Ying Shu1,2, Yingying Yang1, Yuliang Zhao1, Liang Ma1, Ping Fu1, Tiantian Wei1, Ling Zhang1. 1. Kidney Research Institute, Division of Nephrology, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China. 2. Division of Nephrology, The Third People's Hospital of Chengdu, Chengdu, Sichuan 610031, China.
Abstract
BACKGROUND: Acute kidney injury (AKI) caused by bee stings is common, with characteristics of acute onset, severe illness, and high mortality. Melittin, a major component of bee venom, has been considered to play a key role in bee sting related AKI. This study aims to illustrate whether melittin could lead to apoptosis of renal tubular epithelial cells (RTECs) and to investigate its mechanism. METHODS: In vivo, 45 mice were randomly divided into the melittin group (n=30, injected with melittin into the tail vein according to the total dose of 4.0 ug/g weight) and the control group (n=15, injected with the same volume of saline into the tail vein). In vitro, human RTECs (HK-2) were cultured and treated with melittin (2ug/ml or 4ug/ml) and TNF-α (10ng/ml). Biochemical analysis, HE stains, and electron microscope were performed to evaluate renal function and pathological changes. TUNEL stains and flow cytometry were performed to detect apoptosis. Real-time PCR was performed to detect mRNA levels of Bax, Bcl-2, and TNF-α. Simple western assay and immunohistochemical (IH) and immunofluorescent (IF) stains were performed for protein detection. RESULTS: Melittin successfully induced AKI in mice. Compared with the control group, obvious injury and apoptosis of RTECs were observed in the melittin group; the mRNA and protein expressions of Bax were significantly increased, while the expression of Bcl-2 was significantly decreased. The serum TNF-αlevel in melittin group was significantly higher than that in control group. In vitro, the results confirmed that melittin can cause HK-2 cells apoptosis. The trends of expression of Bax and Bcl-2 were consistent with the results in vivo. The levels of TNF-α mRNA and protein by PCR and Western blot were significantly higher in melittin group than those in control group. CONCLUSION: Melittin can lead to the apoptosis of RTECs, which may be mediated by upregulating the expression of Bax/Bcl-2 and activating the TNF-α signaling pathway.
BACKGROUND: Acute kidney injury (AKI) caused by bee stings is common, with characteristics of acute onset, severe illness, and high mortality. Melittin, a major component of bee venom, has been considered to play a key role in bee sting related AKI. This study aims to illustrate whether melittin could lead to apoptosis of renal tubular epithelial cells (RTECs) and to investigate its mechanism. METHODS: In vivo, 45 mice were randomly divided into the melittin group (n=30, injected with melittin into the tail vein according to the total dose of 4.0 ug/g weight) and the control group (n=15, injected with the same volume of saline into the tail vein). In vitro, human RTECs (HK-2) were cultured and treated with melittin (2ug/ml or 4ug/ml) and TNF-α (10ng/ml). Biochemical analysis, HE stains, and electron microscope were performed to evaluate renal function and pathological changes. TUNEL stains and flow cytometry were performed to detect apoptosis. Real-time PCR was performed to detect mRNA levels of Bax, Bcl-2, and TNF-α. Simple western assay and immunohistochemical (IH) and immunofluorescent (IF) stains were performed for protein detection. RESULTS: Melittin successfully induced AKI in mice. Compared with the control group, obvious injury and apoptosis of RTECs were observed in the melittin group; the mRNA and protein expressions of Bax were significantly increased, while the expression of Bcl-2 was significantly decreased. The serum TNF-αlevel in melittin group was significantly higher than that in control group. In vitro, the results confirmed that melittin can cause HK-2 cells apoptosis. The trends of expression of Bax and Bcl-2 were consistent with the results in vivo. The levels of TNF-α mRNA and protein by PCR and Western blot were significantly higher in melittin group than those in control group. CONCLUSION: Melittin can lead to the apoptosis of RTECs, which may be mediated by upregulating the expression of Bax/Bcl-2 and activating the TNF-α signaling pathway.
Acute kidney injury (AKI) is a common clinical syndrome with various etiologies and characteristics of acute onset, severe illness, and high mortality rate. Bee sting is a common cause of AKI in some countries. AKI caused by bee stings are often accompanied with multiple organ dysfunction syndrome (MODS), with the mortality rate ranging from 9.3% to 60% [1-3]; however, its pathogenesis has not been fully elucidated up to now.The relationship between the apoptosis of renal tubular epithelial cells (RTECs) and AKI has been proved in renal ischemia [4, 5], nephrotoxic substances [6, 7], and septicemia [8, 9] associated AKI. And the targeting regulation of apoptosis may provide a new approach to the treatment of AKI. Melittin, a major component of bee venom [10], has been considered to play a key role in AKI induced by bee stings. Meanwhile, it has not been reported whether the RTECs apoptosis is involved in AKI induced by melittin and what the specific mechanisms are.Bax and Bcl-2, as members of B-cell lymphoma/leukemia-2 (BCL-2) protein family, play a critical role in the regulation of apoptosis. Bax, also known as pore-forming protein, forms pores in the outer mitochondrial membrane after activation, resulting in the loss of membrane integrity and the release of cytochrome c [11]. Thus, Bax is an important proapoptotic factor, which participates in the mitochondrial pathway of apoptosis, while Bcl-2, an antiapoptotic factor, can inhibit the function of Bax [12]. Therefore, the expression level of Bax/Bcl-2 is an important index to regulate apoptosis.Tumor necrosis factor-alpha (TNF-α) is an important cytokine that participates in apoptosis. After combining with its death receptor (tumor necrosis factor receptor 1, TNFR1), TNF-α can induce apoptosis through death receptor pathway; on the other hand, it can also promote apoptosis by regulating the expression of proapoptotic and antiapoptotic factors of BCL-2 protein family [13].In the present study, basing on in vivo and in vitro experiments, we aimed to illustrate whether melittin could lead to the apoptosis of RTECs and to investigate the molecular mechanism of apoptosis. As far as we know, this is the first report on the renal toxicity of melittin from the perspective of apoptosis.
2. Materials and Methods
2.1. Animals, Cells, and Reagents
Healthy male BALB/c mice were obtained from West China Medical Animal Experiment Center of Sichuan University. Human proximal tubular epithelial cells (HK-2) were purchased from American Type Culture Collection (Manassas, VA). Melittin and TNF-αwere purchased from Sigma (St. Louis, USA). Antibodies for Bax, Bcl-2, and TNF-α were purchased from Abcam (Shanghai, China).
2.2. AKI Model
45 mice were randomly divided into the melittin group (n=30) and the control group (n=15) on a ratio of 2:1. The mice in melittin group were injected with melittin into the tail vein (total dose of 4.0 ug/g weight) at time 0 h, while the control group mice were injected with the same volume of saline. Due to a lack of appropriate literature references, the dosage of melittin we selected was based on our preliminary experiment (given this dose, more than 80% of the experimental mice developed AKI and survived for more than 48h). Then mice were euthanized at times 2h, 6h, 12h, 24h, and 48h after injection, respectively, and the serum and kidney specimens were collected for further examination. Biochemical analysis, HE stains, and electron microscope were performed to evaluate the renal function and pathological changes. TUNEL stains, real-time PCR (RT-PCR), and immunohistochemical (IH) stains were performed to detect apoptosis and the mRNA and protein levels, respectively.
2.3. Cell Culture
HK-2 cells were maintained in DMEM/F12 media supplemented with 10% FBS, penicillin G (100 U/ml), and streptomycin (100 mg/L). All cells were grown at 37°C in 5% CO2 in a humidified incubator. Before melittin treatments, cells were serum starved for 24 hours. Cell experiments were conducted in two batches. In first batch, HK-2 cells were divided into three groups: the control group, the low-dose group of melittin (2ug/ml, the dose of half inhibitory concentration (IC50) detected by CCK-8, showed in supplementary material ()), and the high-dose group of melittin (4ug/ml), and the cells were collected for further detection at 2h, 6h, 12h, 24h, and 48h after administration of melittin. In the second batch, HK-2 cells were divided into four groups: the control group, the melittin group (2ug/ml), the TNF-α group (10ng/ml), and the melittin (2ug/ml) + TNF-α (10ng/ml) group, and the cells were collected for further detection at 24h and 48h after administration. Flow cytometry was performed to detect apoptosis. RT-PCR was performed to detect the mRNA levels, and simple western assays and immunofluorescent (IF) stains were performed to detect the protein levels.
2.4. Apoptosis Assay
TUNEL staining was performed on paraffin sections of mice renal tissues to detect apoptosis. The experimental method was carried out with reference to literature [14]. Paraffin sections were treated by Xylene soak and different concentrations of ethanol step by step with 100%, 95%, 80%, and 70%. Using PBS to dilute 2mg/ml protease K solution (100:1), the final concentration of protease K solution was 20 ug/ ml. Each specimen was incubated at room temperature for 20 minutes with a 100ul prepared protease K solution. After two washings with PBS, specimens were incubated with 100 U/ml terminal deoxyuridine transferase (TdT), 0.5ug/ml biotinylated uridine in 1 M potassium cacodylate and 125 mM Tris–HC1, and 2.5 mM cobalt chloride, at pH 6.6 for 1 h at 37°C in a humidified chamber. After washes, a 1:40 solution of fluoresceinated streptavidin was incubated for 30 min at room temperature. Slides were counterstained with 0.3 ug/ml propidium iodine in PBS for 1 min at room temperature. To detect the nuclei, the cells were incubated with DAPI for 2 min at room temperature in the dark, rinsed with PBS three times, and observed with a fluorescence microscopy. Apoptosis was determined as the ratio of the number of TUNEL-positive nuclei to that of DAPI-positive nuclei from six randomly selected fields.Quantitation of apoptotic HK-2cells was performed by using Annexin V-APC/PI apoptosis kit (eBioscience, 88-8007). Briefly, when the HK-2 cells in each group grew to about 80% coverage, drugs were added as planned to induce apoptosis. By trypsin digestion, cells were made into suspension and collected in the same 5 mL centrifuge tube with supernatant cells, at a density more than 5 × 105 cells/well. After washing in ice-cold phosphate buffer saline (PBS) twice, cells were resuspended in 500 μL Binding Buffer containing 10 μL Annexin V-APC and 5 μL PI. Then the samples were incubated in the dark at room temperature for 30 min and the apoptotic cells (Annexin V-APC positive and PI-negative) were distinguished on a flow cytometer (OLYMPUS, IX71).
2.5. RT-PCR
Total RNA of renal tissues and cells were extracted by using Trizol reagent (Sigma) according to the manufacturer's instructions. Reverse transcription was performed with 2 μg of total RNA using a RevertAid First Strand cDNA Synthesis kit (Thermo Scientific). RT-PCR was conducted in a Bio-Rad CFX96 real-time PCR System (Bio-Rad, CA) by using FastStart Universal SYBR Green Master (ROX) (Roche, USA). All primers were designed and synthetized by Ribobio (Guangzhou, China): Bax for mice renal tissue (Fw 5'-CTGAGCTGACCTTGGAGC-3' and Rv: 5'-GACTCCAGCCACAAAGATG-3'); Bcl-2 for mice renal tissue (Fw 5'-TGTGGTCCATCTGACCCTCC-3' and Rv: 5'-ACATCTCCCTGTTGACGCTCT-3'); GAPDH for mice renal tissue (Fw 5'-CAACGGGAAGCCCATCAC-3' and Rv: 5'-CGGCCTCACCCCATTTG-3'); Bax for HK-2 cells (Fw 5'- CCCGAGAGGTCTTTTTCCGAG -3' and Rv: 5'-CCAGCCCATGATGGTTCTGAT-3'); Bcl-2 for HK-2 cells (Fw 5'- ACTTCGCCGAGATGTCC -3' and Rv: 5'- ATGACCCCACCGAACTC -3'); TNF-α for HK-2 cells (Fw 5'-TCCAGGCGGTGCTTGTTC -3' and Rv: 5'-CCAGAGGGCTGATTAGAGAG-3'); GAPDH for HK-2 cells (Fw 5'- TGACTTCAACAGCGACACCCA -3' and Rv: 5'-CACCCTGTTGCTGTAGCCAAA-3'). Data were calculated by the 2-ΔΔCt method and normalized to GAPDH expression in each sample.
2.6. Simple Western Assays
The protein levels of Bax, Bcl-2, and TNF-α of HK-2 cells were detected by simple western assays (Proteinsimple, WS-2471). Using simple western assays, it can be completed in the same sample tube where samples are separated, captured, and fixed, as well as immunoassay and quantitative analysis, to automatically achieve all the experimental steps of traditional Western blot steps (including protein sampling and separation, immunoblotting, washing, testing, and quantitative analysis of data), improving the accuracy and repeatability of test results. The samples and reagents were prepared according to the Protein Simple's manual. Briefly, the samples were mixed with 2x Simple Western Sample Master Mix containing 80 mM DTT, 2x Sample buffer, and 2x fluorescence standard. The diluted antibodies, other reagents, and diluted and denatured protein samples were added to the plate in accordance with the set procedure, and the following conditions were followed: (I) protein separation: 375V voltage, 25 minutes; (II) antibody: closed for 15 minutes; (III) the first antibody: incubated for 30 minutes; (IV) the second antibody: incubated for 30 minutes.
2.7. IH Staining
IH staining was performed to detect the protein levels of Bax and Bcl-2 in mice renal tissues. The renal tissue samples were dehydrated and embedded in paraffin following routine methods. The paraffin sections were removed and then immersed in the distilled water following routine methods. Then we followed the instructions of rabbit/mouse universal IH detection kit (Shanghai gene technology co. LTD).
2.8. IF Staining
The protein levels of Bax, Bcl-2, and TNF-α in HK-2 cells were detected by IF staining. HK-2 cells were fixed in 4% paraformaldehyde and permeabilized in 0.1% Triton X-100, and the sections were incubated for 2 h with DAR-FITC (1:50) at RT. The fluorescent images were visualized with a Fluoview 300 fluorescence microscope (Olympus).
2.9. Statistical Analysis
SPSS 20.0 statistical software (SPSS, Inc., Chicago, USA) was used for data processing. Data were expressed as mean ± standard deviation. T test was adopted for the comparison between two groups with normal distribution and homogeneity of variance, and ANOVA was used for the comparison of mean number between multiple groups. Values of P<0.05 were considered statistically significant.
3. Results
3.1. Melittin Induced-AKI Model Was Established Successfully
The serum creatinine (SCr) value of mice in the melittin group increased at time 2h after melittin injection; at time 6h, the SCr value (102.60 ± 4.11 μmol/L) was more than 2 times that of the control group (26.78± 1.91μ mol/L); the SCr value reached the highest level (160.8 ± 7.35 μmol/L) at time 12h. The AKI molds were successfully established. See Figure 1(a).
Figure 1
SCr level and HE staining of renal tissue in mice AKI model. SCr level in mice AKI model (a). HE stains of mice renal tissue (b). Magnification×100. The arrows show the vacuolar degeneration, the shedding of renal tubular epithelial cells, or the enlarged tubule cavity. P (compared with the control): ∗<0.05, ∗∗<0.01, ∗∗∗<0.001.
3.2. The Renal Tissue of Mice in the Melittin Group Showed Obvious Signs of RTECs Injury
HE stains showed that, compared with the control group, the melittin group has shown remarkable signs of RTECs injury, including vacuolar degeneration, the shedding of renal tubular epithelial cells, and the enlarged tubule cavity. And the trend of change of renal tubular injury score was consistent with that of SCr. See Figure 1(b).
3.3. Typical Apoptosis Signs Were Observed in the RTECs of Mice in the Melittin Group
Compared with the control group, the mitochondria of RTECs of mice in the melittin group were significantly swollen, and the typical signs of apoptosis such as chromatin margin set and nuclear shrinkage were observed. See Figure 2(b). TUNEL staining showed a significant increase in apoptosis rate of mice renal tissue in the melittin group. And the trend of apoptosis was consistent with that of SCr. See Figure 2(a).
Figure 2
Apoptosis of mice renal tissue observed by TUNEL staining and electron microscope. TUNEL staining showing the apoptosis cells (green) in mice renal tissue (a). Magnification×100. P (compared with the control): ∗<0.05, ∗∗∗<0.001. The ultrastructure of renal tubular epithelial cells observed by electron microscopy (b). The arrows show normal nucleus and mitochondria (A), and chromatin margin set, nuclear shrinkage or swollen mitochondria (B, C, D, E).
3.4. In Melittin-AKI Mice Models, the Expression of Proapoptotic Factor Bax Increased and the Expression of Antiapoptotic Factor Bcl-2 Decreased
RT-PCR showed that, compared with the control group, the mRNA expression of proapoptotic factor Bax increased significantly at each time point, while the mRNA expression of antiapoptotic factor Bcl-2 decreased significantly. The Bax / Bcl-2 ratio of the melittin group was significantly higher than that of the control group at each time, and the value peaked at time 12h. See Figure 3(a). IH stains showed that, compared with control group, Bax protein levels of the melittin group increased significantly at each time point, while Bcl-2 protein levels decreased significantly. At time 12h, the expression level difference was most obvious. See Figures 3(b) and 3(c).
Figure 3
The expression of Bax and Bcl-2 in renal tissue. The mRNA expression of Bax and Bcl-2 in renal tissue (a). The protein expression of Bax in renal tissue detected by IH stains (b). IH: immunohistochemistry. Magnification×100. The protein expression of Bcl-2 in renal tissue detected by IH stains (c). Magnification×100. P (compared with the control): ∗<0.05, ∗∗<0.01, ∗∗∗<0.001.
3.5. Melittin Caused the Apoptosis of HK-2 Cells
In vitro, HK-2 cells were treated by melittin with different concentrations at different time points. Cell apoptosis was analyzed by flow cytometry using Annexin V-FITC and PI stains. The results showed that, compared with the control group, the apoptosis rate of HK-2 cells in both the low-dose melittin group and the high-dose melittin group increased significantly. Within 24h, the apoptotic effects of melittin were time- and concentration-dependent. See Figure 4.
Figure 4
Melittin caused the apoptosis of HK-2 cells. Detected by flow cytometry using Annexin V-FITC and PI stains. P (intergroup comparison ): ∗∗∗<0.001.
3.6. In the Apoptosis of HK-2 Cells Induced by Melittin, the Expression of Proapoptotic Factor Bax Increased and the Expression of Antiapoptotic Factor Bcl-2 Decreased
RT-PCR was used to detect the mRNA expression of Bax and Bcl-2. The protein expression of Bax and Bcl-2 was detected by simple western assays and IF stains. The results showed that, compared with the control group, the mRNA expression of proapoptotic factor Bax in melittin group increased significantly at 24h and 48h time points, while the mRNA expression of antiapoptotic factor Bcl-2 decreased significantly (Figure 5(a)). The protein expression trends of Bax and Bcl-2 were consistent with their mRNA expression trends (Figures 5(b) and 5(c)).
Figure 5
The expression of Bax and Bcl-2 in HK-2 cells. The mRNA expression of Bax and Bcl-2 in HK-2 cells (a). P (compared with the control): N>0.05, ∗<0.05, ∗∗<0.01. P (intergroup comparison): n>0.05, &<0.05. The protein expression of Bax and Bcl-2 in HK-2 cells detected by simple Western assays (b). A: the control group, B: the melittin group, C: the TNF-α group, D: the melittin+TNF-α group. P (compared with the control): N>0.05, ∗<0.05, ∗∗<0.01. P (intergroup comparison): n>0.05. The protein expression of Bax and Bcl-2 in HK-2 cells detected by IF stains (c). IF: immunofluorescent. Magnification×200. P (compared with the control): ∗∗<0.01, ∗∗∗<0.001.
3.7. TNF-α Signaling Pathway Was Activated in the Apoptosis of HK-2 Cells Induced by Melittin
In melittin-AKI mice models, the serum level of TNF-α was significantly increased. Serum TNF-α level in the melittin group began to increase 2 hours after melittin injection, reaching the highest level at 6h (265.2 ± 3.005, pg/mL), and then gradually decreased from 12h to 48h. The trend of TNF-α was basically consistent with that of SCr and apoptosis, but earlier in time (Figure 6(d)). RT-PCR showed that the mRNA expression of TNF-α in the melittin group was significantly higher than that in the control group (Figure 6(a)). The results of simple western assays and IF showed that the protein level of TNF-α in the melittin group was significantly higher than that in the control group (Figures 6(b) and 6(c)).
Figure 6
The expression of TNF-α in HK-2 cells. The mRNA expression of TNF-α in HK-2 cells (a). P (compared with the control): ∗∗<0.01. The protein expression of TNF-α in HK-2 cells detected by simple Western assays (b). A: the control group, B: the melittin group, C: the TNF-α group, D: the melittin+TNF-α group. P (compared with the control): ∗<0.05, ∗∗<0.01. The protein expression of TNF-α in HK-2 cells detected by IF stains (c). Magnification×200. P(compared with the control): ∗∗<0.01, ∗∗∗<0.001. The serum level of TNF-α in mice (d). P(compared with the control): ∗<0.05.
4. Discussion
AKI is a group of clinical syndromes characterized by a sharp decrease in renal function in a short period of time and accompanied by the occurrence of azotemia, imbalance of water, electrolyte and acid base, and systemic symptoms. The incidence of AKI in adults and children is as high as 21.6% and 33.7%, respectively, and the mortality rate is 23.9% and 13.8%, respectively [15]. Worldwide, about 13 million people suffer from AKI every year, leading to 1.7 million deaths [16]. AKI has become a global public health problem affecting human health and attracting worldwide attention.Bee stings occur frequently in some rural areas. Depending on the type of apisin, the severity of bite, and the physical differences of the victims, bee stings can present various reactions, ranging from mild local reactions (such as edema, erythema, and urticaria) to fatal systemic complications (such as allergic shock, hemolysis, AKI, rhabdomyolysis syndrome, pancreatitis, encephalitis, myocarditis, neuritis, acute hepatic failure, lung injury, and MODS) [2, 3, 17–22]. AKI caused by bee stings is often accompanied by MODS, and 10.7% [1] of patients eventually develop CKD even after active treatment such as blood purification, with poor clinical prognosis. It is of great significance to profoundly study the pathogenesis of AKI caused by bee stings and provide more references for clinical treatment.Recently, it has been confirmed that the apoptosis of RTECs is related to the occurrence and development of AKI [4-9]. Yang et al. [23] found that the apoptosis rate of RTECs increased significantly in mouse renal ischemia reperfusion AKI model. In the rat AKI model induced by cisplatin, the apoptosis rate of RTECs increased, and the expression of proapoptotic factor Bax increased significantly, while the expression of antiapoptotic factor Bcl-2 did not change significantly. The ratio of Bax/ Bcl-2 increased consequently [24]. Liu et al. [25] found that the proportion of cell apoptosis in the contrast induced AKI model increased significantly, the expression of cleaved caspase-3 and proapoptotic factor Bax increased, and the expression of antiapoptotic factor bcl-2 decreased. In the present study, the AKI model was successfully established after injecting melittin into the tail vein of mice; there were obvious signs of renal tubular injury in the melittin group by HE stains. TUNEL stains indicated that the apoptosis rate of RTECs in melittin group increased significantly. Through electron microscope, typical features of apoptosis (such as chromatin margin set and nuclear shrinkage) of RTECs in melittin group were observed and the severity of apoptosis was positively correlated with the severity of kidney injury. In in vitro experiments, it was further confirmed that melittin can induce the apoptosis of human RTECs (HK-2 cells), and its apoptosis effect was concentration- and time-dependent within 24 hours. Through in vivo and in vitro experiments, our study confirmed that melittin can lead to the apoptosis of RTECs, which may be an important pathogenesis of AKI caused by bee stings.Targeted regulation of apoptosis may bring new hope to the treatment of AKI, though it is of great difficulty because of the complexity of apoptotic regulation. The BCL-2 family plays a key role in the regulation of the mitochondrial apoptosis pathway [13], and it includes many members, such as Bcl-2, Bcl-xl, Bcl-W, Mcl-1, A1, Bax(Bcl-2-associated X protein), Bak(Bcl-2 killer), Bcl-ramb, BOK, Bid, Bim, Bik, Bid, Hrh, PUMA, and NOXA [11, 12, 26, 27]. According to the roles in apoptosis, they can be divided into two categories: proapoptotic factor and antiapoptotic factor. Among them, Bax/ Bcl-2 are a pair of common and important apoptosis regulators. As mentioned above [24, 25], there was an increase in Bax/ Bcl-2 ratio in many AKI models accompanied by the apoptosis of RTECs. In vivo experiments of this study showed that the mRNA gene and protein expression of proapoptotic factor Bax increased significantly compared with the control group, while the mRNA gene and protein expression of antiapoptotic factor Bcl-2 decreased obviously, suggesting that apoptotic regulatory factors played an important role. In in vitro experiments, through RT-PCR, simple western assays, and IF stains detections, it was further confirmed that, in the apoptosis of HK-2 cells induced by melittin, the expression levels of Bax significantly increased and Bcl-2 significantly decreased. Therefore, the results of this study indicated that apoptosis regulatory factors Bax and Bcl-2 play a key role in the regulation of RTECs apoptosis induced by melittin, which provided theoretical reference to find new targets for the prevention and treatment of AKI caused by bee stings.TNF-α/TNFR1 mediated death receptor pathway is one of the important ways of apoptosis. Meanwhile, it can indirectly activate the mitochondrial apoptosis pathway by regulating the imbalance between the expressions of proapoptosis and antiapoptosis factors in the BC-2 protein family [13]. Campbell et al. [28] found that, in the AKI model of rats with ureteral obstruction, TNF-α activated the mitochondrial apoptosis pathway and resulted in apoptosis of renal tubule cells by increasing the expression of Bax and reducing the expressions of Bcl-2 and Bcl-xl. In our in vivo experiments, the serum TNF-α level in melittin group began to increase at 2h, reached the highest value at 6h, and gradually decreased between 12h to 48h. And the trend of TNF-α was basically consistent with that of SCr and apoptosis, suggesting that TNF-α signaling pathway was activated in the model of AKI caused by melittin. In in vitro experiments, the results showed that, in the apoptosis of HK-2 cells induced by melittin, the expression of serous TNF-α increased significantly. This indicated that TNF-α signaling pathway was activated in the apoptosis of RTECs induced by melittin.Our research has some limitations. Firstly, our study did not set up a therapeutic group targeting on apoptosis. Secondly, our research only observed some most classic pathways, and some other signal molecules regulating apoptosis need to be further studied in the future. Despite the above shortcomings, we have studied AKI induced by bee stings for the first time from the perspective of apoptosis, and some meaningful findings were observed.
5. Conclusion
Melittin can lead to the apoptosis of RTECs, which may be an important pathogenesis of AKI caused by bee stings. The upregulation of Bax/Bcl-2 expression and the activation of TNF-α signaling pathway might play a key role in the apoptosis of RTECs induced by melittin.
Authors: Angela J Frank; Chau-Chyun Sheu; Yang Zhao; Feng Chen; Li Su; Michelle N Gong; Ednan Bajwa; B Taylor Thompson; David C Christiani Journal: Crit Care Med Date: 2012-07 Impact factor: 7.598
Authors: Matthew T Campbell; Pierre Dagher; Karen L Hile; Hongji Zhang; Daniel R Meldrum; Richard C Rink; