRNA-222-3p on tumor growth were further analyzed in mice.
RESULTS: MicroRNA-222-3p and phosphatase 2 regulatory subunit B alpha were significantly up- and downregulated in activated B cell-like-type diffuse large B-cell lymphoma tissues and cells, respectively. Phosphatase 2 regulatory subunit B alpha was a target of microRNA-222-3p. MicroRNA-222-3p promoted the proliferation and invasion and inhibited the apoptosis of activated B cell-like-type diffuse large B-cell lymphoma cells. Phosphatase 2 regulatory subunit B alpha reversed the tumor-promoting effects of microRNA-222-3p on activated B cell-like-type diffuse large B-cell lymphoma cells. In addition, microRNA-222-3p promoted the tumor growth in mice and downregulated phosphatase 2 regulatory subunit B alpha in tumor tissues.
CONCLUSION: MicroRNA-222-3p promoted the proliferation and invasion and inhibited the apoptosis of activated B cell-like-type diffuse large B-cell lymphoma cells through suppressing phosphatase 2 regulatory subunit B alpha expression.

Introduction

Diffuse large B-cell lymphoma (DLBCL) is a highly invasive non-Hodgkin lymphoma, accounting for 30% to 40% of non-Hodgkin lymphoma cases.[1] The initial response rate of DLBCL is about 90%, but the 5-year recurrence rate is as high as 40%.[2] Drug resistance during treatment also greatly plagues clinicians and patients. About 30% of patients with DLBCL die of relapse or drug resistance.[3] The pathogenesis of DLBCL remains unclear, which hinders further progress in the treatment of DLBCL.

In recent years, some molecular pathogenesis of DLBCL has been preliminarily discovered.[4] In addition to coding genes, some noncoding genes, especially microRNAs (miRs), are considered to be one of the most important targets for regulating DLBCL development.[5] MicroRNAs are key regulators of tumorigenesis and development during the last decade.[6] The important role of these miRs in the progression of DLBCL has also been mentioned in previous studies.[7,8] As a member of miRs, miR-222 has been proved to be involved in the progression of multiple cancers, such as breast cancer, nasopharyngeal carcinoma, and colorectal cancer.[9-11] A previous study indicated that intestinal inflammation can be aggravated by upregulation of miR-222 during the disease progression.[12] Importantly, miR-222 is closely related to the development of DLBCL.[13] Based on the expression profile of miRs, it indicated that miR-222 is a potential biomarker for Epstein-Barr virus-positive DLBCL.[14] In fact, the biological function of miR-222 in disease is usually achieved by targeting certain genes.[15] Protein phosphatase 2 regulatory subunit B alpha (PPP2R2A) belongs to protein phosphatase 2 regulatory subunit B family and participates in the negative control of cell growth and division.[16] Dong et al showed that miR-222 is overexpressed in biliary atresia, and silencing of miR-222 inhibits the proliferation of LX-2 cells (human hepatic stellate cell line) by targeting PPP2R2A.[17] Zeng et al showed that overexpression of miR-222 attenuates cisplatin-induced autophagy in bladder cancer cells by targeting PPP2R2A.[15] In addition, PPP2R2A has been proved to be a tumor suppressor that can inhibit the proliferation of a variety of cancer cells, such as non-small cell lung cancer cells,[18] prostate cancer cells,[19] and colorectal cancer cells.[20] However, the specific role of miR-222 on DLBCL and the relationship between miR-222 and PPP2P2A remain unclear.

Activated B-cell-like (ABC-type) DLBCL, characterized by high-level constitutive nuclear factor kappa-B activation, is an important subtype of DLBCL with poor prognosis and treatment response.[21] In this study, the regulatory effects of miR-222-3p on the proliferation, migration, invasion, and apoptosis of ABC-type DLBCL cells were analyzed. The regulatory relationship between miR-222-3p and PPP2R2A in ABC-type DLBCL cells was further determined. Our findings may provide a novel therapeutic target for ABC-type DLBCL and a new insight into the underlying mechanisms.

