Katja B Kostelnik1, Amy Barker1, Christopher Schultz1, Tom P Mitchell1, Vinothini Rajeeve2, Ian J White3, Michel Aurrand-Lions4, Sussan Nourshargh1, Pedro Cutillas2, Thomas D Nightingale1. 1. Centre for Microvascular Research, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, United Kingdom. 2. Cell Signalling & Proteomics Group, Barts Cancer Institute, Queen Mary University of London, London, United Kingdom. 3. MRC Laboratory of Molecular Cell Biology, University College London, London, United Kingdom. 4. Aix Marseille University, CNRS, INSERM, Institut Paoli-Calmettes, CRCM, Marseille, France.
Abstract
Junctional complexes between endothelial cells form a dynamic barrier that hinders passive diffusion of blood constituents into interstitial tissues. Remodelling of junctions is an essential process during leukocyte trafficking, vascular permeability, and angiogenesis. However, for many junctional proteins, the mechanisms of junctional remodelling have yet to be determined. Here, we used receptor mutagenesis, horseradish peroxidase (HRP), and ascorbate peroxidase 2 (APEX-2) proximity labelling, alongside light and electron microscopy (EM), to map the intracellular trafficking routes of junctional adhesion molecule-C (JAM-C). We found that JAM-C cotraffics with receptors associated with changes in permeability such as vascular endothelial cadherin (VE-Cadherin) and neuropilin (NRP)-1 and 2, but not with junctional proteins associated with the transmigration of leukocytes. Dynamic JAM-C trafficking and degradation are necessary for junctional remodelling during cell migration and angiogenesis. By identifying new potential trafficking machinery, we show that a key point of regulation is the ubiquitylation of JAM-C by the E3 ligase Casitas B-lineage lymphoma (CBL), which controls the rate of trafficking versus lysosomal degradation.
Junctional complexes between endothelial cells form a dynamic barrier that hinders passive diffusion of blood constituents into interstitial tissues. Remodelling of junctions is an essential process during leukocyte trafficking, vascular permeability, and angiogenesis. However, for many junctional proteins, the mechanisms of junctional remodelling have yet to be determined. Here, we used receptor mutagenesis, horseradish peroxidase (HRP), and ascorbate peroxidase 2 (APEX-2) proximity labelling, alongside light and electron microscopy (EM), to map the intracellular trafficking routes of junctional adhesion molecule-C (JAM-C). We found that JAM-C cotraffics with receptors associated with changes in permeability such as vascular endothelial cadherin (VE-Cadherin) and neuropilin (NRP)-1 and 2, but not with junctional proteins associated with the transmigration of leukocytes. Dynamic JAM-C trafficking and degradation are necessary for junctional remodelling during cell migration and angiogenesis. By identifying new potential trafficking machinery, we show that a key point of regulation is the ubiquitylation of JAM-C by the E3 ligase Casitas B-lineage lymphoma (CBL), which controls the rate of trafficking versus lysosomal degradation.
Endothelial cells exist as a monolayer that lines the blood vasculature, and as such, they present a discrete barrier to the cellular and molecular components of blood. This includes ions, small and large proteins, platelets, and leukocytes [1]. The endothelium also plays a crucial role in responding to a pathogenic infection or tissue injury, both in the initial recruitment of leukocytes to the appropriate site [2] and in subsequent tissue repair and angiogenesis [3]. Endothelial dysfunction can predispose the vessel wall to leukocyte adhesion, platelet activation, oxidative stress, thrombosis, coagulation, and chronic inflammation, leading to the pathogenesis of numerous cardiovascular diseases [4].Essential to the establishment of the endothelial monolayer are the protein complexes between adjacent cells that create junctions. Junctions are dynamic and are remodelled to control processes such as cell permeability [1] and cell migration [5], and a subset of junctional proteins also control leukocyte transmigration [2]. This subset includes molecules such as vascular endothelial cadherin (VE-Cadherin), platelet endothelial cell adhesion molecule (PECAM-1) (cluster of differentiation [CD]31), CD99, endothelial cell-selective adhesion molecule (ESAM), intercellular adhesion molecule 1 and 2 (ICAM-1 and -2), and the junctional adhesion molecule (JAM) family of proteins (JAM-A, B, and C) [2,6]. These proteins engage in homophilic and heterophilic interactions with neighbouring cells or with transmigrating leukocytes. Control of these interactions determines the stability of the junctions and/or provides unligated receptor for the movement of transmigrating leukocytes [2,7]. For some receptors that are directly required for leukocyte transmigration (such as JAM-A and PECAM-1), this is a well-characterised process regulated by a combination of phosphorylation, proteolytic cleavage, and intracellular trafficking. However, for other receptors such as JAM-C, almost nothing is known about the molecular control of receptor trafficking and its importance to function.JAM-C is a type 1 integral membrane protein of the immunoglobulin superfamily that mediates numerous endothelial cell functions such as leukocyte transendothelial cell migration [8-12], angiogenesis, and vascular permeability [13-16]. However, there is a marked difference in the function of JAM-C compared to other endothelial junctional receptors. Rather than directly inhibiting leukocyte transmigration, inhibition of JAM-C by genetic means or using blocking antibodies changes the mode of transmigration [8,11,17,18]. In JAM-C–deficient endothelial cells, leukocytes breach the endothelial barrier and then reverse, transmigrating back into the vessel lumen and reducing the overall efficiency of leukocyte traffic. Further, unlike JAM-A, JAM-C surface expression favours changes in permeability following stimulation with thrombin, vascular endothelial growth factor (VEGF), or histamine by inhibiting the activation of the small GTPase ras-related protein 1 (Rap-1) and by activating actomyosin function [15]. Given these functional differences, it is likely for the regulation of JAM-C to be similarly diverse. Together, the broad functional roles of JAM-C in inflammation and vascular biology are illustrated through its involvement in multiple inflammatory disease states such as arthritis [19], peritonitis [9], acute pancreatitis [18,20], ischemia reperfusion injury [10,11], pulmonary inflammation [21,22], and atherosclerosis [23-25].Whilst little is known about the molecular mechanisms of JAM-C trafficking, current evidence indicates an important role for such a phenomenon in regulating JAM-C function. Firstly, in cultured macro- and microvascular endothelial cells, JAM-C can be redistributed in a stimulus-dependent manner [13,15,26]: activation of endothelial cells with thrombin, VEGF, or histamine increases localisation of JAM-C at the cell surface. Secondly, analysis of inflamed murine tissues by electron microscopy (EM) showed labelling of the extracellular domain of JAM-C within vesicles, at the cell surface, and at junctional regions of endothelial cells. Importantly, distribution of JAM-C was altered within these sites following an inflammatory stimulus (ischemia/reperfusion injury), resulting in a change in the levels of vesicular protein versus junctional and cell-surface protein [10,11]. Finally, enhanced levels of JAM-C have been observed in atherosclerosis and rheumatoid arthritis, some of which likely reflect changes in intracellular trafficking [19,24].Collectively, current evidence suggests a causal link between redistribution of intracellular JAM-C and physiological and pathological processes involving opening of endothelial cell junctions. To directly address this hypothesis, we investigated the mechanisms underlying JAM-C redistribution and trafficking using wild-type (WT) and mutant variants of this receptor and a combination of light and EM. Furthermore, to identify cotrafficked cell-surface receptors and trafficking machinery involved in JAM-C internalisation and subcellular localisation, we developed novel, to our knowledge, proximity-labelling mass spectrometry approaches. By perturbing the newly identified pathways of JAM-C redistribution and using mutant variants of this receptor, we show that a key point of regulation is the ubiquitylation of JAM-C by the E3 ligase Casitas B-lineage lymphoma (CBL), which regulates the rate of trafficking and lysosomal degradation.
Results
JAM-C is dynamically trafficked from the cell surface
To characterise the amount and localisation of intracellular JAM-C present at steady state in cultured endothelial cells, we carried out immunofluorescence analysis in human umbilical vein endothelial cells (HUVECs) (Fig 1A–1D). In confluent monolayers, JAM-C is primarily localised to the junctions, although punctae of JAM-C are also present in just over half of the cells (Fig 1D). Incubating cells with the vacuolar-type H+-ATPase inhibitor bafilomycin (100 nM for 4 h) (Fig 1C), a reagent that blocks the acidification step essential for lysosomal degradation, markedly increased the number of JAM-C–positive intracellular punctae. These results indicate that JAM-C is constitutively trafficked into vesicles, and at least a proportion of the receptor in resting conditions is targeted for degradation in lysosomes.
Fig 1
JAM-C is constitutively trafficked from endothelial cell junctions.
(A) Schematic of the endocytosis of endogenous JAM-C from the endothelial cell surface showing the extracellular immunoglobulin domains (blue) and the intracellular PDZ interacting domain (clear circle). (B) Untreated or (C) 100-nM-bafilomycin–treated HUVECs were fixed and costained for JAM-C (green) and VE-Cadherin (red). Boxed regions are shown magnified below in greyscale: (i) JAM-C and (ii) VE-Cadherin. Scale bar, 20 μm. (D) Quantification of the percent of untreated cells with a number of JAM-C–positive vesicles (551 cells from n = 3 experiments, error bars represent SEM). Underlying data are found in S1 Data. (E) Schematic of the endocytosis of JAM-C–HRPout from the endothelial cell surface showing the extracellular immunoglobulin domains (blue), the HRP tag (purple circle) and the intracellular PDZ interacting domain (clear circle). (F–I) HUVECs were transiently transfected with JAM-C–HRPout, fixed, and incubated with DAB and hydrogen peroxide for 30 min. Cells were then secondarily fixed and 70 nm sections prepared and imaged by transmission EM. Precipitated DAB can be clearly seen on (F) endocytic structures and early endosomes. (Fi) shows boxed area magnified, and red arrows highlight endocytic structures and endosomes: (G) junctions, (H and I) MVBs (red arrows). Scale bars, (F) 2 μm, (Fi) 500 nm, (G) 1 μm, (H) 2 μm, and (I) 200 nm. DAB, diaminobenzidine; EM, electron microscopy; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; MVB, multivesicular body; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; VE-Cadherin, vascular endothelial cadherin.
JAM-C is constitutively trafficked from endothelial cell junctions.
(A) Schematic of the endocytosis of endogenous JAM-C from the endothelial cell surface showing the extracellular immunoglobulin domains (blue) and the intracellular PDZ interacting domain (clear circle). (B) Untreated or (C) 100-nM-bafilomycin–treated HUVECs were fixed and costained for JAM-C (green) and VE-Cadherin (red). Boxed regions are shown magnified below in greyscale: (i) JAM-C and (ii) VE-Cadherin. Scale bar, 20 μm. (D) Quantification of the percent of untreated cells with a number of JAM-C–positive vesicles (551 cells from n = 3 experiments, error bars represent SEM). Underlying data are found in S1 Data. (E) Schematic of the endocytosis of JAM-C–HRPout from the endothelial cell surface showing the extracellular immunoglobulin domains (blue), the HRP tag (purple circle) and the intracellular PDZ interacting domain (clear circle). (F–I) HUVECs were transiently transfected with JAM-C–HRPout, fixed, and incubated with DAB and hydrogen peroxide for 30 min. Cells were then secondarily fixed and 70 nm sections prepared and imaged by transmission EM. Precipitated DAB can be clearly seen on (F) endocytic structures and early endosomes. (Fi) shows boxed area magnified, and red arrows highlight endocytic structures and endosomes: (G) junctions, (H and I) MVBs (red arrows). Scale bars, (F) 2 μm, (Fi) 500 nm, (G) 1 μm, (H) 2 μm, and (I) 200 nm. DAB, diaminobenzidine; EM, electron microscopy; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; MVB, multivesicular body; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; VE-Cadherin, vascular endothelial cadherin.We next determined the ultrastructure of intracellular JAM-C pools using EM. We generated a version of JAM-C fused to horseradish peroxidase (HRP) in the membrane-proximal region of the extracellular domain (JAM-C–HRPout). Tagging of JAM-C at this point has previously been shown to have no effect on ligand binding or localisation [27]. We utilised murine JAM-C for expression studies in HUVECs because this allows the depletion of endogenous human JAM-C and rescue with the small interfering RNA (siRNA)-resistant murine orthologue. To determine whether such modification can affect the turnover of JAM-C, we utilised an inhibitor of protein synthesis, cycloheximide. We transfected HUVECs with JAM-C–HRPout or a green fluorescent protein (GFP)-tagged equivalent (JAM-C–GFPout), and 24 h later, we added the inhibitor and monitored JAM-C protein levels by western blot (S1A and S1B Fig). There was no significant difference in turnover of any of the tagged proteins compared to endogenous proteins. Cells expressing JAM-C–HRPout were fixed and labelled with diaminobenzidine (DAB) before analysis by EM. DAB labelling was present in small endocytic clathrin-negative structures budding off from the cell surface (Fig 1F and 1Fi), endosomes (Fig 1F), at the junctions (Fig 1G), and in late endosomes/multivesicular bodies (MVBs) (Fig 1H and 1I).To determine the kinetics of endogenous JAM-C internalisation, we fed anti-JAM-C antibody and monitored the fluorescent intensity at the junctions over a 2-h period (Fig 2A and 2B). This approach showed that approximately two-thirds of surface protein are removed from the junction within 2 h (Fig 2B), indicating that JAM-C is rapidly removed from the junctions at steady state. Antibody cross-linking has been shown to increase the rate of receptor internalisation [28,29], so the kinetics we characterised potentially represent faster-than-average traffic. The assay does, however, confirm that endogenous JAM-C is trafficked from the surface to intracellular pools.
