Qingchun Zhou1,2, Juan Yu3, Qingyou Zheng2, Tao Wu2, Ziliang Ji2, Yumin Zhuo1. 1. Department of Urology, First Affiliated Hospital, Jinan University, Guangzhou City, China. 2. Department of Urology, Shenzhen Hospital, Southern Medical University, Shenzhen City, China. 3. Department of Medical Imaging, Shenzhen Second People's Hospital, The First Affiliated Hospital of Shenzhen University, China.
Abstract
Bladder cancer is one of the most common malignant tumors of the urinary system, with high morbidity and mortality. At present, the survival rates and prognosis of patients with bladder cancer are still relatively low; thus, there remains a need to improve prognosis by identifying novel targets. Kinesins (kinesin superfamily proteins) are a series of microtubule-based motor proteins that mediate various types of cellular processes. Kinesin family member 3A (KIF3A) is critical for cytoplasm separation in mitosis, and it has been reported to be misexpressed in multiple types of cancer. However, its effects on the progression and development of bladder cancer remain unclear. Herein, we report that KIF3A is highly expressed in human bladder cancer. We identified a significant correlation between KIF3A and clinical features, including clinical stage (P = 0.047), pathological tumor status (P = 0.045), lymph node status (P = 0.041) and metastasis (P = 0.035). KIF3A expression was also correlated with poor prognosis of patients with bladder cancer. Our results further indicated that KIF3A ablation resulted in cell cycle arrest; blocked the proliferation, migration and invasion of bladder cancer cells in vitro; and restrained tumor growth in mice in a microtubule-dependent manner. In summary, our findings suggest that KIF3A is a potential therapeutic target for bladder cancer.
Bladder cancer is one of the most common malignant tumors of the urinary system, with high morbidity and mortality. At present, the survival rates and prognosis of patients with bladder cancer are still relatively low; thus, there remains a need to improve prognosis by identifying novel targets. Kinesins (kinesin superfamily proteins) are a series of microtubule-based motor proteins that mediate various types of cellular processes. Kinesin family member 3A (KIF3A) is critical for cytoplasm separation in mitosis, and it has been reported to be misexpressed in multiple types of cancer. However, its effects on the progression and development of bladder cancer remain unclear. Herein, we report that KIF3A is highly expressed in human bladder cancer. We identified a significant correlation between KIF3A and clinical features, including clinical stage (P = 0.047), pathological tumor status (P = 0.045), lymph node status (P = 0.041) and metastasis (P = 0.035). KIF3A expression was also correlated with poor prognosis of patients with bladder cancer. Our results further indicated that KIF3A ablation resulted in cell cycle arrest; blocked the proliferation, migration and invasion of bladder cancer cells in vitro; and restrained tumor growth in mice in a microtubule-dependent manner. In summary, our findings suggest that KIF3A is a potential therapeutic target for bladder cancer.