Materials and Methods

Patients and Sample Collection

A total of 74 cases with initial diagnosis of ABC-type DLBCL were screened from our hospital from February 2016 to November 2018. Activated B-cell-like-type DLBCL was diagnosed histopathologically according to Hans-type principles.[22] These patients had not received chemotherapy, radiation, or other biological treatments previously. Other types of lymphoma and DLBCL combined with other diseases were excluded. A total of 26 patients with pathological diagnosis of reactive lymphoid hyperplasia were selected as the control. The specimens were excised during surgery and then preserved in liquid nitrogen at 80°C until RNA was extracted. Overall survival (OS) was defined from registration to death. This study was approved by the ethics committee of our hospital. All patients signed a written informed consent.

Cell Culture

Human normal B-cell immortalized cell line (HMy2.CIR), DLBCL cell line, germinal central B-cell (GCB)-like OCI-Ly19 and SU-DHL-4, and ABC-like OCI-LY10 and U2932 were purchased from Shanghai Cell Bank of the Chinese Academy of Sciences. HMy2.CIR was cultured in Iscove’s modified dulbecco’s medium (IMDM) (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS), and 1% penicillin–streptomycin (P/S). U2932 and SU-DHL-4 were cultured in RPMI 1640 medium (Gibco) containing 10% FBS and 1% P/S. OCI-LY10 and OCI-Ly19 were cultured in IMDM (Gibco) containing 20% FBS and 1% P/S. All cells were maintained in a humid incubator with 5% CO2 at 37°C.

Cell Transfection and Grouping

OCI-LY10 and U2932 cells were seeded into 6-well plates (5 × 105 cells/well). The miR-222-3p mimics, miR-222-3p inhibitors, miR-222-3p mimics negative control (mimics NC), miR-222-3p inhibitors negative control (inhibitors NC), pcDNA3.1 negative control (pcDNA3.1-NC), pcDNA3.1-PPP2R2A (Jima, Shanghai, China) (15 μL for each) were dissolved in 250 mL medium and mixed uniformly to obtain A solution, respectively. Meanwhile, 5 mL EntransterTM-R transfection reagent (Engreen Biosystem) was mixed with 250 mL culture medium uniformly to obtain B liquid. The solution A and B were then mixed uniformly and incubated in an incubator for 48 hours (37°C, 5% CO2). Cells were divided into miR-222-3p mimics group, mimics NC group, miR-222-3p inhibitors group and inhibitors NC group, mimics NC + pcDNA3.1-NC group, miR-222-3p mimics + pcDNA3.1-NC group, mimics NC + pcDNA3.1-PPP2R2A group, and miR-222-3p mimics + pcDNA3.1-PPP2R2A group. Cells without transfection were considered as blank group.

Quantitative Reverse Transcription Polymerase Chain Reaction

The expression of miR-222-3p was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Simply total RNA was extracted form cells using TRIzol and then reverse transcribed using Reverse Transcription Kit (Invitrogen, San Diego, California) in accordance with the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction was performed on ABI PRISMR 7300 (Applied Biosystems, Foster City, California). The PCR program included 40 cycles of 95°C for 3 minutes, 95°C for 10 seconds, and 55°C for 30 seconds. The data were analyzed by the 2−ΔΔ method.[23] All primers were designed and synthesized by Biotechnology Bioengineering Co, Ltd (Shanghai, China), and the primer sequences are listed in Table 1.

Table 1.

The Primer Sequences.

Name of Primer	Sequences
miR-222-3p-F	ACACTCCAGCTGGGAGCTACATCTGG CTACTG
miR-222-3p-R	CTCAACTGGTGTCGTGGA
U6-F	CTCGCTTCGGCAGCACA
U6-R	AACGCTTCACGAATTTGCGT
PPP2R2A-F	AAAGGAACTATTCGGCTATGTG
PPP2R2A-R	AAAATGACCTGTTACTGGGATC
GAPDH-F	GCACAGTCAAGGCTGAGAATG
GAPDH-R	ATGGTGGTGAAGACGCCAGTA

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miR, micro RNA; PPP2R2A, protein phosphatase 2 regulatory subunit B alpha.

Luciferase Reporter Gene Assay

The target site of miR-222-3p to PPP2R2A was predicted by TargetScan (http://www.targetscan.org/). The sequence fragments of PPP2R2A wild-type (PPP2R2A-WT) and mutant (PPP2R2A-MUT) were synthesized and cloned into pGL3 luciferase vector (Promega, Madison, WI, USA). EHK-293T cells (American type culture collection) were seeded into 24-well plates (5 × 105 cells/well) and cotransformed with PPP2R2A-WT (or PPP2R2A-MUT) and miR-222-3p mimic (or mimic NC) using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA). After 48 hours of transfection, the luciferase assay was determined by using dual luciferase reporter gene assay kit (Promega).

RNA Pull-Down Assay

MiR-222-3p-Wt, miR-222-3p-Mut, and miR-NC were transcribed using TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific). Biotin RNA labeling cocktail (Roche Diagnostics, Indianapolis, Indiana) was used to synthesize Bio-miR-222-3p-Wt, Bio-miR-222-3p-Mut, and Bio-miR-NC. Then 50 pmol biotinylated RNA was mixed with 200 μg cell lysate (OCI-LY10 and U2932) and incubated with 50 μL streptavidin agarose (Invitrogen, Carlsbad, California) for 1 hour at 4°C. The expression of PPP2R2A was measured by qRT-qPCR.

MTT Assay

The transfected cells were seeded in 96-well plates (6 × 103 cells/well) and cultured in an incubator (37°C, 5% CO2) for 24 to 72 hours. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) (5 mg/mL) was then added into each well at a volume of 20 μL. After 4 hours of incubation, 150 μL dimethyl sulfoxide was added into each well to promote crystallization dissolution. The absorbance values at 0, 24, 48, and 72 hours were measured, and MTT plot was drawn (y-axis: absorbance value; x-axis: interval time). The experiment was repeated 3 times.

Colony Formation Assay

The transfected cells were washed with phosphate-buffered saline (PBS), digested with 1% trypsin, and seeded in 6-well plates (300 cells/well). Two weeks later, cells were washed with PBS twice, fixed with 4% paraformaldehyde, and then stained with Swiss-Giemsa for 15 minutes. Positive stained colonies were observed under an inverted phase contrast microscope (Olympus Ckx53, Tokyo, Japan) and counted automatically by using ImageJ (version 1.48) software. Cell colony formation rate was calculated as (colony number/total number of seeded cells) × 100%.

Flow Cytometry

The apoptosis of transfected cells was measured by Annexin V/Fluorescein isothiocyanate (FITC) apoptosis detection kit (Kaiji Biotechnology, Nanjing, China). A mixture of 5 μL PI and 5 μL Annexin V/FITC was added to cells and incubated for 15 minutes. The apoptotic rate was detected on flow cytometry.

Transwell Assay

The invasion of transfected cells was measured by Transwell chamber (Corning, New York). Simply cells were adjusted to 2 × 105/mL in serum-free RPMI-1640 medium, and 200 μL cells were added to the upper chamber; 400 μL RPMI-1640 medium containing 20% FBS was added to the lower chamber (24-well plate). After 48 hours of culturing (37°C, 5% CO2), the medium was removed. The left cells were washed twice with PBS, fixed with 4% paraformaldehyde for 30 minutes, and stained with crystal violet for 20 minutes. Positive stained cells were observed under microscope (×200), and the number of cells passing through the membrane was counted in 5 random fields.

Western Blot Analysis

Western blot was used to measure the expression of proteins. Simply 50 μg total protein was extracted by lysis buffer and quantified with a bicinchoninic acid assay kit (Kaiji Biotech, Nanjing, China). The samples were subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membrane. The membrane was then blocked with 5% skim milk in Tris-buffered saline with Tween solution. Subsequently, the membrane was sequentially incubated with primary antibodies (Rabbit anti-human Bcl-2, Bax, PPP2R2A, 1:2000; Abcam, Cambridge, United Kingdom) and secondary antibody (bs-0295G-HRP, 1:5000; Beijing Biosynthesis Biotechnology, Beijing, China). Finally, the bands were visualized by Enhanced Chemiluminescence Plus, and the integrated optical density was measured by software Lab Works version 4.5.

Tumor Growth Assay

A total of 18 SPF BALB/c nude mice (4 weeks old) were purchased from SLACL Laboratory Animal Center (Shanghai, China). Then 0.1 mL OCI-LY10 cells (1.0 × 107/mL; blank, miR-222-3p mimics, mimics NC) were subcutaneously injected into the flank of mice (6 mice in each group). The tumor volume was measured every 7 days after the injection according to the formula of (L × W2)/2 (where L represented the length and W represented the width). After the injection for 56 days, mice were anesthetized with CO2 and killed. Tumor tissues were collected for further analysis. All animal experiments were approved by Institutional Animal Care and Use Committee.