Fig 2
JAM-C is turned over dynamically at the endothelial junction, and the rate of internalisation is increased during junctional disassembly and inflammation.
(A) HUVECs were fed with JAM-C antibody, excess antibody was removed, and the cells were incubated at 37°C before being fixed at 0 and 2 h and imaged by confocal microscopy. Scale bar, 20 μm; boxed regions are shown at higher magnification. (B) The difference in junctional intensity is quantified between 0 and 2 h (n = 4 experiments, error bars represent SEM, **p ≤ 0.01; t test). (C) HUVECs were treated with 4 mM EGTA in calcium-free, low-serum media for 30 min before washing and incubation at 37°C with conventional media. Cells were fixed before and during the time course of washout and recovery and stained for JAM-C (green) and VE-Cadherin (red). Images were acquired by confocal microscopy and the number of JAM-C–positive vesicles at each time point determined. Scale bar, 10 μm (5 fields of view/experiment, n = 3 experiments, error bars represent SD, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test). (D) HUVECs were either left untreated or incubated with 10 ng/ml IL-1 or 50 ng/ml TNF-α for 4 h at 37°C. Cells were then fixed and stained for JAM-C (green) and VE-Cadherin (red). Images were acquired by confocal microscopy and (E) the number of JAM-C–positive vesicles at each time point determined. Scale bar, 10 μm (150 cells from n = 3 experiments, error bars represent SD, **p ≤ 0.01; t test). (F) Schematic of the endocytosis of JAM-C–GFPout from the endothelial cell surface showing the extracellular immunoglobulin domains (blue), the GFP tag (green circle), and the intracellular PDZ interacting domain (clear circle). (G) HUVECs were nucleofected with WT JAM-C–GFPout and imaged with a spinning-disk confocal microscope. Time indicates total time in media, and the boxed region at 0 s is shown magnified at later time points. JAM-C exists in vesicles, at the cell surface, and at the cell junctions. Large vesicles can be seen that tubulate and migrate away from the junctional region. Scale bar: 0 s, 20 μm; inset, 10 μm. Underlying data are found in S2 Data. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; IL-1, interleukin-1; JAM-C, junctional adhesion molecule-C; n.s., not significant; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; TNF, tumour necrosis factor; VE-Cadherin, vascular endothelial cadherin; WT, wild type.
JAM-C is turned over dynamically at the endothelial junction, and the rate of internalisation is increased during junctional disassembly and inflammation.
(A) HUVECs were fed with JAM-C antibody, excess antibody was removed, and the cells were incubated at 37°C before being fixed at 0 and 2 h and imaged by confocal microscopy. Scale bar, 20 μm; boxed regions are shown at higher magnification. (B) The difference in junctional intensity is quantified between 0 and 2 h (n = 4 experiments, error bars represent SEM, **p ≤ 0.01; t test). (C) HUVECs were treated with 4 mM EGTA in calcium-free, low-serum media for 30 min before washing and incubation at 37°C with conventional media. Cells were fixed before and during the time course of washout and recovery and stained for JAM-C (green) and VE-Cadherin (red). Images were acquired by confocal microscopy and the number of JAM-C–positive vesicles at each time point determined. Scale bar, 10 μm (5 fields of view/experiment, n = 3 experiments, error bars represent SD, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test). (D) HUVECs were either left untreated or incubated with 10 ng/ml IL-1 or 50 ng/ml TNF-α for 4 h at 37°C. Cells were then fixed and stained for JAM-C (green) and VE-Cadherin (red). Images were acquired by confocal microscopy and (E) the number of JAM-C–positive vesicles at each time point determined. Scale bar, 10 μm (150 cells from n = 3 experiments, error bars represent SD, **p ≤ 0.01; t test). (F) Schematic of the endocytosis of JAM-C–GFPout from the endothelial cell surface showing the extracellular immunoglobulin domains (blue), the GFP tag (green circle), and the intracellular PDZ interacting domain (clear circle). (G) HUVECs were nucleofected with WT JAM-C–GFPout and imaged with a spinning-disk confocal microscope. Time indicates total time in media, and the boxed region at 0 s is shown magnified at later time points. JAM-C exists in vesicles, at the cell surface, and at the cell junctions. Large vesicles can be seen that tubulate and migrate away from the junctional region. Scale bar: 0 s, 20 μm; inset, 10 μm. Underlying data are found in S2 Data. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; IL-1, interleukin-1; JAM-C, junctional adhesion molecule-C; n.s., not significant; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; TNF, tumour necrosis factor; VE-Cadherin, vascular endothelial cadherin; WT, wild type.Endothelial cell junctions are remodelled during vascular growth, angiogenesis, and inflammation, allowing cells to move within the monolayer and leukocytes to cross the endothelial barrier. Once these processes are complete, it is essential for the junctions to reform to once again establish a contiguous barrier. Using immunofluorescence and confocal microscopy to analyse localisation of endogenous JAM-C, we monitored the amount of vesicular traffic associated with conditions that are known to disrupt endothelial barrier function. We first artificially disrupted junctions by chelating calcium ions essential for junctional formation [30]; we then washed out the chelating agent (EGTA) to monitor junctional reformation (Fig 2C). An increased number of JAM-C–positive vesicles was noted following the addition of EGTA that then reduced following washout and formation of a confluent monolayer (Fig 2C). This indicates that vesicular trafficking of JAM-C is associated with the removal of endothelial cell junctions. We next extended these studies to HUVECs treated with the potent proinflammatory cytokines interleukin-1 (IL-1) and tumour necrosis factor (TNF)-α. TNF-α increased the number of JAM-C–positive intracellular vesicles, whilst IL-1 had little effect (Fig 2D and 2E), suggesting that JAM-C junctional remodelling is stimulus-specific and is associated with treatments that reduce barrier function.To directly monitor the dynamics of JAM-C trafficking, we transfected HUVECs with a JAM-C–GFPout construct (Fig 2F) and observed the cells by spinning-disk confocal microscopy (Fig 2G, S1 Movie). We noted large membranous structures forming near cellular junctions, from which tubular extensions were seen to emerge that subsequently detached and moved away (presumably along cytoskeletal tracks), dissolving the original structure. Together, the present data demonstrate that JAM-C trafficking is a rapid process, a response that is further increased during junctional remodelling and following activation of endothelial cells with certain inflammatory stimuli.
Development of a novel, to our knowledge, HRP-based proximity-labelling assay for characterising the trafficking of JAM-C
The endothelial cell junction is comprised of multiple protein complexes, some of which have already been demonstrated to redistribute constitutively and during leukocyte transmigration [31-33]. To define in an unbiased manner the receptors localised with JAM-C at the cell junctions and to determine which of these cotraffic with JAM-C, we developed a JAM-C-HRP–based proximity-labelling protocol [34] (Fig 3A–3C). This approach uses the enzymatic activity of HRP to oxidise fluid-phase–fed biotin tyramide, thus generating biotin phenoxyl radicals that covalently react with electron-rich amino acids (such as Tyr, Trp, His, and Cys) on neighbouring proteins (Fig 3B). The short-lived nature of these radicals results in a small labelling radius (<20 nm) and provides a proximity map of all nearby proteins (Fig 3C). We transfected HUVECs with the JAM-C–HRPout construct (Fig 3A) and fed the cells for 30 min with biotin tyramide. The proteins neighbouring JAM-C were biotinylated during a short (1-min) incubation with hydrogen peroxide, and this reaction was then terminated using molecules that scavenge free radicals. Biotinylated proteins in proximity to JAM-C–HRP were detected at the cell surface and within intracellular vesicles (Fig 3D). Importantly, no biotinylation was detected in the absence of biotin tyramide or hydrogen peroxide (S1C Fig). To specifically identify intracellular stores of JAM-C, we incorporated ascorbate, a membrane-impermeant inhibitor of HRP, into our assay. Ascorbate blocks the proximity-labelling reaction at the cell surface, but not in intracellular stores (Fig 3C). This approach has been previously utilised in EM studies to inhibit cell-surface HRP-catalysed DAB labelling [35,36], but to our knowledge, this is the first time it has been employed for proteomics. We verified that the reaction worked by immunofluorescent labelling of treated cells with fluorescently tagged streptavidin to visualise biotinylated proteins near JAM-C (Fig 3D and S1C Fig) and by western blotting using streptavidin HRP (Fig 3E). Both methods confirmed that intracellular stores of JAM-C could be visualised, but not cell-surface pools. To further increase the number of intracellular vesicles containing JAM-C, we also incorporated bafilomycin into the assay (Fig 3D). Following the reaction, cells were lysed and biotinylated proteins pulled down with streptavidin before performing an on-bead tryptic digest and subsequent tandem mass spectrometry (MS/MS) analysis.
Fig 3
An HRP-based proximity-labelling approach reveals JAM-C cotraffics with NRP-1 and 2 and VE-Cadherin, but not with components of the LBRC.
(A) Schematic of the domain structure of the JAM-C–HRP construct. (B) In the presence of biotin tyramide and hydrogen peroxide, the HRP tag leads to the biotinylation of any proteins within 20 nm (labelled with an X) on tyrosine, tryptophan, cysteine, or histidine residues. (C) Endothelial cells expressing JAM-C–HRPout are fed with biotin tyramide, and then hydrogen peroxide is added for 1 min. Proteins within a 20-nm radius of JAM-C–HRP are labelled with biotin (shown in light purple). Addition of the membrane-impermeant HRP inhibitor ascorbate blocks the biotinylation reaction at the cell surface but not inside the cell. (D–F) HUVECs were transfected with JAM-C–HRPout and incubated in the presence or absence of bafilomycin A1 (100 nM) for 4 h to block lysosomal degradation. Cells were fed biotin tyramide for 30 min and then exposed to hydrogen peroxide for 1 min in the presence or absence of 50 mM ascorbate. (D) The cells were then fixed and labelled for streptavidin (green) and DAPI (blue) and images acquired by confocal microscopy or (E–F) the reaction was then quenched, and the cells were lysed. Biotinylated proteins were pulled down using neutravidin beads and lysate, and pulldown samples were analysed by (E) SDS-PAGE and western blot for the presence of JAM-C, tubulin, and biotinylated proteins or (F) following an on-bead tryptic digest mass spectrometry. A heat map of 4 independent mass spectrometry data sets is shown, with white meaning none and dark red a high signal. Individual experiments were carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 4 analyses/experiment). p-Values are given across all 4 experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001, t test). The + TNF-α experiment is shown in S3 Fig. Cotrafficked proteins appear in both ±ascorbate conditions, whilst proteins adjacent to JAM-C solely at the cell surface are only present in the −ascorbate condition. Scale bar, 20 μm. CD, cluster of differentiation; EGFR, epidermal growth factor receptor; ESAM, endothelial cell-selective adhesion molecule; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; ICAM, intercellular adhesion molecule; IL, interleukin; Jak-1, janus kinase 1; JAM-C, junctional adhesion molecule-C; LBRC, lateral border recycling compartment; LDL, low-density lipoprotein; NRP, neuropilin; n/s, not significant; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; PECAM, platelet endothelial cell adhesion molecule; PLVAP, plasmalemma vesicle-associated protein; PTPR, receptor-type tyrosine phosphatase; Tie-2, tyrosine-protein kinase receptor 2; TM, transmembrane; TNF, tumour necrosis factor; VE-Cadherin, vascular endothelial cadherin; VEGFR, vascular endothelial growth factor receptor.
An HRP-based proximity-labelling approach reveals JAM-C cotraffics with NRP-1 and 2 and VE-Cadherin, but not with components of the LBRC.