Cell Counting Kit‐8extracellular signal‐regulated kinaseglyceraldehyde‐3 phosphate dehydrogenaseimmunohistochemistrykinesin family member 3Aparaformaldehydequantitative PCROriginating from the bladder epithelial cells, bladder cancer is one of the most common malignant tumors of the urinary system with high morbidity and mortality, ranking ninth in the world 1, 2. Bladder cancer is more common in male patients and older adults according to epidemiological data 3. Surgical resection, chemoradiotherapy and combined therapy are traditional clinical treatment methods 4, 5; however, because of the lack of obvious symptoms at early stage and the limited effective treatments for advanced bladder cancer, survival rates and prognosis of patients with bladder cancer are still low 6, 7. Recently, targeted therapy involving bladder cancer showed promising results. Targeted drugs, such as nivolumab and atezolizumab, were currently tested in clinical trials 8, 9, 10. It is urgent to explore novel targets to improve the prognosis.Kinesins (kinesin superfamily proteins) are a family of microtubule‐based motor proteins that contain more than 15 members 11. Kinesins mediate various types of cellular processes, such as ciliogenesis, cell migration, division and vesicle transport 12, 13. Recently, potential effects of kinesins on cancer progression have been widely reported 14. Kinesin family member 3A (KIF3A) is critical in the process of cytoplasm separation in mitosis 15. Previous studies indicated the involvement of KIF3A in the spermatogenesis 16, as well as in the regulation of brain development. The KIF3A mutation also led to the pediatric asthma and neoplastic renal lesions and neoplastic renal lesions 17.In the past few decades, the role of KIF3A in cancer progression has been widely studied 18. KIF3A was abnormally expressed in multiple types of tumor tissues 18, 19, 20. Abnormal KIF3A level was thought as a potential biomarker for the early‐stage diagnosis and prognosis of breast cancer 18. KIF3A also promoted the proliferation and invasion of prostate cancer cells targeting Wnt signaling pathways 19. In addition, KIF3A mRNA level was associated with overall survival times of patients with hepatocellular carcinoma 21. Although KIF3A has been reported to be involved in the development of multiple types of tumors, its potential role in bladder cancer remains unclear.Given the high metastasis and mortality of bladder cancer, here we declared the involvement of KIF3A in the progression of bladder cancer with the aim to clarify the effects and underlying molecular mechanisms of KIF3A‐mediated cellular events in vitro and in vivo, providing insights into whether KIF3A could serve as a promising therapeutic target for the treatment of bladder cancer from bench to clinic.
Materials and methods
Antibodies, plasmids and primers
We used the following antibodies in our research: rabbit anti‐KIF3A Ig [1 : 500 dilution for immunohistochemistry (IHC) assays; 1 : 2000 dilution for immunoblot assays, ab11259; Abcam, Cambridge, UK], mice anti‐β‐actin Ig (1 : 2000 dilution, ab8227; Abcam), rabbit anti‐Ki67 Ig (1 : 2000 dilution, ab16667; Abcam), rabbit anti‐matrix metalloproteinase 2 (MMP2) Ig (1 : 1000 dilution, ab37150; Abcam) and rabbit anti‐MMP9 Ig (1 : 2000 dilution, ab38898; Abcam).Primer sequences of quantitative PCR (qPCR) were designed as follows: KIF3A_F: 5′‐ATAGTTCCCGTTCCCATG‐3′, KIF3A_R: 5′‐CTGACCCACTGA TATCAGAG‐3′; GAPDH_F (glyceraldehyde‐3 phosphate dehydrogenase forward): 5′‐CGACCACTTTGTCAAGCTCA‐3′, GAPDH_R: 5′‐GGTTGAGCACAGGGTACTTTATT‐3′. shRNA plasmids [ready‐to‐package adenoassociated virus (AAV)] of KIF3A were purchased from Addgene (Cambridge, MA, USA).
Immunohistochemistry
Tumor tissues were obtained from First Affiliated Hospital, Jinan University and preserved in formalin before analysis. The study methodologies conformed to the standards set by the Declaration of Helsinki and were approved by the local ethics committee. Written informed consent was obtained from a legally authorized representative(s) for anonymized patient information to be published in this article. To further explore the expression levels of KIF3A in human tumor tissues of bladder cancer, we performed IHC assays. In brief, all sections were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature and subsequently blocked with 2% BSA for 20 min. Slides were subsequently incubated with KIF3A or Ki67 antibodies for 2 h at room temperature and then incubated with biotinylated secondary antibodies for 1.5 h at room temperature. Diaminobenzidine was used as a chromogen substrate.We then scored the proportion of positive staining cells as follows: the percentage of bladder cancer cells was less than 10%, scored 0; the percentage of positive tumor cells occupies 10–40%, scored 1; the positive percentage of tumor cells was between 40% and 70%, scored 2; and the percentage was more than 70%, scored 3. Meanwhile, the staining intensity was assessed 0 for negative staining, 1 for relative low staining, 2 for moderate staining, and 3 for strong staining. High KIF3A level (3–6) or low level (0–3) was determined according to the positive cell percentage score plus staining intensity score. Tissue sections were detected within four visual fields, and the staining results were judged by double‐blind method.