Statistical Analysis

All statistical analyses were performed using SPSS version 21.0 software. The results were presented as mean ± standard deviation. The data of 2 groups were analyzed by the Student t test. The data of more than 2 groups were analyzed by one-way analysis of variance, followed by Tukey post hoc test. Kaplan-Meier survival analysis was performed to assess the correlation between miR-222-3p and survival of patients. Pearson correlation test was used to assess the correlation between PPP2R2A and miR-222-3p expression. P <.05 was considered to be statistically significant.

Results

The Expression of MiR-222-3p and PPP2R2A in DLBCL

The expression of miR-222-3p in ABC-type patients with DLBCL was detected by qRT-PCR. The result showed that miR-222-3p expression in patients with DLBCL was higher than that in the control group (Figure 1A). Kaplan-Meier analysis showed that the OS was significantly higher in patients with low miR-222-3p expression than in patients with high miR-222-3p expression (Figure 1B). The expression of miR-222-3p in DLBCL cell lines (OCI-LY19, SU-DHL-4, OCI-LY10, and U2932) was higher than that in HMy2.CIR (Figure 1C). Since the miR-222-3p expression in ABC-type DLBCL was higher than that of GCB type, ABC-type DLBCL cell lines OCI-LY10 and U2932 were selected for further investigation. Furthermore, the relationship between the expression of miR-222-3p and the clinicopathological parameters of ABC-type DLBCL was listed in Table 2. The result showed that compared with patients of III/IV stage, extranodal invasion, and International Prognostic Index (IPI) score of 3 to 5, the expression of miR-222-3p was significantly lower in patients of I/II stage, no extranodal invasion, and IPI score of 0 to 2, respectively (all P < .05).

Figure 1.

The expression of miR-222-3p in diffuse large B-cell lymphoma (DLBCL). A, The expression of miR-222-3p in activated B cell-like (ABC)-type DLBCL patients and controls detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR); P < .001. B, Kaplan-Meier detection for the overall survival rate of patients with low expression and high expression of miR-222-3p; P = .0026. C, The expression of miR-222-3p in DLBCL cell lines (OCI-LY19, SU-DHL-4, OCI-LY10, and U2932) and human normal B cell immortalized cell line (HMy2.CIR) detected by qRT-PCR. Compared with HMy2.CIR, *P < .05; compared with OCI-LY19, # P < .05; compared with SU-DHL-4, and P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

Table 2.

The Relationship Between MiR-222-3p Expression and the Clinicopathological Parameters of ABC-Type Patients With DLBCL.

Parameter	Cases	MiR-222-3p Expression Value	P Value
Sex
Male	35	1.618 ± 0.476	.5950
Female	39	1.680 ± 0.527
Age			.3693
>60	42	1.605 ± 0.502
≤60	32	1.711 ± 0.502
Stage			.0001a
I/II	30	1.307 ± 0.463
III/IV	44	1.885 ± 0.379
Extranodal invasion			.0028a
Yes	45	1.787 ± 0.503
No	29	1.438 ± 0.425
IPI score			.0001a
0-2	40	1.451 ± 0.415
3-5	34	1.884 ± 0.497

Abbreviations: ABC, activated B cell-like; DLBCL, diffuse large B-cell lymphoma; IPI, International Prognostic Index; MiR-222-3p, microRNA-222-3p.

a P < .05.

MiR-222-3p Promoted the Proliferation and Invasion of ABC-Type DLBCL Cells

The expression of miR-222-3p in OCI-LY10 and U2932 cells was significantly higher in miR-222-3p mimics group than in mimics NC group (all P < .05; Figure 2A). Meanwhile, the expression of miR-222-3p in OCI-LY10 and U2932 cells was significantly lower in miR-222-3p inhibitors group than in inhibitors NC group (all P < .05; Figure 2B).

Figure 2.