(A) Schematic of the domain structure of the JAM-C–HRP construct. (B) In the presence of biotin tyramide and hydrogen peroxide, the HRP tag leads to the biotinylation of any proteins within 20 nm (labelled with an X) on tyrosine, tryptophan, cysteine, or histidine residues. (C) Endothelial cells expressing JAM-C–HRPout are fed with biotin tyramide, and then hydrogen peroxide is added for 1 min. Proteins within a 20-nm radius of JAM-C–HRP are labelled with biotin (shown in light purple). Addition of the membrane-impermeant HRP inhibitor ascorbate blocks the biotinylation reaction at the cell surface but not inside the cell. (D–F) HUVECs were transfected with JAM-C–HRPout and incubated in the presence or absence of bafilomycin A1 (100 nM) for 4 h to block lysosomal degradation. Cells were fed biotin tyramide for 30 min and then exposed to hydrogen peroxide for 1 min in the presence or absence of 50 mM ascorbate. (D) The cells were then fixed and labelled for streptavidin (green) and DAPI (blue) and images acquired by confocal microscopy or (E–F) the reaction was then quenched, and the cells were lysed. Biotinylated proteins were pulled down using neutravidin beads and lysate, and pulldown samples were analysed by (E) SDS-PAGE and western blot for the presence of JAM-C, tubulin, and biotinylated proteins or (F) following an on-bead tryptic digest mass spectrometry. A heat map of 4 independent mass spectrometry data sets is shown, with white meaning none and dark red a high signal. Individual experiments were carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 4 analyses/experiment). p-Values are given across all 4 experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001, t test). The + TNF-α experiment is shown in S3 Fig. Cotrafficked proteins appear in both ±ascorbate conditions, whilst proteins adjacent to JAM-C solely at the cell surface are only present in the −ascorbate condition. Scale bar, 20 μm. CD, cluster of differentiation; EGFR, epidermal growth factor receptor; ESAM, endothelial cell-selective adhesion molecule; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; ICAM, intercellular adhesion molecule; IL, interleukin; Jak-1, janus kinase 1; JAM-C, junctional adhesion molecule-C; LBRC, lateral border recycling compartment; LDL, low-density lipoprotein; NRP, neuropilin; n/s, not significant; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; PECAM, platelet endothelial cell adhesion molecule; PLVAP, plasmalemma vesicle-associated protein; PTPR, receptor-type tyrosine phosphatase; Tie-2, tyrosine-protein kinase receptor 2; TM, transmembrane; TNF, tumour necrosis factor; VE-Cadherin, vascular endothelial cadherin; VEGFR, vascular endothelial growth factor receptor.We detected 134 proteins that were within the vicinity of JAM-C at the cell surface and 50 proteins that were proximal to JAM-C after internalisation; an example of all the data from one replicate is shown, including the background proteins identified (S1D Fig), and a more detailed table showing proteins 3.5-fold enriched over the mock condition and that exhibit differential trafficking is also shown (Fig 3F). Our mass spectrometry results (Fig 3, S1 Table—includes corrected p-value for multiple comparisons—and S1E and S1F Fig) indicate that components of a known junctional adhesion molecule trafficking pathway, the lateral border recycling compartment (LBRC), comprising PECAM-1, CD99, and JAM-A [31-33] are all adjacent to JAM-C at the cell surface but are not cotrafficked with JAM-C. Proteins classically associated with endothelial cell permeability such as VE-Cadherin, NRP-1, and NRP-2 were adjacent to JAM-C at the cell surface and also cotrafficked with JAM-C. Other cotrafficked receptors included plasmalemma vesicle-associated protein, a protein implicated in permeability, angiogenesis, and leukocyte transmigration [37], and a number of integrin subunits (alpha-2, 3, and 5 and beta-1). Notably, VEGF receptor (VEGFR)2, a receptor classically associated with the NRPs, is adjacent to JAM-C at the junctions but absent from the intracellular carriers, suggesting that separate trafficking of these coreceptors may be a means of regulating their functions.We further validated our MS results by immunofluorescence analysis and western blotting of purified biotinylated proteins (S2 Fig). Since TNF-α can increase the number of JAM-C–positive vesicles (Fig 2E), to determine whether these are qualitatively different to those in unstimulated cells (i.e., the result of an additional inflammatory pathway) or whether they simply represent an up-regulation in the rate of traffic, we carried out HRP proximity labelling in the presence of TNF-α. The cotrafficking proteins were largely the same (S3 Fig). The only major difference noted was a potential reduction in the cotrafficking of JAM-C with VE-Cadherin, and this needs to be verified in future work. This indicates that inflammatory stimuli affect the rate, but not the primary route, of JAM-C intracellular traffic.
JAM-C turnover is dependent on ubiquitylation of the cytoplasmic tail
To determine the importance of intracellular trafficking on the function of JAM-C, we needed to define the mechanism of its turnover. Trafficking of a receptor is most often governed by specific signals and motifs present in the intracellular domain. The cytoplasmic domain of JAM-C is relatively short (44 amino acids) and features a number of conserved potential phosphorylation and ubiquitylation sites, as well as a postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1 (PDZ) interacting domain (Fig 4A). We incorporated mutations of all these sites into our GFPout JAM-C constructs either by site-directed or truncation mutagenesis. When expressed in endothelial cells, all mutants exhibited at least some junctional localisation (Fig 4B). The ΔPDZ mutant exhibited a noticeably different localisation in that it was expressed at higher levels and was also found to be enriched in a peri-Golgi pool. To determine the effect of each mutation on JAM-C-GFP turnover, we transiently transfected HUVECs with the JAM-C constructs and, 16 h later, added cycloheximide to block new protein synthesis. We then monitored the loss of GFP-labelled protein by western blot over a 24-h period (Fig 4C and 4D). We observed that the K283R and Y267A mutants had slower and quicker turnover than WT JAM-C, respectively. Given that increases in cell-surface JAM-C levels are associated with a number of disease states, including atherosclerosis and rheumatoid arthritis [19,24], and the K283R mutant exhibits a slower turnover, we focused on the potential role of ubiquitylation in JAM-C trafficking and degradation.
Fig 4
A lysine residue in the cytoplasmic tail of JAM-C is required for its timely degradation.
(A) A schematic representation of the JAM-C–GFPout construct showing the residues in the cytoplasmic tail that were mutated by site-directed mutagenesis. (B) HUVECs were transfected with WT or mutant JAM-C–GFPout constructs, fixed, and stained for VE-Cadherin (red). The boxed area is magnified (bottom left of each panel) to show the Jam-C–GFP signal. All JAM-C mutants exhibit at least some junctional staining. The ΔPDZ construct exhibited the most marked change in localisation, existing additionally in a peri-Golgi region and expressing at higher levels. Scale bars, 20 μm. (C and D) HUVECs were transfected with WT or mutated JAM-C–GFPout constructs and treated with 10 μg/ml cycloheximide. (C) The rate of protein degradation was determined by SDS-PAGE and western blot over a 24-h period; a representative anti-GFP blot is shown. (D) Quantification of western blots normalised to the 0-h protein levels, data from n = 7 experiments, error bars represent SEM (*p ≤ 0.05; two-way ANOVA). Underlying data are found in S3 Data. a.a., amino acid; GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; TM, transmembrane; WT, wild type.
A lysine residue in the cytoplasmic tail of JAM-C is required for its timely degradation.
(A) A schematic representation of the JAM-C–GFPout construct showing the residues in the cytoplasmic tail that were mutated by site-directed mutagenesis. (B) HUVECs were transfected with WT or mutant JAM-C–GFPout constructs, fixed, and stained for VE-Cadherin (red). The boxed area is magnified (bottom left of each panel) to show the Jam-C–GFP signal. All JAM-C mutants exhibit at least some junctional staining. The ΔPDZ construct exhibited the most marked change in localisation, existing additionally in a peri-Golgi region and expressing at higher levels. Scale bars, 20 μm. (C and D) HUVECs were transfected with WT or mutated JAM-C–GFPout constructs and treated with 10 μg/ml cycloheximide. (C) The rate of protein degradation was determined by SDS-PAGE and western blot over a 24-h period; a representative anti-GFP blot is shown. (D) Quantification of western blots normalised to the 0-h protein levels, data from n = 7 experiments, error bars represent SEM (*p ≤ 0.05; two-way ANOVA). Underlying data are found in S3 Data. a.a., amino acid; GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; SEM, standard error of the mean; TM, transmembrane; WT, wild type.JAM-C has 4 lysine residues in its cytoplasmic tail (Fig 5A); to completely abrogate ubiquitylation, we needed to generate a mutant with all lysine residues mutated to arginine (Quad-K JAM-C). We co-transfected HUVECs with hemagglutinin (HA)-tagged ubiquitin and either WT or mutant JAM-C–GFPout or endothelial growth factor receptor (EGFR)-GFP (as a positive control). Using GFP trap beads, we pulled down the tagged protein and quantified levels of GFP-tagged receptor and associated HA-tagged ubiquitin (Fig 5B). The Quad-K JAM-C was devoid of ubiquitylation, unlike both the WT and EGFR protein. No obvious change in JAM-C localisation was apparent with the ubiquitin mutant in fixed images (Fig 5C). However, live-cell imaging of WT and Quad-K JAM-C–GFPout in the presence of bafilomycin revealed marked differences in receptor trafficking (Fig 5D and 5E). The WT receptor gradually accrues in vesicles following bafilomycin treatment (Fig 5D, S2 Movie). These structures represent the pool of late endosomes and lysosomes unable to degrade because of the inhibition of V-ATPase function and therefore acidification. In contrast, Quad-K JAM-C–GFPout cycles between endocytic structures and the cell surface and does not accrue in late endosomal/lysosomal structures (Fig 5E, S3 Movie). This demonstrates fundamental differences in receptor trafficking following blocking of JAM-C ubiquitylation. To more closely examine the ultrastructure of the intracellular pools in which the Quad-K JAM-C mutant localises, we incorporated the lysine mutations into the JAM-C–HRPout construct and expressed it in unstimulated endothelial cells before carrying out DAB labelling and EM analysis. We found clear evidence of Quad-K JAM-C–HRP on early endosomes (Fig 5Fa) but little labelling on MVBs (Fig 5Fb and 5Fc), in contrast to WT JAM-C–HRPout (Fig 1H and 1I). These data are consistent with the live-cell imaging experiments and indicate that the mutation of intracellular lysine residues in JAM-C prevents sorting of the receptor onto the intraluminal vesicles of the MVB for subsequent degradation.
Fig 5
JAM-C is ubiquitylated, and this governs its targeting to MVBs.
(A) A schematic representation of the JAM-C–EGFPout construct showing all the lysine residues in the cytoplasmic tail that can be potentially modified by ubiquitylation and the JAM-C mutant generated. (B) HUVECs were transfected with WT, Quad-K JAM-C–GFPout, or EGFR-GFP (as a positive control) and ubiquitin HA. Cells were lysed, and GFP-tagged proteins were pulled down using GFP trap agarose beads. Lysate and pulldown proteins were analysed by SDS-PAGE and western blot for the presence of GFP- and HA-tagged proteins. WT, but not Quad-K, JAM-C is modified with ubiquitin. (C) HUVECs were transfected with WT or Quad-K mutant JAM-C–GFPout and then fixed before imaging by confocal microscopy. Scale bar, 20 μm. (D and E) HUVECs were transfected with (D) WT or (E) Quad-K JAM-C–EGFPout and 100 nM bafilomycin was added (at t = 0 min) before imaging by time-lapse confocal microscopy. The number of vesicles over time in each cell or the average number of vesicles/cell is plotted (error bars represent SEM). A representative movie is shown of n = 3 separate experiments. Boxed regions are shown magnified as individual stills. Scale bars, 20 μm and 5 μm in magnified stills. (F) HUVECs were transiently transfected with Quad-K JAM-C–HRPout, fixed, and incubated with DAB and hydrogen peroxide for 30 min. Cells were then secondarily fixed, and 70-nm sections were prepared and imaged by transmission EM. Precipitated DAB can be clearly seen on early endosomes, but there is little evidence of labelling on MVBs (a, b, and c). Scale bar, 200 nm. Underlying data are found in S4 Data. a.a., amino acid; DAB, diaminobenzidine; EGFP, enhanced green fluorescent protein; EGFR, epidermal growth factor receptor; EM, electron microscopy; GFP, green fluorescent protein; HA, hemagglutinin; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; MVB, multivesicular body; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; QK, Quad-K; Quad-K, 4 lysine residues mutated to arginine residues; TM, transmembrane; Ub/Ubq, ubiquitin; WT, wild type.
JAM-C is ubiquitylated, and this governs its targeting to MVBs.
(A) A schematic representation of the JAM-C–EGFPout construct showing all the lysine residues in the cytoplasmic tail that can be potentially modified by ubiquitylation and the JAM-C mutant generated. (B) HUVECs were transfected with WT, Quad-K JAM-C–GFPout, or EGFR-GFP (as a positive control) and ubiquitin HA. Cells were lysed, and GFP-tagged proteins were pulled down using GFP trap agarose beads. Lysate and pulldown proteins were analysed by SDS-PAGE and western blot for the presence of GFP- and HA-tagged proteins. WT, but not Quad-K, JAM-C is modified with ubiquitin. (C) HUVECs were transfected with WT or Quad-K mutant JAM-C–GFPout and then fixed before imaging by confocal microscopy. Scale bar, 20 μm. (D and E) HUVECs were transfected with (D) WT or (E) Quad-K JAM-C–EGFPout and 100 nM bafilomycin was added (at t = 0 min) before imaging by time-lapse confocal microscopy. The number of vesicles over time in each cell or the average number of vesicles/cell is plotted (error bars represent SEM). A representative movie is shown of n = 3 separate experiments. Boxed regions are shown magnified as individual stills. Scale bars, 20 μm and 5 μm in magnified stills. (F) HUVECs were transiently transfected with Quad-K JAM-C–HRPout, fixed, and incubated with DAB and hydrogen peroxide for 30 min. Cells were then secondarily fixed, and 70-nm sections were prepared and imaged by transmission EM. Precipitated DAB can be clearly seen on early endosomes, but there is little evidence of labelling on MVBs (a, b, and c). Scale bar, 200 nm. Underlying data are found in S4 Data. a.a., amino acid; DAB, diaminobenzidine; EGFP, enhanced green fluorescent protein; EGFR, epidermal growth factor receptor; EM, electron microscopy; GFP, green fluorescent protein; HA, hemagglutinin; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; MVB, multivesicular body; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; QK, Quad-K; Quad-K, 4 lysine residues mutated to arginine residues; TM, transmembrane; Ub/Ubq, ubiquitin; WT, wild type.