Cell culture and transfection
Human bladder cancer T24 and 5637 cell lines were bought from ATCC (Rockefeller, MD, USA) and maintained in RPMI 1640 culture medium, supplemented with 10% of FBS at 37 °C in a 5% CO2 incubator.shRNA plasmids were transfected into bladder cancer cells using Lipofectamine 2000 (11668019; Invitrogen, Carlsbad, CA, USA). Stable knockdown cell clones were screened by lentivirus infection.
qPCR assay
TRIzol (15596026; Invitrogen) agent was used to extract total mRNA from human bladder cancer cells or tissues. mRNA was then reverse transcribed to produce cDNA by synthesis system (M1701; Promega, Madison, WI, USA). qPCR was performed using SYBR Ex Taq kit (638319; Takara, Osaka city, Osaka prefecture, Japan), and KIF3A levels were normalized to endogenous GAPDH level.
Immunoblot assays
Cells were first lysed by RIPA cell lysis buffer (R0278; Sigma‐Aldrich, St. Louis, MO, USA). Protein samples were isolated by SDS/PAGE and then transferred onto polyvinylidene fluoride membranes. Membranes were blocked with 5% fat‐free milk in Tris‐buffered saline with Tween 20 and incubated with the primary antibodies for the detection of KIF3A, Ki67, MMP2, MMP9 and β‐actin at room temperature for 2 h. Then polyvinylidene fluoride membranes were washed with Tris‐buffered saline with Tween 20 four times and incubated with HRP‐conjugated secondary antibodies for 45 min. After washing, signals were detected using an enhanced chemiluminescence kit.
Colony formation assay
A total of 104 cells were seeded into a six‐well culture plate and transfected with shRNA plasmids 24 h postseeding. After maintaining for 2 weeks, cells were fixed with 4% PFA for 20 min at room temperature, stained with 0.2% crystal violet buffer for 30 min, and washed with PBS twice. Then the colony was photographed and the numbers were manually counted.
Cell Counting Kit‐8 assay
Bladder cancer cells were first seeded into 96‐well plates, transfected with control or KIF3A shRNA plasmids, and maintained for 48 h. Bladder cancer cells were then incubated with Cell Counting Kit‐8 (CCK‐8) agent for 3 h, and the A value was measured respectively using a microplate reader at 490 nm wavelength.
Wound healing assay
Both T24 and 5637 cells were transfected with KIF3A or control shRNA plasmids and maintained for 48 h. A mechanical wound was generated using a 20‐μL pipette tip. Subsequently, cancer cells were washed with PBS to remove debris, and the complete culture medium was added to stimulate wound healing. Photographs were respectively taken at 0 and 24 h postscratch, and the relative extent of wound healing was calculated.
Transwell assay
The procedure for Transwell assay referred to previous studies 22. In brief, bladder cancer cells were transfected with control or KIF3A shRNA plasmids for 48 h and resuspended in serum‐free RPMI 1640 culture medium. The upper chambers of filters (8.0‐µm membrane pores) contained 20% Matrigel (in RPMI 1640 medium) and were incubated at 37 °C for 30 min. Approximately 105 cells in 200 µL of medium were then seeded into the upper chambers of the inserts and induced to migrate toward the bottom chambers containing complete medium. Twenty‐four hours postseeding, cells in the top chamber were removed using cotton swabs, and the remaining cells were fixed in 4% PFA at room temperature for 20 min and stained with 0.2% crystal violet buffer for 30 min. Cell number was manually counted.
Immunofluorescence staining
Cells were fixed in 4% PFA and washed with PBS containing 0.1% (v/v) Triton X‐100 solution. Then, the cells were incubated in 2% BSA in PBS. Subsequently, cells were stained using mouse anti‐α‐tubulin Ig (1 : 500 dilution; Abcam, Cambridge, UK). Then, secondary antibody conjugated with Alexa 488 (Molecular Probes, Life Technologies Japan, Tokyo, Japan) was applied for staining. The cells were counterstained with 4′6‐diamidino‐2‐phenylindole. After washing, digital images were acquired using fluorescence microscopy (DP72; Olympus, Tokyo, Japan).