Micro RNA-222-3p promotes the proliferation and invasion of activated B cell-like (ABC)-type diffuse large B-cell lymphoma (DLBCL) cells. A, The expression of miR-222-3p in miR-222-3p mimics or negative control (NC)-transfected OCI-LY10 and U2932 cells detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). B, The expression of miR-222-3p in miR-222-3p inhibitors or NC-transfected OCI-LY10 and U2932 cells detected by qRT-PCR. C, The proliferation of transfected OCI-LY10 and U2932 cells detected by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay. D, The proliferation of transfected OCI-LY10 and U2932 cells detected by colony formation assay. E, The invasion of transfected OCI-LY10 and U2932 cells detected by transwell invasion assay. Compared with blank and mimics NC, *P < .05; compared with Blank and inhibitors NC, # P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

MTT assay showed that compared with mimics NC group, the OD490 of OCI-LY10 and U2932 cells was increased in miR-222-3p mimics group (all P < .05) and was decreased in miR-222-3p inhibitors group (all P < .05; Figure 2C).

Colony formation assay showed that the number of cell colonies in miR-222-3p mimics group was significantly higher than that in mimics NC group (all P < .05). Meanwhile, the number of cell colonies in miR-222-3p inhibitor group was significantly lower than that in inhibitor NC group (all P < .05; Figure 2D).

Transwell assay showed that the number of invasive cells in miR-222-3p mimics group was more than that in the mimics NC group. Meanwhile, the number of invasive cells in miR-222-3p inhibitors group was less than that in the inhibitors NC group (all P < .05; Figure 2E).

MiR-222-3p Inhibited the Apoptosis of ABC-Type DLBCL Cells

Flow cytometry showed that the apoptotic rate was lower in the miR-222-3p mimics group than in the mimics-NC group (all P < .05) and was significantly higher in the miR-222-3p inhibitors group than in the inhibitors-NC group (all P < .05; Figure 3A).

Figure 3.

Micro RNA-222-3p inhibits the apoptosis of activated B cell-like (ABC)-type diffuse large B-cell lymphoma (DLBCL) cells. A, The apoptosis of transfected OCI-LY10 and U2932 cells detected by flow cytometry. B, The expression of Bcl-2 and Bax in transfected OCI-LY10 and U2932 cells detected by Western blot. Compared with blank or mimics negative control (NC), *P < .05; compared with blank or inhibitors NC, # P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

Western blot was used to detect the expression of Bcl-2 and Bax in transfected OCI-LY10 and U2932 cells. The results showed that Bcl-2 and Bax were significantly upregulated and downregulated in mi-222-3p mimics group compared with that in the mimics NC group, respectively (all P < .05). Meanwhile, Bcl-2 and Bax were significantly downregulated and upregulated in the mi-222-3p inhibitors group compared with that in the inhibitors NC group, respectively (all P < .05; Figure 3B).

Protein Phosphatase 2 Regulatory Subunit B Alpha Was a Target Gene of MiR-222-3p

TargetScan showed that miR-222-3p had a binding site at 3′-untranslated region (3′-UTR) of PPP2R2A (Figure 4A). The luciferase activity was significantly lower in the miR-222-3p mimics + PPP2R2A WT group than other groups (P < .05; Figure 4B). RNA pull-down assay further illustrated that miR-222-3p bind to PPP2R2A (Figure 4C). The transfection of miR-222-3p mimic and pcDNA3.1-PPP2R2A decreased and the expression of PPP2R2A increased in OCI-LY10 and U2932 cell at both the mRNA and protein levels, respectively. The cotransfection of miR-222-3p mimics and pcDNA3.1-PPP2R2A reversed the downregulation effect of miR-222-3p mimics on PPP2R2A expression (Figure 4D and E). In addition, the expression of PPP2R2A in ABC-type patients with DLBCL was lower than that in the control group (Figure 4F). There was a negative correlation between miR-222-3p and PPP2R2A expression in ABC-type patients with DLBCL (r = −0.6862; P < .0001; Figure 4G). The expression of PPP2R2A in DLBCL cell lines (OCI-LY19, SU-DHL-4, OCI-LY10, and U2932) was lower than that in HMy2.CIR (Figure 4H).

Figure 4.

Protein phosphatase 2 regulatory subunit B alpha (PPP2R2A) is a target gene of miR-222-3p. A, The binding site of miR-222-3p at 3′-untranslated region (3′-UTR) PPP2R2A predicted by TargetScan. B, The binding ability between PPP2R2A and miR-222-3p confirmed by dual-luciferase reporter gene assay; compared with the cotransfection of miR-222-3p mimics and PPP2R2A-MUT, *P < .05. C, The binding ability between PPP2R2A and miR-222-3p confirmed by RNA pull-down assay; compared with Bio-NC group, *P < .05. D, The expression of PPP2R2A in miR-222-3p mimics or pcDNA3.1-PPP2R2A-transfected OCI-LY10 and U2932 cells detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). E, The expression of PPP2R2A detected by Western blot; compared with blank or mimics negative control (NC) + pcDNA3.1-NC group, * P < .05. F, The expression of PPP2R2A in activated B cell-like (ABC)-type diffuse large B-cell lymphoma (DLBCL) patients and controls detected by qRT-PCR; compared with the control group, P < .0001. G, Correlation analysis of miR-222-3p and PPP2R2A expression in ABC-type DLBCL patients. H, The expression of PPP2R2A in DLBCL cell lines (OCI-LY19, SU-DHL-4, OCI-LY10, and U2932) and human normal B-cell immortalized cell line (HMy2.CIR) detected by qRT-PCR; compared with HMy2.CIR, *P <.05; compared with OCI-LY19, # P < .05; compared with SU-DHL-4, and P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

Overexpression of PPP2R2A Reversed the Effects of MiR-222-3p on the Proliferation and Apoptosis of ABC-Type DLBCL Cells

Compared with the mimics NC + pcDNA3.1-NC group, the OD490 was significantly increased in the miR-222-3p mimics + pcDNA3.1-NC group and decreased in the mimics NC + pcDNA3.1-PPP2R2A group (P < .05; Figure 5A). Compared with the mimics NC + pcDNA3.1-NC group, the apoptotic rate was significantly decreased in the mimics NC + pcDNA3.1-NC group and increased in the mimics NC + pcDNA3.1-PPP2R2A group (Figure 5B). In addition, compared with the mimics NC + pcDNA3.1-NC group, Bcl-2 and Bax were significantly up- and downregulated in the miR-222-3p mimics + pcDNA3.1-NC group, respectively. Compared with the mimics NC + pcDNA3.1-NC group, Bcl-2 and Bax were significantly down- and upregulated in mimics NC + pcDNA3.1-PPP2R2A group, respectively (Figure 5C).

Figure 5.

Overexpression of protein phosphatase 2 regulatory subunit B alpha (PPP2R2A) reversed the effect of miR-222-3p on the proliferation and apoptosis of activated B cell-like (ABC)-type diffuse large B-cell lymphoma (DLBCL) cells. A, The proliferation of miR-222-3p mimics or pcDNA3.1-PPP2R2A-transfected OCI-LY10 and U2932 cells detected by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay. B, The apoptosis of transfected OCI-LY10 and U2932 cells detected by flow cytometry. C, The expression of B-cell lymphoma-2 (Bcl-2) and Bcl-2 associated X (Bax) in transfected OCI-LY10 and U2932 cells detected by Western blot. Compared with the blank or mimics negative control (NC) + pcDNA3.1-NC group, *P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

Mi-222-3p Mimics Promoted the Tumor Growth in Nude Mice

The tumor volume was larger in the miR-222-3p mimics group than in the mimics NC group at day 21, 35, 49, and 56 postinjection (Figure 6A). In addition, qRT-PCR showed that the expression of PPP2R2A in tumor tissues was lower in the miR-222-3p mimics group than in the mimics NC group at both the mRNA and protein levels (P < .05; Figure 6B and C).

Figure 6.

Micro RNA-222-3p promotes tumor growth in nude mice. A, Tumor images on the last day of the experiment (day 56). B, Xenograft tumor growth in miR-222-3p mimics-injected nude mice (tumor size is monitored every 7 days). C, Protein phosphatase 2 regulatory subunit B alpha (PPP2R2A) expression in tumor tissues detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). D, Protein phosphatase 2 regulatory subunit B alpha (PPP2R2A) expression in tumor tissues detected by Western blot. Compared with the Blank or mimics negative control (NC) group, *P < .05. Data were expressed as mean ± standard deviation. All experiments were repeated 3 times.

Discussion

Diffuse large B-cell lymphoma is a common malignant tumor with strong invasive ability.[24] Although miR-222 has been proved to be related to the development of DLBCL,[12] the specific action mechanism of miR-222 in DLBCL progression remains unclear. In this study, miR-222-3p and PPP2R2A were significantly upregulated and downregulated in ABC-type DLBCL tissues and cells compared with the control group, respectively. In addition, luciferase reporter gene and RNA pull-down assay showed that miR-222-3p had a binding site at 3′-UTR of PPP2R2A. Furthermore, MTT, colony formation, flow cytometry, and Transwell assay showed that miR-222-3p promoted the proliferation and invasion and inhibited the apoptosis of ABC-type DLBCL cells. Finally, the mice experiment showed that miR-222-3p mimics promoted the tumor growth in mice and inhibited PPP2R2A expression in tumor tissues.

MiR-222 is upregulated in various diseases and considered as a therapeutic target.[25,26] A previous study showed that miR-222 is upregulated in patients with rheumatoid arthritis.[27] Noormohammad et al indicated that miR-222 is overexpressed in both patients with Helicobacter pylori-infected and noninfected gastric cancer.[28] A miRs signature profile proved that miR-222 is upregulated in DLBCL.[29] Garofalo et al indicated that the downregulation of miR-222 contributes to the enhanced tumorigenicity.[30] Gan et al showed that the downregulation of miR-222 enhances the sensitivity of breast cancer cells to tamoxifen.[31] In fact, miR-222 overexpression can promote the proliferation of tumor cells via targeting specific genes,[32] like PPP2R2A.[17] Protein phosphatase 2 regulatory subunit B alpha has been proved to be a tumor suppressor in a variety of cancers.[18-20] Beca et al showed that low expression of PPP2R2A is significantly associated with poor disease-free survival and OS in patients with breast cancer.[33] Zhao et al showed that early hemizygous loss of PPP2R2A facilitates effective mitotic progression of prostate cancer cells.[19] In addition, Liang et al indicated that overexpression of miR-892a promotes the proliferation and colony formation of colorectal cancer cells through suppressing PPP2R2A.[20] Zhang et al indicated that the upregulation of miR-614 promotes the proliferation and inhibits the apoptosis of ovarian cancer cells by suppressing PPP2R2A.[34] The above findings illustrate the tumor-suppressing role of PPP2R2A on tumor progression. In the current study, miR-222-3p and PPP2R2A were significantly up- and downregulated in ABC-type DLBCL tissues and cells, respectively. Meanwhile, luciferase reporter gene and RNA pull-down assay showed that 3′-UTR PPP2R2A carried the binding site of miR-222-3p. Therefore, we speculate that the upregulation of miR-222-3p may be involved in the progression of ABC-type DLBCL by suppressing PPP2R2A expression.

The expression of miRs is widely believed to be pathogenetically involved in DLBCL.[35,36] MiR-222 is an important miR, which can affect multiple tumor cell processes, including proliferation, differentiation, apoptosis, invasion, and metastasis.[37] A previous study showed that the downregulation of miR-222 inhibits the proliferation and migration of prostate cancer cells.[38] Liu et al indicated that miR-222 promotes the proliferation, migration, and invasion and inhibits the apoptosis of liver cancer cells.[37] The inhibition of miR-222-3p results in a decrease in the activity of cell proliferation and invasion.[39] In addition, miR-222 induces the apoptosis of gastrointestinal stromal tumor cells,[40] prostate cancer cells, and neck squamous cell carcinoma cells.[41,42] In this study, the proliferation and invasion of ABC-type DLBCL cells were promoted and the apoptosis was inhibited in the miR-222-3p mimics group compared with the mimics NC group. We speculate that miR-222-3p can promote the proliferation and invasion and inhibit the apoptosis of ABC-type DLBCL cells. However, the current research also has some limitations, such as the regulatory role of miR-222-3p and PPP2R2A on GCB-type DLBCL cells and the specific action mechanism of PPP2R2A.

Conclusion

In conclusion, the upregulation of miR-222-3p played an important role in the progression of ABC-type DLBCL. MiR-222-3p promoted the proliferation and invasion and inhibited the apoptosis of ABC-type DLBCL cells by suppressing PPP2R2A expression.