An ascorbate peroxidase 2 proximity-labelling approach to identify machinery utilised for JAM-C trafficking
To determine the molecular machinery associated with the intracellular trafficking and ubiquitylation of JAM-C, we used an ascorbate peroxidase 2 (APEX-2) proximity-labelling approach. This strategy was originally developed by Rhee and colleagues [34]. To specifically identify machinery associated with ubiquitylation of JAM-C, we compared WT JAM-C–APEX-2 biotinylation with the Quad-K JAM-C–APEX-2 and monitored the proteins enriched in the former over the latter.We incorporated a codon-optimised APEX-2 tag in the membrane-proximal region of the cytoplasmic tail of JAM-C in both WT and Quad-K JAM-C (Fig 6A). This site was chosen so as to minimise the potential for disrupting the C-terminal PDZ interacting domain and other motifs present in the cytoplasmic tail. To ensure the WT and mutant JAM-C–APEX constructs did not dimerise with the endogenous WT receptor, we depleted the endogenous receptor and expressed siRNA-resistant constructs (Fig 6B). We detected robust biotinylation by western blot following 30-min feed with biotin tyramide and 1-min exposure to hydrogen peroxide (Fig 6C). Moreover, biotinylated proteins were detected at the junctions and on intracellular vesicles following immunofluorescence labelling with streptavidin 488 (Fig 6D). To identify proteins neighbouring JAM-C–APEX, we pulled down biotinylated proteins and carried out on-bead trypsin digestion and MS/MS analysis. Mass spectrometry analysis revealed 576 significant hits that were more than 3.5-fold enriched over the mock transfected cells (Fig 6E and 6F, S2 Table). Hits included proteins from the cell-surface and intracellular pools and associated with a number of cellular processes, including endocytosis, recycling, fusion, and ubiquitylation. We detected a number of integral membrane proteins previously identified from our HRP approach, including VE-Cadherin. Of particular interest were a number of components associated with endosomal sorting complex required for transport (ESCRT)-0 and 1 and E3 ligases such as CBL, demonstrating that at some point during its trafficking, JAM-C is adjacent to machinery necessary for the ubiquitylation and the maturation of endosomes to MVBs. The equivalent analysis of Quad-K JAM-C–APEX-2 biotinylation showed a similar profile, but notably, CBL and components of the ESCRT complex, vacuolar protein sorting-associated protein (VPS)28 and Vps4B, were absent (Fig 6E and 6G). This indicates that when the 4 lysines present in the cytoplasmic tail of JAM-C are mutated, the E3 ligase and some components of the associated ESCRT machinery are not recruited, and JAM-C is therefore not sorted onto intraluminal vesicles.
Fig 6
An APEX-2 proximity-labelling approach reveals potential JAM-C trafficking machinery.
(A) Schematic of the domain structure of the JAM-C–APEX-2 construct, showing the extracellular immunoglobulin domains (blue), the APEX-2 tag (green circle), and the intracellular PDZ interacting domain (clear circle). The APEX-2 tag, following feeding with biotin tyramide and incubation with hydrogen peroxide for 1 min, labels all neighbouring proteins within 20 nm on electron-rich amino acids (purple circle). (B–E) HUVECs were transfected with WT or Quad-K JAM-C–APEX-2. Cells were fed biotin tyramide for 30 min and then exposed to hydrogen peroxide for 1 min. The reaction was then quenched, and the cells were either (D) fixed and stained with streptavidin and analysed by confocal microscopy or (B, C, and E) lysed and biotinylated proteins pulled down using neutravidin beads for analysis by (B and C) SDS-PAGE and western blot for the presence of (B) JAM-C and tubulin or (C) biotinylated proteins or (E) following an on-bead tryptic digest, mass spectrometry. A heat map of n = 3 independent mass spectrometry data sets is shown, with white representing no signal and dark red a high signal. Each individual experiment was carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 3 analyses/experiment). p-Values are given across all 3 experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test). (F and G) String analysis of proteins neighbouring (F) WT or (G) Quad-K JAM-C–APEX-2 proteins. *Lane removed of a JAM-C mutant not included in this analysis. APEX-2, ascorbate peroxidase 2; CBL, Casitas B-lineage lymphoma; ESCRT, endosomal sorting complex required for transport; Hrs, hepatocyte growth factor-regulated tyrosine kinase substrate; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; KIF, kinesin-like protein; n/s, not significant; Quad-K, 4 lysine residues mutated to arginine residues; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; siRNA, small interfering RNA; SNAP23, synaptosomal-associated protein 23; SNARE, soluble N-ethylmaleimide sensitive factor attachment protein receptor; STAM, signal transducing adapter molecule 1; TM, transmembrane; Tsg101, tumour susceptibility gene 101 protein; VPS, vacuolar protein sorting-associated protein; WASF2, Wiskott–Aldrich syndrome protein family member 2; WT, wild type.
An APEX-2 proximity-labelling approach reveals potential JAM-C trafficking machinery.
(A) Schematic of the domain structure of the JAM-C–APEX-2 construct, showing the extracellular immunoglobulin domains (blue), the APEX-2 tag (green circle), and the intracellular PDZ interacting domain (clear circle). The APEX-2 tag, following feeding with biotin tyramide and incubation with hydrogen peroxide for 1 min, labels all neighbouring proteins within 20 nm on electron-rich amino acids (purple circle). (B–E) HUVECs were transfected with WT or Quad-K JAM-C–APEX-2. Cells were fed biotin tyramide for 30 min and then exposed to hydrogen peroxide for 1 min. The reaction was then quenched, and the cells were either (D) fixed and stained with streptavidin and analysed by confocal microscopy or (B, C, and E) lysed and biotinylated proteins pulled down using neutravidin beads for analysis by (B and C) SDS-PAGE and western blot for the presence of (B) JAM-C and tubulin or (C) biotinylated proteins or (E) following an on-bead tryptic digest, mass spectrometry. A heat map of n = 3 independent mass spectrometry data sets is shown, with white representing no signal and dark red a high signal. Each individual experiment was carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 3 analyses/experiment). p-Values are given across all 3 experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test). (F and G) String analysis of proteins neighbouring (F) WT or (G) Quad-K JAM-C–APEX-2 proteins. *Lane removed of a JAM-C mutant not included in this analysis. APEX-2, ascorbate peroxidase 2; CBL, Casitas B-lineage lymphoma; ESCRT, endosomal sorting complex required for transport; Hrs, hepatocyte growth factor-regulated tyrosine kinase substrate; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; KIF, kinesin-like protein; n/s, not significant; Quad-K, 4 lysine residues mutated to arginine residues; PDZ, postsynaptic density protein/drosophila disc large tumour suppressor/zonula occludens protein 1; siRNA, small interfering RNA; SNAP23, synaptosomal-associated protein 23; SNARE, soluble N-ethylmaleimide sensitive factor attachment protein receptor; STAM, signal transducing adapter molecule 1; TM, transmembrane; Tsg101, tumour susceptibility gene 101 protein; VPS, vacuolar protein sorting-associated protein; WASF2, Wiskott–Aldrich syndrome protein family member 2; WT, wild type.To confirm that CBL is required for the ubiquitylation of JAM-C, we reduced its expression using siRNA transfection in HUVECs (Fig 7A). Depletion of CBL decreased the ubiquitylation of JAM-C–GFPout (Fig 7B and 7C) and increased the levels of receptor present in endothelial cells (Fig 7B and 7D). The effects of CBL depletion are particularly apparent when the levels of ubiquitylation are normalised to the levels of JAM-C–GFPout present (Fig 7E). CBL knockdown caused no significant change in the surface localisation of endogenous receptor by immunofluorescence analysis (Fig 7F), although this was confounded by the variability in junctional quantification of immunofluorescence images. However, on addition of bafilomycin, CBL-depleted cells have significantly fewer JAM-CGFPout–positive vesicles (Fig 7F and 7G). This indicates that CBL is required for JAM-C ubiquitylation, which is necessary for JAM-C sorting onto the intraluminal vesicles of late endosomes.
Fig 7
JAM-C is ubiquitylated by the E3 ligase CBL.
(A–G) HUVECs were transfected with 2 different CBL siRNAs over a 96-h period. (A) Cells were lysed and analysed by SDS-PAGE and western blot, detecting CBL and tubulin. Knockdown was typically ≥90%. (B–E) Untreated or CBL knockdown cells were transfected with JAM-C–GFPout and HA ubiquitin. Cells were lysed, and GFP-tagged proteins were pulled down using GFP trap agarose beads. Pulldown proteins were analysed by SDS-PAGE and western blots for the presence of GFP- and HA-tagged proteins. Quantification of (C) HA ubiquitin levels, (D) JAM-C–GFPout levels, or (E) ubiquitin levels normalised to levels of JAM-C. Results are from n = 3 experiments. Error bars represent SEM (*p ≤ 0.05; t test). (F) Mock and CBL knockdown cells were incubated with and without 100 nM bafilomycin for 4 h and then fixed and labelled for endogenous VE-Cadherin (red) and JAM-C (green). (G) Quantification of the number of JAM-C–positive vesicles present in mock and CBL knockdown cells treated with 100 nM bafilomycin (5 fields of view/condition). Results are shown normalised to the mean number of vesicles in the mock cells from n = 3 experiments. Error bars represent SD (**p ≤ 0.01; t test). Underlying data are found in S5 Data. CBL, Casitas B-lineage lymphoma; GFP, green fluorescent protein; HA, hemagglutinin; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; kd, knockdown; SEM, standard error of the mean; siRNA, small interfering RNA; VE-Cadherin, vascular endothelial cadherin.
JAM-C is ubiquitylated by the E3 ligase CBL.
(A–G) HUVECs were transfected with 2 different CBL siRNAs over a 96-h period. (A) Cells were lysed and analysed by SDS-PAGE and western blot, detecting CBL and tubulin. Knockdown was typically ≥90%. (B–E) Untreated or CBL knockdown cells were transfected with JAM-C–GFPout and HA ubiquitin. Cells were lysed, and GFP-tagged proteins were pulled down using GFP trap agarose beads. Pulldown proteins were analysed by SDS-PAGE and western blots for the presence of GFP- and HA-tagged proteins. Quantification of (C) HA ubiquitin levels, (D) JAM-C–GFPout levels, or (E) ubiquitin levels normalised to levels of JAM-C. Results are from n = 3 experiments. Error bars represent SEM (*p ≤ 0.05; t test). (F) Mock and CBL knockdown cells were incubated with and without 100 nM bafilomycin for 4 h and then fixed and labelled for endogenous VE-Cadherin (red) and JAM-C (green). (G) Quantification of the number of JAM-C–positive vesicles present in mock and CBL knockdown cells treated with 100 nM bafilomycin (5 fields of view/condition). Results are shown normalised to the mean number of vesicles in the mock cells from n = 3 experiments. Error bars represent SD (**p ≤ 0.01; t test). Underlying data are found in S5 Data. CBL, Casitas B-lineage lymphoma; GFP, green fluorescent protein; HA, hemagglutinin; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; kd, knockdown; SEM, standard error of the mean; siRNA, small interfering RNA; VE-Cadherin, vascular endothelial cadherin.
Ubiquitylation of JAM-C is required for cell migration
JAM-C is known to mediate a number of important biological processes, including angiogenesis [16,38-41] and leukocyte transmigration [8-12]. To determine how altering the ubiquitin-mediated trafficking of JAM-C affects its cellular function, we performed scratch wound assays. Recovery of the wound has been shown to be reduced in conditions of JAM-C knockdown [39] and increased in situations of JAM-C overexpression [42]. This assay provides a simple way to monitor the migration of endothelial cells, a process that is essential during angiogenesis. Such changes are unlikely to be due to altered proliferation because no change in cell growth has been detected following JAM-C overexpression over a 96-h period [43]. We depleted endogenous JAM-C, rescued it with lentiviral-expressed GFP, WT JAM-C–GFPout, or Quad-K JAM-C–GFPout (Fig 8A), and monitored the rate of scratch wound closure over a 16-h period (Fig 8B). The efficiency of endogenous JAM-C knockdown was similar in all conditions, and the expression levels of the JAM-C constructs matched endogenous levels (Fig 8A). Knockdown of JAM-C resulted in a slower rate of scratch wound closure, and this was rescued by overexpression of JAM-C–GFPout (Fig 8B and 8C). In contrast, Quad-K JAM-C–GFPout failed to rescue the phenotype (Fig 8B and 8C), and 60 h postscratch, the wound remained open (Fig 8D).
Fig 8
Ubiquitylation of JAM-C is required for HUVEC migration.
(A–D) HUVECs were transfected with siRNA targeting luciferase or JAM-C over a 96-h period. The day after the second round of transfection, cells were additionally transduced with a GFP-, WT JAM-C-GFPout–, or a Quad-K JAM-C-GFPout–expressing lentivirus and allowed to reach confluency. (A) Cells were lysed, and the extent of JAM-C knockdown and rescue was determined by western blot relative to a tubulin loading control. The expressed WT and Quad-K constructs were similar to endogenous levels. (B–D) The monolayer was scratched, and the cells were allowed to recover over a 0- to 60-h time period whilst being imaged on a brightfield Olympus (Tokyo, Japan) microscope. (B) A representative experiment showing the percentage recovery of cells over a 16-h time period. Mock treated cells expressing the GFP construct recover relatively quickly. JAM-C siRNA-treated cells fail to recover when rescued by transduced Quad-K JAM-C–GFPout or GFP construct. However, almost complete recovery is apparent using transduced WT JAM-C–GFPout construct after 16 h. Error bars represent SD. (C) The percentage recovery of siRNA-treated GFP, WT JAM-C–GFP, or Quad-K JAM-C–GFP transduced cells at 16 h is shown normalised to the mock/GFP rescued condition. Data shown from n = 4 experiments, error bars represent SEM (*p ≤ 0.05, **p ≤ 0.01; unpaired t test). (D) Representative images of recovery of scratch wounds after 60 h. Scale bar, 200 μm. Underlying data are found in S6 Data. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; kd, knockdown; luc, luciferase; Quad-K, 4 lysine residues mutated to arginine residues; SEM, standard error of the mean; siRNA, small interfering RNA; WT, wild type.
Ubiquitylation of JAM-C is required for HUVEC migration.