Tumor growth assay
The procedure for the Transwell assay referred to previous studies 23. All animal assay processes in this study were approved by our Institutional Animal Care and Use Committee. T24 cells were infected with control or KIF3A shRNA lentivirus to generate stable cell lines. Approximately 5 × 105 control or KIF3A‐depleted T24 cells were subcutaneously implanted into athymic nude mice to induce tumor formation. Six mice were used for each group. Two weeks postimplantation, mouse weights were measured, tumors were isolated every 5 days, and the volume of each tumor was measured. Thirty days postimplantation, all tumors were isolated from mice.
Statistics
graphpad 6.0 (Graphpad Software, San Diego, CA, USA) was used for statistical analysis in this study. Three replicates were done for each experiment. All data were represented as mean ± SEM. In addition, the correlation between clinical results and KIF3A protein expression was calculated using Fisher’s exact test and χ2 analysis. Kaplan‐Meier analysis was performed to evaluate the prognosis. Student’s t‐test was used for statistical comparisons. Difference <0.05 was considered statistically significant in this study.
Results
KIF3A expression in human bladder cancer tissues
To evaluate the potential effects of KIF3A on bladder cancer progression, we assessed the KIF3A expression levels between tumor tissues and the adjacent normal tissues. The KIF3A levels of 50 patients who underwent surgical resection were first detected through qPCR assays. Interestingly, mRNA levels of KIF3A in tumor tissues were obviously higher compared with that in adjacent nontumor tissues (Fig. 1A). Using IHC assays, we further confirmed that the protein levels of KIF3A were significantly increased compared with that in normal tissues (Fig. 1B), suggesting abnormal expression of KIF3A in human bladder cancer tissues.
Figure 1
KIF3A expression in human bladder cancer tissues, and its correlation with prognosis of patients. (A) qPCR assays revealed the obviously increased mRNA levels of KIF3A in human bladder cancer tissues. (B) Immunohistochemical assays were performed, and the representative photographs of KIF3A expression in bladder tumor tissues and the adjacent normal tissues were shown (original magnification ×100 and ×200, respectively). Scale bars indicate 100 or 50 μm. (C) The KM‐Plot analysis of overall survival rate between KIF3A low‐ and high‐expression groups was exhibited (the correlation between overall survival rate and KIF3A expression was calculated using Fisher’s exact test, n = 50, mean ± SEM, **P < 0.01).
KIF3A expression in human bladder cancer tissues, and its correlation with prognosis of patients. (A) qPCR assays revealed the obviously increased mRNA levels of KIF3A in human bladder cancer tissues. (B) Immunohistochemical assays were performed, and the representative photographs of KIF3A expression in bladder tumor tissues and the adjacent normal tissues were shown (original magnification ×100 and ×200, respectively). Scale bars indicate 100 or 50 μm. (C) The KM‐Plot analysis of overall survival rate between KIF3A low‐ and high‐expression groups was exhibited (the correlation between overall survival rate and KIF3A expression was calculated using Fisher’s exact test, n = 50, mean ± SEM, **P < 0.01).
Correlation between KIF3A expression and clinical characteristics, as well as the prognosis of patients with bladder cancer
Furthermore, a total of 50 bladder cancer tissue samples from patients who received surgical resections were manually divided into low and high KIF3A expression groups (Table 1). Notably, we discovered that 25 patients (50%) exhibited low KIF3A expression, whereas 25 (50%) exhibited high KIF3A level (Table 1).
Table 1
Relationship between KIF3A mRNA and clinicopathological parameters.