(A–D) HUVECs were transfected with siRNA targeting luciferase or JAM-C over a 96-h period. The day after the second round of transfection, cells were additionally transduced with a GFP-, WT JAM-C-GFPout–, or a Quad-K JAM-C-GFPout–expressing lentivirus and allowed to reach confluency. (A) Cells were lysed, and the extent of JAM-C knockdown and rescue was determined by western blot relative to a tubulin loading control. The expressed WT and Quad-K constructs were similar to endogenous levels. (B–D) The monolayer was scratched, and the cells were allowed to recover over a 0- to 60-h time period whilst being imaged on a brightfield Olympus (Tokyo, Japan) microscope. (B) A representative experiment showing the percentage recovery of cells over a 16-h time period. Mock treated cells expressing the GFP construct recover relatively quickly. JAM-C siRNA-treated cells fail to recover when rescued by transduced Quad-K JAM-C–GFPout or GFP construct. However, almost complete recovery is apparent using transduced WT JAM-C–GFPout construct after 16 h. Error bars represent SD. (C) The percentage recovery of siRNA-treated GFP, WT JAM-C–GFP, or Quad-K JAM-C–GFP transduced cells at 16 h is shown normalised to the mock/GFP rescued condition. Data shown from n = 4 experiments, error bars represent SEM (*p ≤ 0.05, **p ≤ 0.01; unpaired t test). (D) Representative images of recovery of scratch wounds after 60 h. Scale bar, 200 μm. Underlying data are found in S6 Data. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; kd, knockdown; luc, luciferase; Quad-K, 4 lysine residues mutated to arginine residues; SEM, standard error of the mean; siRNA, small interfering RNA; WT, wild type.Finally, we used live-cell imaging to directly analyse the trafficking of JAM-C in migrating cells (Fig 9A, S4 Movie). We noted large JAM-C-GFPout–positive vesicles forming at junctional regions, particularly on either side of the cell’s leading edge; these sites are associated with junctional disassembly. Markedly less vesicle traffic was apparent at the very front of migrating cells. This indicates that junctional disassembly is a crucial aspect of cell migration, and a proportion of this internalised JAM-C needs to be degraded by a ubiquitin-mediated lysosomal pathway to allow normal cell migration (Fig 8). Together, the results demonstrate dynamic JAM-C trafficking and ubiquitylation are essential responses for endothelial cell migration.
Fig 9
JAM-C is internalised from junctions near the front of migrating cells.
(A) JAM-C–GFPout was expressed in HUVECs, and the cells were allowed to form a confluent monolayer. The cell layer was scratched, and 45 min later, live-cell imaging was carried out with images acquired every 30 s for 45 min. The dotted line represents the edge of the scratch wound, asterisks highlight vesicles, arrows show holes that form between cells, and the boxed region is shown magnified. Scale bar, 20 μm. (B) Model of the role of JAM-C trafficking in endothelial cell migration. WT: (1) JAM-C is endocytosed from the junction either side of the leading edge and is localised to endosomes. (2) As JAM-C enters endosomes, the E3 ligase CBL ubiquitylates the cytoplasmic tail on lysine residues, allowing recruitment of the ESCRT complex and the formation of intraluminal vesicles. (3) JAM-C is degraded in the lysosomes, preventing recycling and regulation of integrins and/or abrogating signalling. (4) The remaining JAM-C that is not ubiquitylated is likely returned to the cell surface to reform new junctions after the cell has moved. Inhibition of JAM-C ubiquitylation: (5) JAM-C is endocytosed from the junction either side of the leading edge and is localised to endosomes. (6) Mutation of JAM-C or absence of CBL prevents ubiquitylation and recruitment to the intraluminal vesicles of late endosomes. (7) Failure to degrade JAM-C results in a failure of cell migration potentially due to mistargeting of JAM-C to the appropriate region of the cell junction, misregulation of integrin molecules, and/or abrogation of signalling. CBL, Casitas B-lineage lymphoma; ESCRT, endosomal sorting complex required for transport; GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; WT, wild type.
JAM-C is internalised from junctions near the front of migrating cells.
(A) JAM-C–GFPout was expressed in HUVECs, and the cells were allowed to form a confluent monolayer. The cell layer was scratched, and 45 min later, live-cell imaging was carried out with images acquired every 30 s for 45 min. The dotted line represents the edge of the scratch wound, asterisks highlight vesicles, arrows show holes that form between cells, and the boxed region is shown magnified. Scale bar, 20 μm. (B) Model of the role of JAM-C trafficking in endothelial cell migration. WT: (1) JAM-C is endocytosed from the junction either side of the leading edge and is localised to endosomes. (2) As JAM-C enters endosomes, the E3 ligase CBL ubiquitylates the cytoplasmic tail on lysine residues, allowing recruitment of the ESCRT complex and the formation of intraluminal vesicles. (3) JAM-C is degraded in the lysosomes, preventing recycling and regulation of integrins and/or abrogating signalling. (4) The remaining JAM-C that is not ubiquitylated is likely returned to the cell surface to reform new junctions after the cell has moved. Inhibition of JAM-C ubiquitylation: (5) JAM-C is endocytosed from the junction either side of the leading edge and is localised to endosomes. (6) Mutation of JAM-C or absence of CBL prevents ubiquitylation and recruitment to the intraluminal vesicles of late endosomes. (7) Failure to degrade JAM-C results in a failure of cell migration potentially due to mistargeting of JAM-C to the appropriate region of the cell junction, misregulation of integrin molecules, and/or abrogation of signalling. CBL, Casitas B-lineage lymphoma; ESCRT, endosomal sorting complex required for transport; GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; WT, wild type.
Discussion
Prior to this study, many aspects of the molecular control of JAM-C function were unclear, as was the relationship, in terms of regulation and function, with its homologue JAM-A and other components of the junctional machinery. Our presented work addresses many of these issues and opens further avenues of research to determine how intracellular trafficking controls JAM-C’s important physiological and pathological roles.Our proximity-labelling proteomics approach allowed a bulk analysis of the receptors trafficked alongside JAM-C. With this approach, we discovered that JAM-C traffics with VE-Cadherin and NRP-1 and 2, as well as some integrin subunits, but is not present in the same pool as its homologue JAM-A or any of the other component of the LBRC. This cotrafficking is likely to represent receptors associated with a similar function being moved en masse. Receptors present in the LBRC are thought to provide a reticular pool of unligated receptors necessary for leukocyte movement, whilst by contrast, we hypothesise trafficking of JAM-C and its counterparts allows precise control of cell migration and the passage of molecules and cells by disassembling and reforming the junction. In agreement with this, we see increased trafficking of JAM-C associated with artificial disruption of the junctions by calcium chelation and following exposure to an inflammatory stimulus (TNF-α). Another cytokine, IL-1, had little effect on trafficking, and this difference likely reflects the ability of TNF-α signalling to additionally stimulate an endothelial permeability response [44]. In vivo, TNF-α signalling is known to be important during ischemia reperfusion injury [45], one of the first occasions in which vesicular pools of JAM-C were noted [10].Although there is no direct codependence for traffic, it remains possible that JAM-C may share some as yet unknown trafficking machinery with its neighbours and be internalised at the same time from the cell surface. However, some of the receptors present in the same cotrafficked pool have been reported to be internalised by different clathrin-dependent and independent routes [46-50]. An alternative explanation is that the shared pool could represent a fusion of early endosomes from diverse endocytic routes to form a late endosomal pool downstream. There is therefore scope for cotrafficked receptors interacting with each other and therefore modifying function, although this remains to be investigated.A key finding of the study is that we show for the first time, to our knowledge, that JAM-C is ubiquitylated and that this modification represents a key step in JAM-C receptor trafficking. Our APEX-2 proximity-labelling approach allowed us to identify CBL as the E3 ligase responsible for ubiquitylating JAM-C on up to 4 different residues in the cytoplasmic domain, with the number and pattern of bands suggesting polyubiquitylation. This modification is necessary for the efficient sorting of JAM-C onto intraluminal vesicles of the MVB. The trafficking phenotype on CBL depletion was less striking than that of the Quad-K JAM-C mutant and so likely represents either an incomplete block of the ubiquitylation pathway or compensation by another E3 ligase. Ubiquitylation is a means of controlling turnover of claudin-1, 2, 4, 5, 8, and 16 [51]; however, the only JAM family member previously shown to be ubiquitylated is JAM-B on Sertoli cells. The site of ubiquitylation, the E3 ligase involved, and the effect on receptor trafficking have yet to be determined [52]. A further means to regulate JAM-C trafficking and function is likely to be the removal of ubiquitin. There are thought to be more than 100 potential deubiquitinating enzymes (DUBs) in mammalian cells [51], and we identified 6 potential JAM-C–localised DUBs in our APEX-2 screen: ubiquitin carboxyl-terminal hydrolase (USP) 5, 7, 10, 15, and 47 and USPY. Notably, these proteins were adjacent to JAM-C irrespective of whether we utilised the WT or the Quad-K mutant and therefore could potentially represent nearby bystander proteins rather than bona fide interactors. We have yet to verify whether these proteins are important for JAM-C traffic, although interestingly, USP-47 has been shown to regulate E-cadherin deubiquitylation at junctions [53].Our results show that targeted removal and degradation of JAM-C from junctions is required for endothelial cell migration. As endothelial cells migrate to fill a gap in the monolayer, endocytic disassembly of the junction occurs on either side of the cells’ leading edge. As JAM-C enters endosomes, it becomes ubiquitylated and is directed for degradation by the lysosomes. A failure to ubiquitylate has no effect on overall internalisation but results in premature, mistimed, or mistargeted removal of JAM-C from the cell surface. We present 3 potential models (which are not mutually exclusive) of how inhibition of degradation of JAM-C slows migration (Fig 9B). Firstly, the change in receptor targeting might reduce the kinetics or timing of removal or change the localisation of homo- and heterotypic junctional interactions with neighbouring cells, preventing cell movement. Secondly, targeting receptor for degradation might be required to disrupt cell-surface protein–protein interactions or terminate signalling events. Such signalling could potentially occur via interactions with the polarity proteins, partitioning defective protein (Par) 3 [54] and Par6 [55]. Notably, Par3/JAM-C interactions are required for neuronal cell migration from the germinal zone [56], and signalling via Par3 and cell division control protein 42 (Cdc42) is required for lumen formation during 3D endothelial tubulogenesis [57]. Thirdly, changes in JAM-C trafficking might alter the ligand binding properties of other receptors. For example, JAM-C has already been shown to regulate integrin [13,42] activation and localisation. If JAM-C is misrouted, there is the potential for this mode of regulation to be changed.The trafficking and degradation of JAM-C is likely important for the other ascribed roles of JAM-C, particularly during leukocyte transmigration and permeability because they both rely on the disassembly and reassembly of junctions. Controlling the trafficking of JAM-C and its cotrafficked counterparts could potentially provide novel ways of limiting disease states, particularly those associated with increased levels of cell-surface JAM-C such as atherosclerosis and arthritis.
Methods
Constructs and cloning
pRK5-HA-Ubiquitin-WT was a gift from Ted Dawson (Addgene plasmid #17608; Cambridge, MA, USA). EGFR-GFP was a gift from Alexander Sorkin (Addgene plasmid #32751). Murine JAM-C–GFPout and JAM-C–GFPout ΔPDZ have been described previously [27]. To generate murine JAM-C–HRPout, HRP was amplified from P-selectin HRP [58] using primers incorporating 15-bp 5′ or 3′ overlaps with JAM-C (S3 Table). JAM-C–GFPout was digested with XbaI and XhoI and an infusion reaction and subsequent transformation performed according to the manufacturer’s instructions (Clontech, Mountain View, CA, USA). QuikChange site-directed mutagenesis of JAM-C–GFPout to generate Y267A, S281A, Y282A, K283R, K287R, Y293A, and T296A was performed according to the manufacturer’s instructions (Agilent, Santa Clara, CA, USA) using the primers listed (S3 Table). Murine Quad-K JAM-C–HRPout, JAM-C–APEX-2, and all the site-directed mutations thereof were prepared by gene synthesis (Thermo Fisher Scientific, Waltham, MA, USA). The soybean APEX-2 sequence was first codon-optimised using GeneOptimizer (Thermo Fisher Scientific) and incorporated into the intraluminal domain of JAM-C between the transmembrane and cytoplasmic tail before subcloning into pCDNA3.1 using HindIII and BamHI sites. For lentiviral transduction, WT and Quad-K JAM-C–GFPout were amplified using appropriate primers (S3 Table) and subcloned into pLNT-SFFV using an infusion reaction according to the manufacturer’s instructions (Clontech).
Cell culture and transient transfection
HUVECs (Promocell, Heidelberg, Germany) were cultured as previously described [59]. Plasmid transfections were performed by nucleofection (Nucleofector II, programme U-001; Amaxa Biosystems, Gaithersburg, MD, USA) using 2–10 μg DNA or 250 pmol siRNA (JAM-C: AUGUAGUUAACUCCAUCUGGUUUCC, CBL-1: CCUCUCUUCCAAGCACUGA, CBL-2: CCUGAUCUGACUGGCUUAU, or luciferase: CGUACGCGGAAUACUUCGA).
Lentivirus preparation
To produce lentivirus, 8 × 106 HEK293T cells were seeded onto a 15-cm–diameter tissue culture dish in 20 ml DMEM with Glutamax (Gibco, Gaithersburg, MD, USA) with 10% heat-inactivated FBS (Gibco). Cells were incubated overnight before adding 25 μM chloroquine solution 1 h prior to transfection. Transfection complexes were prepared by diluting 18 μg of plasmid expressing the lentiviral packaging genes (pGagPol), 4 μg plasmid expressing the VSV-G envelope (pMDVSVG), and 18 μg of pSFFV-JAM-C-EGFP-WPRE in 2 ml OptiMEM (Gibco). 200 μl polyethylenimine (PEI) solution (1 mg/ml) was added (5:1 ratio of PEI:DNA) and immediately pulse-vortexed (3 brief pulses, low speed so as not to shear DNA). Complexes were incubated at room temperature for 10 min before all volume was transferred to HEK293T cells, which were returned to the incubator overnight before media was aspirated and replaced with 20 ml fresh DMEM for 48 h. Virus-containing supernatant was removed and stored at 4°C and replaced with another 20 ml DMEM complete for a further 24 h. The supernatant was taken and pooled with the earlier material, syringe-filtered with a 0.22-μM pore filter. Four times concentrated polyethylene glycol (PEG) precipitation solution was prepared (36% PEG [6,000 Da], 1.6 M NaCl, filter-sterilised) and diluted to 1× concentrate in the virus-containing supernatant. This was stored at 4°C for 90 min (inverted every 30 min) before centrifugation at 1,500 × g for 1 h at 4°C, following which media was aspirated and the pellet resuspended in OptiMEM. Aliquots were stored at −80°C until use.
Antibody feeding
HUVECs were cultured on 10-mm coverslips and inverted on prewarmed drops of HUVEC growth medium (HGM) containing a 1:1,000 dilution of rabbit anti-JAM-C antibody (S4 Table) for 15 min. Coverslips were then washed 3 times in prewarmed PBS and transferred to a drop of HGM. Coverslips were fixed at 0, 15, 30 min, 1, 2, or 4 h and immunofluorescence-labelled for total or cell-surface antibody, and the nuclei were labelled with DAPI before analysis by confocal microscopy. Levels of cell-surface JAM-C antibody were determined using Cell Profiler software [60]. Nuclei and edge channels were manually Otsu-thresholded, and a median filter was applied with an artificial diameter of 10 pixels. Objects less than 50 pixels in diameter were filtered out and the object area and intensity determined.
Ubiquitylation assay
Endogenous CBL was depleted in HUVECs by 2 rounds of transfection with 250 pmol siRNA as above. At the second round of transfection, pRK5-HA-Ubiquitin-WT and WT or mutant JAM-C-GFPout were included; the next day, cells were lysed in RIPA buffer (150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris [pH 8.0]) supplemented with 10 mM freshly prepared N-ethylmaleimide and protease inhibitors (Sigma-Aldrich, St. Louis, MO, USA). Washed GFP Trap A beads (Chromotek, Planegg-Martinsried, Germany) were added to the lysates and incubated overnight rotating at 4°C. Beads were washed and resuspended in hot Laemmli buffer (2% SDS, 25% glycerol, 0.36 M β-mercaptoethanol, 0.05 M Tris [pH 8.0]) and western-blotted.
HRP and APEX-2 proteomics
Typically, 4× 14-cm plates (Nunc, Roskilde, Denmark) of HUVECs were required for each proteomics condition analysed. Endogenous JAM-C was depleted by 2 rounds of transfection over a 96-h period with either 250 pmol JAM-C siRNA/reaction or a nontargeting luciferase siRNA. At the second round, 10 μg WT, Quad-K JAM-C–HRPout, or APEX-2 constructs were also included or, for mock conditions, cells were nucleofected with buffer alone. Following the second round, transfection cells were cultured with 7 μM freshly made haem to aid peroxidase folding and in the presence or absence of 50 ng/ml TNF-α and/or 100 nM bafilomycin (Life Technologies, Carlsbad, CA, USA). 24 h after the second transfection, both mock and peroxidase-transfected cells were fed with 500 μM biotin tyramide (Iris Biotech, Marktredwitz, Germany) for 30 min at 37°C. The cells were then exposed to M199 supplemented with 1 mM hydrogen peroxide in the presence or absence of 50 mM freshly prepared ascorbate for 1 min. The biotinylation reaction was stopped by the addition of stop solution (PBS, 10 mM sodium azide, 10 mM ascorbate, 5 mM Trolox). Cells were either fixed for immunofluorescence analysis or lysed at 4°C in RIPA buffer supplemented with 10 mM sodium azide and protease inhibitors. The lysate was centrifuged at 21,000 × g for 15 min at 4°C and protein concentration determined (Pierce 660 nm Protein Assay Reagent, Thermo Fisher Scientific). Eight point five μg lysate was kept for western blot analysis, and 1.6–1.8 mg total protein was added to 250 μl washed high-capacity neutravidin beads (Life Technologies) in low binding tubes (Life Technologies) and rotated overnight at 4°C. The beads were washed in 25 mM ammonium bicarbonate buffer, centrifuged at 21,000 × g, and frozen at −80°C before mass spectrometry analysis.
Cycloheximide chase assay
HUVECs were transfected with WT or mutant JAM-C–GFPout; the next day, cells were washed and incubated with 10 μg/ml cycloheximide. Cells were lysed in RIPA buffer supplemented with protease inhibitors (Sigma-Aldrich) at 0, 8, and 24 h before analysis by western blotting.
Mass spectrometry
Proteomics experiments were performed using mass spectrometry as reported [61,62]. In brief, Immunoprecipitated (IP) protein complex beads were digested into peptides using trypsin, and peptides were desalted using C18 + carbon top tips (Glygen Corporation, TT2MC18.96; Columbia, MD, USA) and eluted with 70% acetonitrile (ACN) with 0.1% formic acid. Dried peptides were dissolved in 0.1% TFA and analysed by nanoflow ultimate 3000 RSL nano instrument coupled online to a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific). Gradient elution was from 3% to 35% buffer B in 120 min at a flow rate 250 nL/min, with buffer A being used to balance the mobile phase (buffer A was 0.1% formic acid in water, and B was 0.1% formic acid in ACN). The mass spectrometer was controlled by Xcalibur software (version 4.0) and operated in the positive mode. The spray voltage was 1.95 kV, and the capillary temperature was set to 255°C. The Q-Exactive Plus was operated in data-dependent mode, with one survey MS scan followed by 15 MS/MS scans. The full scans were acquired in the mass analyser at 375–1,500 m/z with a resolution of 70,000, and the MS/MS scans were obtained with a resolution of 17,500. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the data set identifier PXD013003. MS raw files were converted into Mascot Generic Format using Mascot Distiller (version 2.5.1) and searched against the SwissProt database (release December 2015) restricted to human entries using the Mascot search daemon (version 2.5.0) with an FDR of approximately 1%. Allowed mass windows were 10 ppm and 25 mmu for parent and fragment mass to charge values, respectively. Variable modifications included in searches were oxidation of methionine, pyro-glu (N-term), and phosphorylation of serine, threonine, and tyrosine. The Mascot result (DAT) files were extracted into Excel files for further normalisation and statistical analysis.
Calcium switch
HUVECs were washed in low-calcium media (M199 with 20% dialysed FBS [Sigma-Aldrich] and 10 U/ml Heparin) before addition of low-calcium media with 4 mM EGTA (pH 8.0). After 30 min, the EGTA was removed and replaced with HGM. Cells were fixed before and 30 min after EGTA addition and at 15, 30, 60, and 90 min postwashout. Cells were then analysed by confocal microscopy labelling for JAM-C and VE-Cadherin.
Live-cell imaging
Endogenous JAM-C or CBL was depleted in HUVECs by 2 rounds of transfection with 250 pmol siRNA as above. At the second round, cells were transfected with WT or Quad-K JAM-C–GFPout and plated on borosilicate glass-bottomed dishes (Greiner Bio One, Kremsmunster, Austria). The following day, cells were imaged in the presence or absence of 100 nM bafilomycin (Life Technologies) in a heat-controlled chamber at 37°C with 5% CO2 in HGM using either a 63× oil immersion objective (NA 1.3) and a Zeiss 800 microscope (Zeiss, Jena, Germany) or, for higher speed images, a 100× oil immersion lens (NA 1.4) and a spinning disk (UltraVIEW VoX; Perkin-Elmer, Waltham, MA, USA). During longer-term time lapses (45 min), images were acquired every 45 s at a resolution of 512 × 512 pixels and a step size of 0.5 μm. During spinning-disk acquisition, images were acquired every 5 s for 10 min with a step size of 0.4–0.5 μm, comprising 9–14 pictures (depending on cell height) with an exposure for each image at 30 ms.
Immunofluorescence staining
Fixation and staining were carried out in permeabilised cells as in Lui-Roberts and colleagues [63] using appropriate antibodies (S4 Table). Fixed cell images were taken on a Zeiss 800 scanning confocal microscope system with a 63× objective (NA 1.3) as confocal z-stacks with 0.5-μm step size. Acquisition was performed using Zen Blue software with a 1,024 × 1,024 pixel resolution, 2× frame average, and 1× zoom.
Western blotting
Proteins were separated by SDS-PAGE, transferred to polyvinylidene fluoride membranes (Perkin-Elmer), and then probed with primary antibody (S4 Table) followed by the appropriate HRP-conjugated secondary antibody (1:5,000) (Agilent).
Scratch wound assay
Mock or JAM-C knockdown cells were transduced with GFP, WT JAM-C–GFPout, or Quad-K JAM-C–GFPout lentivirus. Scratch wound migration assays were performed on confluent monolayers of HUVECs. Wounds were made using a pipette tip, and images were captured every 30 min for 16 h by time-lapse microscopy using an Olympus (Shinjuku, Tokyo, Japan) IX81 microscope; additional images of closed scratch wounds were also acquired at 60 h. Percentage wound closure was calculated using Fiji [64].
EM
HUVECs were transfected with WT or Quad-K JAM-C–HRPout constructs and plated onto glass coverslips. The coverslips were fixed in EM-grade 2% paraformaldehyde, 1.5% glutaraldehyde (TAAB Laboratories Equipment, Ltd., Aldermaston, UK) and washed in 0.05 M Tris HCl (pH 7.6) before incubation with 0.075% DAB, 0.02% hydrogen peroxide for 30 min in the dark. The coverslips were washed in 0.1 M sodium cacodylate and secondarily fixed in 1% osmium tetraoxide, 1.5% potassium ferricyanide and then treated with 1% tannic acid. Samples were then dehydrated and embedded in Epon resin. Coverslips were inverted onto prepolymerised Epon stubs and polymerised by baking at 60°C overnight. Seventy-nm–thick sections were cut with a diatome 45° diamond knife using an ultramicrotome (UC7; Leica, Wetzlar, Germany). Sections were collected on 1 × 2 mm Formvar-coated slot grids and stained with Reynolds lead citrate. Samples were imaged using a transmission electron microscope (Tecnai G2 Spirit; FEI, Thermo Fisher Scientific) and a charge-coupled device camera (SIS Morada; Olympus).
The JAM-C–HRP biotinylation assay.
(A and B) HUVECs were transfected with WT JAM-C–HRPout or JAM-C–GFPout constructs and treated with 10 μg/ml cycloheximide. (A) The rate of protein degradation was determined by SDS-PAGE and western blot over a 24-h period, and a representative anti-JAM-C blot is shown. (B) Quantification of western blots normalised to the 0-h protein levels; data from n = 4 experiments, error bars represent SEM. Underlying data are found in S7 Data. (C–F) HUVECs were transfected with JAM-C–HRP and on the following day incubated with or without biotin tyramide and hydrogen peroxide in the presence or absence of 50 mM ascorbate. (C) Immunofluorescence analysis of cells labelled for streptavidin (green) and EEA 1 (red). Biotinylated proteins are only present when both hydrogen peroxide and biotin tyramide is present and partially localise with early endosomes. (D–F) Biotinylated proteins were pulled down with streptavidin and analysed by mass spectrometry (n = 4 experiments). (D) An example data set from one mass spectrometry experiment is shown, consisting of duplicate samples with each mass spectrometry run repeated. Proteins near JAM-C appear only in transfected cells. Proteins that appear solely in mock or in mock and JAM-C-HRP–transfected sample represent nonspecific binders. (E) Pie chart showing the number of proteins adjacent to JAM-C at the cell surface and intracellularly. (F) The percentage of protein hits associated with specific cellular locations and processes is plotted. EEA 1, early endosome antigen 1; GFP, green fluorescent protein; HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; SEM, standard error of the mean; WT, wild type.(TIF)Click here for additional data file.
Validation of HRP biotinylation assay by western blot and immunofluorescence analysis.
(A and B) JAM-C-HRPout–transfected cells were fed with biotin tyramide and exposed to hydrogen peroxide in the presence or absence of ascorbate. Biotinylated proteins were pulled down and western-blotted for (A) proteins neighbouring JAM-C at the cell surface: JAM-A or (B) proteins cotrafficked with JAM-C: VE-Cadherin, NRP-1, and NRP-2. Representative blots are shown with quantification of n = 4 experiments, and error bars represent SEM (*p ≤ 0.05, ** p ≤ 0.01; ***p ≤ 0.001, ****p ≤ 0.0001; unpaired t test). (C) Immunofluorescence analysis of endogenous JAM-C (green) and either VE-Cadherin or PECAM-1 (magenta). The boxed region is magnified. VE-Cadherin cotraffics with JAM-C, whilst PECAM-1 does not. Underlying data are found in S8 Data. HRP, horseradish peroxidase; JAM-C, junctional adhesion molecule-C; NRP, neuropilin; PECAM-1, platelet endothelial cell adhesion molecule 1; SEM, standard error of the mean; VE-Cadherin, vascular endothelial cadherin.(TIF)Click here for additional data file.
An HRP-based proximity-labelling approach reveals changes in JAM-C cotrafficking following stimulation with TNF-α.
(A–C) HUVECs were transfected with JAM-C–HRPout and stimulated for 4 h with 50 ng/ml TNF-α. (A) Cells were lysed and analysed by western blot. The level of JAM-C–HRP expression is similar across all transfected samples, and TNF-α stimulation up-regulates the expression of ICAM-1. (B and C) Cells were fed biotin tyramide for 30 min and then exposed to hydrogen peroxide for 1 min in the presence or absence of 50 mM ascorbate. (B) Cells fixed and stained with streptavidin (green), DAPI (blue), and ICAM-1 (grey). Images were acquired by confocal microscopy. Scale bar, 20 μm. (C) Biotinylated proteins were pulled down using neutravidin beads, and pulldown samples were analysed by mass spectrometry. Heat map of 2 independent mass spectrometry data sets is shown with white meaning no signal and dark red a high signal. Each individual experiment was carried out in duplicate, with mass spectrometry runs being repeated twice (to give a total of 4 analyses/experiment). p-Values are given across 2 experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test). Cotrafficked proteins appear in both ± ascorbate conditions, whilst proteins adjacent to JAM-C solely at the cell surface are only present in the −ascorbate condition. (D and E) HUVECs were stimulated for 4 h with TNF-α fixed and labelled for (D) JAM-C (green) and VE-Cadherin (magenta) or (E) JAM-C (green) and PECAM-1 (magenta). JAM-C does not colocalise with VE-Cadherin or PECAM-1. Scale bar, 20 μm. HRP, horseradish peroxidase; HUVEC, human umbilical vein endothelial cell; ICAM, intercellular adhesion molecule; JAM-C, junctional adhesion molecule-C; PECAM-1, platelet endothelial cell adhesion molecule 1; TNF, tumour necrosis factor; VE-Cadherin, vascular endothelial cadherin.(TIF)Click here for additional data file.
Spinning-disk microscopy of WT JAM-C–GFPout traffic.
HUVECs were nucleofected with WT JAM-C–GFPout and imaged with a spinning-disk confocal microscope. Time indicates total time in media and a maximum intensity projection is shown of all z-stacked images. JAM-C exists in vesicles, at the cell surface, and at the cell junctions. Large vesicles can be seen that tubulate and migrate away from the junctional region. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; WT, wild type.(MP4)Click here for additional data file.
Confocal time-lapse microscopy of WT JAM-C–EGFPout in the presence of bafilomycin.
HUVECs were transfected with WT JAM-C–EGFPout and 100 nM bafilomycin was added (at t = 0 min) before imaging by time-lapse confocal microscopy. A maximum intensity projection is shown of all z-stacked images. EGFP, enhanced green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; WT, wild type.(MOV)Click here for additional data file.
Confocal time-lapse microscopy of Quad-K JAM-C–EGFPout in the presence of bafilomycin.
HUVECs were transfected with Quad-K JAM-C–EGFPout and 100 nM bafilomycin was added (at t = 0 min) before imaging by time-lapse confocal microscopy. A maximum intensity projection is shown of all z-stacked images. EGFP, enhanced green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; Quad-K, 4 lysine residues mutated to arginine residues; WT, wild type.(MOV)Click here for additional data file.WT JAM-C–GFPout was expressed in HUVECs, and the cells were allowed to form a confluent monolayer. The cell layer was scratched, and 45 min later, live-cell imaging was carried out with images acquired every 30 s for 45 min. A maximum intensity projection is shown of all z-stacked images; scale bar, 20 μm. GFP, green fluorescent protein; HUVEC, human umbilical vein endothelial cell; JAM-C, junctional adhesion molecule-C; WT, wild type.(AVI)Click here for additional data file.
Mass spectrometry hits from WT JAM-C–HRPout proximity-labelling experiments with and without ascorbate and/or TNF-α.
Mass spectrometry data sets from WT JAM-C–HRPout proximity-labelling experiments with and without 50 mM ascorbate and/or 50 ng/ml TNF-α. Individual experiments were carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 4 analyses/experiment for the untreated sample and 2 analyses/experiment for TNF-α experiments). p-Values are given across all experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test); corrected p-values for multiple comparisons are also given. HRP, horseradish peroxidase; JAM-C, junctional adhesion molecule-C; TNF, tumour necrosis factor; WT, wild type.(XLSX)Click here for additional data file.
Mass spectrometry hits from WT or Quad-K JAM-C–APEX2 proximity-labelling experiments.
Mass spectrometry data sets from WT or Quad-K JAM-C–APEX2 proximity-labelling experiments. Individual experiments were carried out in duplicate, with each mass spectrometry run being repeated twice (to give a total of 3 analyses/experiment for untreated sample). p-Values are given across all experiments (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; t test); corrected p-values for multiple comparisons are also given. APEX-2, ascorbate peroxidase 2; JAM-C, junctional adhesion molecule-C; Quad-K, 4 lysine residues mutated to arginine residues; WT, wild type.(XLSX)Click here for additional data file.
List of all primers used for mutagenesis and infusion cloning.
(DOCX)Click here for additional data file.
List of all antibodies used with supplier.
(DOCX)Click here for additional data file.
Values for each data point to create the graph in Fig 1D.
(XLSX)Click here for additional data file.
Values for each data point to create the graphs in Fig 2.
(XLSX)Click here for additional data file.
Values for each data point to create the graph in Fig 4.
(XLSX)Click here for additional data file.
Values for each data point to create the graphs in Fig 5.
(XLSX)Click here for additional data file.
Values for each data point to create the graphs in Fig 7.
(XLSX)Click here for additional data file.
Values for each data point to create the graphs in Fig 8.
(XLSX)Click here for additional data file.
Values for each data point to create the graph in S1B Fig.
(XLSX)Click here for additional data file.
Values for each data point to create the graphs in S2 Fig.
(XLSX)Click here for additional data file.
Annotated raw images of all blots presented in figures.
(PDF)Click here for additional data file.19 Jul 2019Dear Dr Nightingale,Thank you for submitting your manuscript entitled "Dynamic trafficking and turnover of Jam-C is essential for endothelial cell migration" for consideration as a Research Article by PLOS Biology.Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.**Important**: Please also see below for further information regarding completing the MDAR reporting checklist. The checklist can be accessed here: https://plos.io/MDARChecklistPlease re-submit your manuscript and the checklist, within two working days, i.e. by Jul 21 2019 11:59PM.Login to Editorial Manager here: https://www.editorialmanager.com/pbiologyDuring resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.Kind regards,Di JiangPLOS Biology==================INFORMATION REGARDING THE REPORTING CHECKLIST:PLOS Biology is pleased to support the "minimum reporting standards in the life sciences" initiative (https://osf.io/preprints/metaarxiv/9sm4x/). This effort brings together a number of leading journals and reproducibility experts to develop minimum expectations for reporting information about Materials (including data and code), Design, Analysis and Reporting (MDAR) in published papers. We believe broad alignment on these standards will be to the benefit of authors, reviewers, journals and the wider research community and will help drive better practise in publishing reproducible research.We are therefore participating in a community pilot involving a small number of life science journals to test the MDAR checklist. The checklist is intended to help authors, reviewers and editors adopt and implement the minimum reporting framework.IMPORTANT: We have chosen your manuscript to participate in this trial. The relevant documents can be located here:MDAR reporting checklist (to be filled in by you): https://plos.io/MDARChecklist**We strongly encourage you to complete the MDAR reporting checklist and return it to us with your full submission, as described above. We would also be very grateful if you could complete this author survey:https://forms.gle/seEgCrDtM6GLKFGQAAdditional background information:Interpreting the MDAR Framework: https://plos.io/MDARFrameworkPlease note that your completed checklist and survey will be shared with the minimum reporting standards working group. However, the working group will not be provided with access to the manuscript or any other confidential information including author identities, manuscript titles or abstracts. Feedback from this process will be used to consider next steps, which might include revisions to the content of the checklist. Data and materials from this initial trial will be publicly shared in September 2019. Data will only be provided in aggregate form and will not be parsed by individual article or by journal, so as to respect the confidentiality of responses.Please treat the checklist and elaboration as confidential as public release is planned for September 2019.We would be grateful for any feedback you may have.19 Aug 2019Dear Dr Nightingale,Thank you very much for submitting your manuscript "Dynamic trafficking and turnover of Jam-C is essential for endothelial cell migration" for consideration as a Research Article at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by three independent reviewers.In light of the reviews (below), we will not be able to accept the current version of the manuscript, but we would welcome resubmission of a revised version that addresses the reviewers' comments. Our Academic Editor indicates that the comments of the reviewers are of high quality and are very reasonable because they mostly request better description of the tools and data already presented in the manuscript. S/he advises that you address experimentally comment 1 of reviewer 1 on characterizing better your fusion construct, and all the comments of the reviewers that request clarifications, quantifications, explanations of control experiments or better discussion/wording. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.Your revisions should address the specific points made by each reviewer. Please submit a file detailing your responses to the editorial requests and a point-by-point response to all of the reviewers' comments that indicates the changes you have made to the manuscript. In addition to a clean copy of the manuscript, please upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type. You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.Before you revise your manuscript, please review the following PLOS policy and formatting requirements checklist PDF: http://journals.plos.org/plosbiology/s/file?id=9411/plos-biology-formatting-checklist.pdf. It is helpful if you format your revision according to our requirements - should your paper subsequently be accepted, this will save time at the acceptance stage.Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements.Upon resubmission, the editors will assess your revision and if the editors and Academic Editor feel that the revised manuscript remains appropriate for the journal, we will send the manuscript for re-review. We aim to consult the same Academic Editor and reviewers for revised manuscripts but may consult others if needed.We expect to receive your revised manuscript within two months. Please email us (plosbiology@plos.org) to discuss this if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not wish to submit a revision and instead wish to pursue publication elsewhere, so that we may end consideration of the manuscript at PLOS Biology.When you are ready to submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Di Jiang, PhDAssociate EditorPLOS Biology*****************************************************Reviewer remarks:Reviewer #1: Kostelnik, et al. present interesting data that JAM-C is internalized in a ubiquitin-dependent manner along with molecules regulating permeability such as VE-cadherin and NRP1 and NRP2, but not with molecules regulating leukocyte transmigration such as PECAM-1, CD99, and JAM-A, and under conditions in which endothelial cells move, this internalization is critical for movement by reducing the amount of JAM-C in the lateral junctions to allow adjacent endothelial cells (EC) to break their bonds and slide past each other. They use a clever technique to label membrane molecules neighboring JAM-C and distinguish those on the surface from those internalized. The data are for the most part convincing. However, I have some reservations regarding the central interpretation that should be reconciled prior to publication.MAJOR COMMENTSThe major issue is that the authors assume that the pathway taken by JAM-C-HRPout is the same as taken for native JAM-C. Their justification for this is, “Tagging of Jam-C at this point has previously been shown to have no effect on ligand binding or localisation.” They refer to a previous paper (Mol Biol Cell 16, 4992-5003, 2005) in which they show that placing eGFP—a molecule of approximately the same size as HRP--in that position still allows JAM-C to localize to the junctions appropriately when transfected into MDCK cells or CHO fibroblasts. However, they never studied turnover of the construct. JAM-C has an apparent Mr of 29 - 45 kD depending on the report. HRP has an Mr of 44 kD. It is quite possible that placing a molecule the size of JAM-C or larger into the JAM-C extracellular domain would affect its turnover and its ability to recycle. This raises the question of whether they are studying the natural trafficking pathway of JAM-C or the degradation pathway of a distorted molecule. The half-life of JAM-C-GFPout seems to be about 12 hours in Fig. 4D, which is rather short for a membrane glycoprotein, particularly a member of the Ig superfamily, which in a recent study was found to have a median half-life of 20 hours (Chem. Sci., 2017, 8, 268). To be certain that their constructs are following the normal turnover pathways, they need to compare the turnover of JAM-C-HRPout with that of native JAM-C in the same experiment. They could do this using the same procedure as in Fig. 4, or more accurately using metabolically labeled then “chased” molecules followed by immunoprecipitation and western blot. If the turnover of JAM-C-HRPout is considerably faster than that of native JAM-C, the observations that JAM-C is internalized with a subset of surface interacting proteins and that enhanced degradation of JAM-C facilitates cell migration are still interesting observations worthy of publication, but the interpretation of the data will need to be changed.Fig. 2 The antibody against JAM-C used in A-C is a polyclonal antibody, which can cross-link JAM-C and increase its rate of internalization. What happens if a monoclonal antibody is used?Fig. 3E. What is “mock” conditions? I can’t find this explained anywhere. Why is so much material pulled down under “mock” conditions in E but not seen in the corresponding proteomic experiments in 3F?Figs. 5, 6, 7 Considering that ubiquitylation of membrane proteins is a well-known and accepted mechanism for targeting them for degradation, the data of these figures does not seem very surprising or significant compared to the proteomic data of Fig 3. The E3 ligase for JAM-C was not previously known, but it is not surprising that one exists. The authors could consider shortening this part of the manuscript or relegating it to Supplementary Materials and focus on the significance of their primary observation and the experiment of Figure 8.Fig. 8 shows that inhibition of ubiquitination and turnover of JAM-C blocks migration. The authors propose that this is due to more JAM-C at the junctions. Previous figures show that blocking ubiquitylation of JAM-C increases JAM-C-GFPout levels and decreases the number of fluorescent vesicles, but the intensity of JAM-C at the junctions does not appear to be different. Can the authors quantify junctional JAM-C?Fig. 9 The video provided does not make a good case that internalization of JAM-C-GFPout is at the sides of the cells as opposed to at the front of the migrating cell.MINOR COMMENTSAlmost none of the western blots have molecular size labels. They should.Fig. 1 Were the cells permeabilized to be able to see punctae?Line 297 TNFa is a known permeability agent; IL-1b is not. Therefore, instead of being stimulus specific, a more circumspect interpretation would be that this change is seen with treatments that reduce barrier function.It is a bit disingenuous in the schematic diagrams in multiple figures to represent the HRP and GFP as small circles compared to the large JAM-C sausage, when in fact HRP and GFP are about the same size or larger than the JAM-C extracellular domains. They should be drawn to scale.I am curious why the manuscript refers to the molecule as “Jam-C” when the rest of the literature as well as Dr. Aurrand-Lions, one of the pioneers of this molecule, calls it “JAM-C”.Summary: This is an interesting manuscript. The authors should perform the experiments suggested above, which should not be difficult in order to better understand the phenomena they are studying. The statistics appear to be adequate and supplemental data are appropriate. The manuscript is generally well-written, but quite a few experimental details are missing from the Methods and figure legends. This should be reviewed carefully when revising.Reviewer #2: This manuscript reports about recycling mechanisms of the adhesion molecule JAM-C in endothelial cells. It is shown that JAM-C is constitutively endocytosed and recruited to multi-vesicular bodies leading to its degradation. Internalization is boosted by junctional disassembly and the cytokine TNF-�. A method of proximity biotinylation based on integrating HRP into the JAM-C protein was used to identify candidate proteins by proteomics, which might be within a 20 nm distance to JAM-C on the cell surface and in endocytic vesicles. A group of such candidates were found within the vicinity of JAM-C in both locations, possibly trafficking parallel with JAM-C, others were only in the vicinity of JAM-C at the cell surface. A lysine residue was reported to be involved in JAM-C turn over. Mutating all four lysine residues in the cytoplasmic domain blocked its ubiquitylation as well as its targeting to multi-vesicular bodies. Another approach to biotinylate proteins within the cytoplasmic tail of JAM-C was based on inserting APEX-2 into the cytoplasmic tail. Combining this with the mutation of the four lysine residues allowed to identify the E3 ligase Cbl as candidate of a protein adjacent to JAM-C during trafficking. Silencing of Cbl inhibited ubiquitylation of JAM-C and increased its level in endothelial cells, however, did not affect its levels at cell contacts. Finally, mutating the four lysine residues in JAM-C impaired recovery in scratch wound assays of endothelial monolayers.The study is interesting and establishes a role for JAM-C ubiquitylation for its targeting to the degradation pathway which seems to be relevant for mechanisms by which JAM-C influences endothelial cell contacts and or endothelial cell migration. The results presented in this paper are likely to contribute to the understanding of the role of JAM-C in angiogenesis and possibly other functions of JAM-C. The paper falls short of explaining how impairment of targeting JAM-C to the degradation pathway might influence cell migration. While this may be asked too much, some other aspects need to be improved.1) The HRP based proximity labeling assay was used in combination with streptavidin/biotin based pull down experiments and proteomics analysis to identify a series of proteins which are candidates for close neighbors within the vicinity of JAM-C. Verification of these candidates was attempted, but the results in supplementary figure 2 are not convincing. The proteomics results suggest that biotinylation of VE-cadherin, NRP-1 and NRP-2, triggered by JAM-C-HRP, is not completely killed by ascorbate, thus it occurs at the cell surface and in intracellular vesicles. This is indeed verified in suppl. figure 2B. However, the proteomics data suggest, that biotinylation of PECAM-1 and CD99 was not seen at all and for JAM-A there was a weak signal without ascorbate and no signal with ascorbate. The note “bands not visible due to low antibody sensitivity” as stated within the figure is not convincing. As it stands right now, no statement can be made about PECAM-1 and CD99 (they can even not be considered as confirmed candidates for proteins in the vicinity of JAM-C) and for JAM-A the overall signal (outside plus inside the cell) is so weak that a comparison between outside and inside (with and without ascorbate) cannot be made. The results shown in suppl. figure 2A have to be done in a more sensitive way to obtain convincing and meaningful results.2) For several experiments “mock” conditions were shown, but it was not stated what these negative control conditions were. For example, Fig. 3E and 3F, does mock mean a mock transfection with a JAM-C without HRP? Same for Fig. 6C and 6E. What about suppl fig. 2A and B, does “mock” mean no hydrogenperoxide, or no JAM-C-HRP or no biotinylation reagent?3) Silencing of JAM-C did not lead to enhanced expression levels of JAM-C at cell contacts (Fig. 7F). Why then do the authors discuss that “the change in receptor recycling could prematurely increase the strength of homo and heterotypic junctional interactions with neighboring cells preventing cell movement” (bottom of page 17)? This argument should probably be omitted. Furthermore, the cartoon in figure 9B also seems to suggest that inhibition of JAM-C ubiquitylation would lead to more JAM-C at cell contacts, but this is not observed in reality (Fig. 7F). Therefore, the cartoon should be omitted or redrawn in a way, that is not in conflict with the results of figure 7F. Furthermore, the discussion should mention that lack of JAM-C ubiquitylation might affect cell migration by affecting integrins. In the light of their results showing co-trafficking of integrins with JAM-C and in the light of publications analyzing possible interactions between JAM-C and integrins (such as reference 13 and 48), these are obvious possibilities.Reviewer #3: With pleasure I have read the manuscript of Kostelnik et al describing a role for Jam-C protein trafficking in endothelial cell migration. The authors have performed imaging based analysis of Jam-C dynamics as well as elegant proteomic approaches to discern Jam-C function at the cell’s surface or once internalized. This has lead to the finding that Jam-C is ubiquitinated by CBL and that proper degradation of internalized Jam-C is needed for endothelial migration in scratch wound assays. In addition, the trafficking of Jam-C seems to occur in distinct vesicles compared to some of the other well-known endothelial receptors of the lateral recycling compartment. Which reveals an alternative mode of junction regulation Jam-C (and co-trafficking VE-cadherin). Overall the experiments have been well controlled and represent exciting new findings that are of importance for the field and would fit well within the scope of Plos Biology. I have a few concerns, which I encourage the authors to address.• The authors conclude that Jam-C recycling is important, however there is no direct evidence to suggest that this is the case. Instead all experiments have been focused on internalization, ubiquitination and proteosomal degradation. Therefore statements along those lines should be avoided. Or the authors have to try to proof that Jam-C is recycled toward the plasma membrane and that this is the mechanism how Jam-C promote scratch wound migration.• Figure 7: Is internalization of endogenous Jam-C affected by CBL? Pulse chase experiments with the anti-Jam-C antibody should be compared in control and siRNA treated HUVECs. Is the quad-K mutant of Jam-C able to rescue migration defects in CBL knockdown cells?• Please confirm that the Quad lysine mutated Jam-C variant is not ubiquitinated anymore by CBL.• Figure 9 and text page 15: “We noted large Jam-C positive vesicles forming at junctional sites on either side of the cell’s leading edge”. Although the data in this figure indeed indicate that Jam-C is internalized in leader cells in the scratch assay, there is no comparison made with follower cells or cells in non-migrating endothelial cells to be able to determine whether Jam-C internalization is specific for, or enriched at the leading edge.• Does mutating the lysines in Jam-C tail affect only intracellular trafficking or also overall surface levels of Jam-C? Please analyse the amount of Jam-C surface levels of the wild type protein versus the Quad-K mutant.• The authors claim to have shown a new trafficking machinery in control of Jam-C. Although the mass spectrometry results indeed have identified many proteins to be in the vicinity of Jam-C, the study continues only with knockdown studies with CBL. It is more appropriate to mention that CBL-mediated ubiquitination controls Jam-C. Unless the authors can show that other identified trafficking regulators are functionally involved in controlling trafficking of Jam-C.Minor Comments• Figure 2A, B: is the antibody used to determine kinetics of Jam-C internalization not interfering with the function of Jam-C? Analysis of VE-cadherin stainings and scratch wound migration the presence of the antibody should be provided to confirm that the analysis based on this antibody closely resembles trafficking of the endogenous Jam-C protein.• Figure 2E: Is the observed increased number of Jam-C positive vesicles upon TNF treatment due to decreased proteosomal degradation or due to increased internalization of Jam-C from the plasma membrane?• Figure 2G: The authors conclude that TNFa enhances internalization of Jam-C in Fig 2D. What happens to the dynamics of Jam-C-GFP after treatment with TNFa, are more membraneous structures observed under those conditions and does that explain the increased number of Jam-C vesicles?• In the text there is a big emphasis on the role of Jam-C in leukocyte transmigration. However, the data presented are regarding the dynamics of Jam-C in normal endothelial monolayers, scratch assays or TNF-treated endothelium. I recommend to either prove that CBL-mediated Jam-C protein trafficking is involved in transmigration of leukocytes across endothelium or to change the focus of the manuscript to better reflect the current results.• The presentation of immunofluorescence images would benefit from higher intensities (i.e. Figure 1B,C;2C; 7F.• I encourage the authors to improve the presentation of the figures by marking performed immuno-stainings in the figure itself rather than in the figure legends only.• Figure 2B; how was the junctional area defined to be able to quantify whether Jam-C intensity levels?• What happens to VE-cadherin trafficking, which is also internalized through a similar mode of tubular endocytosis from remodeling junctions, once the lysines in Jam-C are mutated and preventing its proteosomal degradation. Does the trafficking of other receptors remain unaffected or is their a co-dependent mode of internalization and endocytosis?18 Oct 2019Submitted filename: Response to Reviewers.docxClick here for additional data file.29 Oct 2019Dear Dr Nightingale,Thank you for submitting your revised Research Article entitled "Dynamic trafficking and turnover of JAM-C is essential for endothelial cell migration" for publication in PLOS Biology. I have now obtained advice from the academic editor who has assessed your revision.Based on our academic editor's evaluation, we're delighted to let you know that we're now editorially satisfied with your manuscript. However before we can formally accept your paper and consider it "in press", we also need to ensure that your article conforms to our guidelines; two of which are described below under DATA POLICY and are marked with "***IMPORTANCE: ". A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication.Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.Please note that you have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. Our academic editor felt that your rebuttal was very nice and useful to readers and that the paper would benefit from having it published along with the reviews. We would like to encourage you to opt in.Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include a cover letter, a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable), and a track-changes file indicating any changes that you have made to the manuscript.Please do not hesitate to contact me should you have any questions.Sincerely,Di Jiang, PhDAssociate EditorPLOS Biology------------------------------------------------------------------------ETHICS STATEMENT:You may remove the current Ethics Statement (copied below) from the submission form."No human participants, specimens or tissue samples, or vertebrate animals, embryos or tissues were used as part of this study."------------------------------------------------------------------------DATA POLICY:You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.***IMPORTANCE: Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels: 1D, 2BCE, 3F, 4D, 5DE, 6E, 7CDEG, 8BC, S1BDF, S2AB, S3C, as they are essential for readers to assess your analysis and to reproduce it. ***IMPORTANCE: Please also ensure that figure legends in your manuscript include information on where the underlying data can be found. You may say in the relevant figure legends: e.g., "Underlying data are found in S1 Data.".Please ensure that your Data Statement in the submission system accurately describes where your data can be found.------------------------------------------------------------------------BLOT AND GEL REPORTING REQUIREMENTS:For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements.__________________________________________________In compliance with data protection regulations, you may request that we remove your personal registration details at any time. (Use the following URL: https://www.editorialmanager.com/pbiology/login.asp?a=r). Please contact the publication office if you have any questions.12 Nov 2019Submitted filename: Response to Reviewers.docxClick here for additional data file.14 Nov 2019Dear Dr Nightingale,On behalf of my colleagues and the Academic Editor, Anna Akhmanova, I am pleased to inform you that we will be delighted to publish your Research Article in PLOS Biology.The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle these stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication.Early VersionThe version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.PRESSWe frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.Kind regards,Hannah HarwoodPublication Assistant,PLOS Biologyon behalf ofDi Jiang,Associate EditorPLOS Biology
Authors: B A Imhof; C Zimmerli; G Gliki; D Ducrest-Gay; P Juillard; P Hammel; R Adams; M Aurrand-Lions Journal: J Pathol Date: 2007-06 Impact factor: 7.996
Authors: Hyun-Woo Rhee; Peng Zou; Namrata D Udeshi; Jeffrey D Martell; Vamsi K Mootha; Steven A Carr; Alice Y Ting Journal: Science Date: 2013-01-31 Impact factor: 47.728
Authors: Anna Salikhova; Ling Wang; Anthony A Lanahan; Miaoliang Liu; Michael Simons; William P J Leenders; Debabrata Mukhopadhyay; Arie Horowitz Journal: Circ Res Date: 2008-08-21 Impact factor: 17.367
Authors: Xiaochun Li; Milena Stankovic; Boris P-L Lee; Michel Aurrand-Lions; Chris N Hahn; Ying Lu; Beat A Imhof; Mathew A Vadas; Jennifer R Gamble Journal: Arterioscler Thromb Vasc Biol Date: 2009-05-21 Impact factor: 8.311
Authors: Paul F Bradfield; Arjun Menon; Marijana Miljkovic-Licina; Boris P Lee; Nicolas Fischer; Richard J Fish; Brenda Kwak; Edward A Fisher; Beat A Imhof Journal: PLoS One Date: 2016-07-21 Impact factor: 3.240
Authors: Giulia De Rossi; Maria Vähätupa; Enrico Cristante; Samantha Arokiasamy; Sidath E Liyanage; Ulrike May; Laura Pellinen; Hannele Uusitalo-Järvinen; James W Bainbridge; Tero A H Järvinen; James R Whiteford Journal: Arterioscler Thromb Vasc Biol Date: 2021-02-18 Impact factor: 10.514