Parameters
No. of patients
KIF3A mRNA expression (n)
P value
Low (< median)
High (≥ median)
n
50
25
25
Age (years)
≥ Mean (60)
23
12
11
0.777
< Mean (60)
27
13
14
Sex
Male
33
15
18
0.370
Female
17
10
7
Tumor size (mm)
0–2
16
10
6
0.311
2–5
22
11
11
>5
12
4
8
Tumor differentiation
Well
9
6
3
0.489
Moderate
31
15
16
Poor
10
4
6
Clinical stage
I–II
27
17
10
0.047*
III–IV
23
8
15
Pathological tumor status
T1–T2
29
18
11
0.045*
T3–T4
21
7
14
Lymph node status
N0
31
19
12
0.041*
N1
19
6
13
Distant metastasis
M0
35
21
14
0.031*
M1
15
4
11
Vascular invasion
Absent
33
16
17
0.765
Present
17
9
8
P < 0.05.
Relationship between KIF3A mRNA and clinicopathological parameters.P < 0.05.We then investigated the clinical pathological significance between KIF3A expression levels and clinical features in bladder cancer. In brief, patient age, sex, tumor size, differentiation, clinical stage, pathological tumor status, lymph node status, metastasis and vascular invasion were assessed. No significant clinical correlations were found, including patient age (P = 0.777), sex (P = 0.370), tumor size (P = 0.311), differentiation (P = 0.489) and vascular invasion (P = 0.765), between low‐ and high‐expression KIF3A groups (Table 1). However, the analysis revealed that KIF3A expression was significantly correlated with clinical stage (P = 0.047), pathological tumor status (P = 0.045), lymph node status (P = 0.041) and metastasis (P = 0.035) in patients with bladder cancer (Table 1), demonstrating that KIF3A expression levels were positively correlated with clinical pathological stages. Furthermore, through Kaplan Meier‐plotter analysis, we discovered patients with lower KIF3A expression exhibited higher overall survival rate (Fig. 1C), suggesting KIF3A level was associated with the poor prognosis.
KIF3A promotes the proliferation of bladder cancer cells in vitro
To explore the mechanism underlying KIF3A‐mediated clinical characteristics and prognosis of bladder cancer, we used shRNAs that specifically knock down KIF3A in two types of bladder cancer cell lines, namely, T24 and 5637. qPCR (Fig. 2A) and immunoblot (Fig. 2B) assays were respectively performed, confirming the knockdown efficiency of KIF3A shRNA plasmids effectively in T24 and 5637 cells.
Figure 2
KIF3A promotes the proliferation of bladder cancer cells in vitro. (A) qPCR assays revealed the obviously dropped expression levels of KIF3A caused by the transfection of its shRNA plasmids in T24 and 5637 cells, respectively. (B) Immunoblot assays confirmed the efficiently silenced KIF3A expression in both KIF3A–shRNA‐transfected T24 and 5637 cells. (C) CCK‐8 assays showed the inhibition of cell proliferation caused by KIF3A ablation, confirmed by the A
490 nm wavelength in T24 or 5637 cells. (D) Representative photographs showed the results of colony formation assays of T24 and 5637 cells transfected with control or KIF3A shRNA plasmids. (E) Flow cytometry assays were performed and confirmed that KIF3A depletion induced cell cycle arrest in T24 cells. (F) Immunoblot assays indicated the expression level of Ki67 in control or KIF3A knockdown T24 and 5637 cells (mean ± SEM, **P < 0.01). Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.
KIF3A promotes the proliferation of bladder cancer cells in vitro. (A) qPCR assays revealed the obviously dropped expression levels of KIF3A caused by the transfection of its shRNA plasmids in T24 and 5637 cells, respectively. (B) Immunoblot assays confirmed the efficiently silenced KIF3A expression in both KIF3A–shRNA‐transfected T24 and 5637 cells. (C) CCK‐8 assays showed the inhibition of cell proliferation caused by KIF3A ablation, confirmed by the A
490 nm wavelength in T24 or 5637 cells. (D) Representative photographs showed the results of colony formation assays of T24 and 5637 cells transfected with control or KIF3A shRNA plasmids. (E) Flow cytometry assays were performed and confirmed that KIF3A depletion induced cell cycle arrest in T24 cells. (F) Immunoblot assays indicated the expression level of Ki67 in control or KIF3A knockdown T24 and 5637 cells (mean ± SEM, **P < 0.01). Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.Subsequently, to confirm the potential involvement of KIF3A in the proliferation of bladder cancer cells, we used CCK‐8 assays. KIF3A knockdown effectively decreased the A value at 490 nm wavelength in both T24 and 5637 cells, respectively (Fig. 2C), indicating a decreased proliferation ability. Similarly, through colony formation assays, relative colony number in KIF3A‐depleted groups was markedly decreased (Fig. 2D). We further noticed KIF3A depletion resulted in cell cycle arrest of T24 cells in vitro (Fig. 2E). Next, we performed immunoblot assays to detect expression level of a proliferate marker, such as Ki67. Results showed ablation of KIF3A dramatically suppressed Ki67 level in T24 and 5637 cells (Fig. 2F). Combined, data obtained in this section illustrated a defective proliferation capacity, suggesting KIF3A contributed to cell proliferation of bladder cancer in vitro.
Ablation of KIF3A blocks cell migration and invasion of bladder cancer in vitro
We next performed wound healing and Transwell assays to investigate the effects of KIF3A on the migration and invasion of bladder cancer cells. Our results showed that KIF3A knockdown dramatically blocked the extent of wound closure in both T24 and 5637 cells (Fig. 3A). In addition, Transwell assays confirmed that KIF3A knockdown significantly blocked cancer cell invasion in cell models through membranes, accompanied with dramatically decreased cell numbers (Fig. 3B). We further detected the expression of MMP2 and MMP9, two key regulators of cell migration, in cells expressing control or KIF3A shRNA. Immunoblot assays confirmed the significant down‐regulation of MMP2 and MMP9 levels in KIF3A‐depleted T24 or 5637 cells, which were consistent with our previous results (Fig. 3C). Our data further confirmed that KIF3A depletion impaired the stabilization of microtubule on the ice in T24 cells (Fig. 3D), suggesting the critical involvement of KIF3A on the regulation of microtubule stabilization. Collectively, our results demonstrated that KIF3A contributed to cell migration and invasion of bladder cancer in vitro.
Figure 3
KIF3A contributes to the migration and invasion of bladder cancer cells in vitro. (A) Wound healing assays were also performed using T24 and 5637 cells transfected with control or KIF3A–shRNA plasmids, and the relative wound width was detected. (B) Transwell assays using control or KIF3A depletion T24 and 5637 cells were performed, and the extent of Transwell migration was quantified by relative cell number. (C) Immunoblot assays indicated the expression levels of MMP2 and MMP9 in control or KIF3A knockdown T24 and 5637 cells. (D) T24 cells were set on ice for 0, 5 and 15 min to induce microtubule depolymerization, and the remaining microtubules were detected through immunostaining assays (mean ± SEM, **P < 0.01). Scale bar indicates 10 μm. Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.
KIF3A contributes to the migration and invasion of bladder cancer cells in vitro. (A) Wound healing assays were also performed using T24 and 5637 cells transfected with control or KIF3A–shRNA plasmids, and the relative wound width was detected. (B) Transwell assays using control or KIF3A depletion T24 and 5637 cells were performed, and the extent of Transwell migration was quantified by relative cell number. (C) Immunoblot assays indicated the expression levels of MMP2 and MMP9 in control or KIF3A knockdown T24 and 5637 cells. (D) T24 cells were set on ice for 0, 5 and 15 min to induce microtubule depolymerization, and the remaining microtubules were detected through immunostaining assays (mean ± SEM, **P < 0.01). Scale bar indicates 10 μm. Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.
KIF3A induces tumor growth of bladder cancer cells in vivo
To further confirm our hypothesis, we then tested whether KIF3A promoted tumor growth of bladder cancer cells in a mouse model. In brief, T24 cells were infected with control or KIF3A shRNA lentivirus, which was subcutaneously injected into nude mice. Two weeks postimplantation, tumors were isolated every 5 days, photographed, and the volumes of tumors were measured. Thirty days postimplantation, all tumors were isolated and the animals were sacrificed. First, KIF3A level in tumor tissues from knockdown groups was assessed through immunoblot assays (Fig. 4A). Also, there were no significant differences regarding mouse weight between control and KIF3A‐depleted groups (Fig. 4B). Representative tumors, the tumor growth curve and tumor weight are exhibited in Fig. 4C. Consistent with our hypothesis, the volume and weight of tumors in KIF3A depletion groups were significantly decreased compared with that in control groups (Fig. 4C). We further conducted IHC assays to detect the KIF3A and Ki67 expressions in tumor tissues. Both KIF3A and Ki67 levels were obviously decreased in KIF3A‐depleted tumor tissues (Fig. 4D). Collectively, we reported that KIF3A contributed to tumor growth of bladder cancer in vivo.
Figure 4
Knockdown of KIF3A impaired tumor growth of bladder cancer cells in vitro. (A–C) T24 cells were infected with KIF3A or control shRNA lentivirus, and subsequently implanted into nude mice. After 2 weeks, tumors were isolated, and volume was calculated every 5 days. After 30 days, all tumors were isolated (n = 6 in each group). Tumor growth curves were calculated based on the average volume of six tumors for each group. (A) Immunoblot assays confirmed the efficiently silenced KIF3A expression in tumor tissues from KIF3A‐depleted mice. (B) Weight of mice from control or KIF3A depletion groups. (C) Representative photographs of tumors, the growth curve and tumor weight were exhibited, respectively. (D) Immunohistochemical assays indicated the expression levels of KIF3A and Ki67 in control or KIF3A knockdown tumor tissues isolated from mice (mean ± SEM, **P < 0.01). Scale bars indicate 50 μm. Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.
Knockdown of KIF3A impaired tumor growth of bladder cancer cells in vitro. (A–C) T24 cells were infected with KIF3A or control shRNA lentivirus, and subsequently implanted into nude mice. After 2 weeks, tumors were isolated, and volume was calculated every 5 days. After 30 days, all tumors were isolated (n = 6 in each group). Tumor growth curves were calculated based on the average volume of six tumors for each group. (A) Immunoblot assays confirmed the efficiently silenced KIF3A expression in tumor tissues from KIF3A‐depleted mice. (B) Weight of mice from control or KIF3A depletion groups. (C) Representative photographs of tumors, the growth curve and tumor weight were exhibited, respectively. (D) Immunohistochemical assays indicated the expression levels of KIF3A and Ki67 in control or KIF3A knockdown tumor tissues isolated from mice (mean ± SEM, **P < 0.01). Scale bars indicate 50 μm. Student’s t‐test was used for statistical comparisons, and three independent replicates were performed.
Discussion
In the past decade, advanced bladder cancer exhibited an increasing high mortality rate worldwide. However, the key treatment strategies, such as surgical resection, radiotherapy and chemotherapy, exhibited few effects 24, 25, 26 in clinical practice. Targeted therapy becomes a promising therapeutic approach; therefore, it is critical to explore the appropriate therapeutic targets 27, 28. In this study, we identified the possible involvement of a member of kinesin family, named KIF3A, in the progression of bladder cancer. Comparing KIF3A levels in a total of 50 tumor tissues with the corresponding adjacent tissues from patients with bladder cancer, we found there were abnormally high KIF3A levels in human bladder cancer tissues. Similarly, KIF3A was highly expressed in multiple types of human cancers, such as breast cancer, lung cancer and prostate cancer. Furthermore, through clinical pathological analysis, we detected a positive correlation between KIF3A expression and clinical characteristics (including tumor size and clinical stage), suggesting its potential effects on progression of bladder cancer. Previous studies also indicated that KIF3A was associated with clinical features, including Gleason score, tumor–node–metastasis stage and metastatic status of patients with prostate cancer, which is similar to our findings. By conducting Kaplan‐Meier survival analysis, we reported that KIF3A was correlated with the poor prognosis. In summary, our findings suggest KIF3A might be regarded as a possible biomarker and therapeutic target for bladder cancer treatment.Through CCK‐8 assays, colony formation assays and tumor growth assays, we further confirmed that KIF3A altered proliferation rates of bladder cancer cells in vitro and in vivo. However, the precise molecular mechanisms require further study. In prostate cancer, KIF3A promoted the proliferation of cancer cells via Wnt signaling 19, whereas in glioblastoma, KIF3A affected ciliogenesis and tumorigenesis 20. Furthermore, KIF3A could bind to β‐arrestin to block the Wnt signal pathway, therefore affecting the proliferation of lung cancer cells, which is consistent with the upregulation of cyclin D1 and β‐catenin 29, 30. Whether KIF3A stimulated cell proliferation of bladder cancer through these mechanisms should be further investigated in future studies.In this study, we found that KIF3A promoted the migration and invasion of bladder cancer cells. However, clinicopathological studies showed that KIF3A level was not related to vascular invasion. This is interesting, because KIF3A might be highly expressed in tumor cells to promote migration and invasion, whereas there might be no abnormal expressions in endothelial cells to promote endothelial cell movement. KIF3A might therefore show modest effects on vascular invasion. Further research of the KIF3A‐mediated mechanism is needed.In this study, there is one problem that cannot be ignored. KIF3A is a microtubule‐based motor protein involved in many important cellular activities, such as mitosis, migration and ciliogenesis 15, 31. These cellular biological processes may alter tumor development. KIF3A mediated extracellular signal‐regulated kinases 1/2 (ERK1/2) signaling pathways and further suppressed the migration and invasion of breast cancer cells 18, 32. KIF3A ablation also sensitized bronchial epithelia to apoptosis and further promoted airway inflammation in asthma 17. In this study, we found that KIF3A affects cancer progression through the regulation of proliferation rate, and the possible effects of KIF3A on the migration, invasion and apoptosis of bladder cancer cells require further study. It is well known that KIF3A is a microtubule‐based motor protein participating in multiple types of cellular processes, such as cell division and migration, which could also be affected by microtubule dynamics 15, 31. We speculated that the effect of KIF3A on tumor proliferation and movement might be caused by its regulation of microtubule dynamics, which requires further investigation.Collectively, we demonstrated that KIF3A was highly expressed in human bladder cancer tissues. There were correlations between KIF3A expression and clinical characteristics, including clinical stage, pathological tumor status, lymph node status and metastasis. Interestingly, KIF3A was associated with the prognosis of patients with bladder cancer. KIF3A mediates cell cycle; facilitates cell proliferation, migration and invasion of bladder cancer in vitro; and promotes tumor growth of bladder cancer in vivo. Our study sheds light on KIF3A as a novel therapeutic target for treatment of bladder cancer for drug design and development from bench to clinic.
Conflict of interest
The authors declare no conflict of interest.
Author contributions
YZ conceived and designed the experiments. Q Zhou and JY analyzed and interpreted the results of the experiments. Q Zheng, TW and ZJ performed the experiments.
Authors: John M Sung; Jeremy W Martin; Francis A Jefferson; Daniel A Sidhom; Keyhan Piranviseh; Melissa Huang; Nobel Nguyen; Jenny Chang; Argyrios Ziogas; Hoda Anton-Culver; Ramy F Youssef Journal: Clin Genitourin Cancer Date: 2019-05-31 Impact factor: 2.872
Authors: Zun Liu; Ryan E Rebowe; Zemin Wang; Yingchun Li; Zehua Wang; John S DePaolo; Jianhui Guo; Chiping Qian; Wanguo Liu Journal: Mol Cancer Res Date: 2014-01-10 Impact factor: 5.852
Authors: Alberto Martini; John P Sfakianos; Lotta Renström-Koskela; Ashkan Mortezavi; Ugo G Falagario; Lars Egevad; Abolfazal Hosseini; Reza Mehrazin; Matthew D Galsky; Gunnar Steineck; N Peter Wiklund Journal: BJU Int Date: 2019-08-07 Impact factor: 5.588
Authors: Kevin C Corbit; Amy E Shyer; William E Dowdle; Julie Gaulden; Veena Singla; Miao-Hsueh Chen; Pao-Tien Chuang; Jeremy F Reiter Journal: Nat Cell Biol Date: 2007-12-16 Impact factor: 28.824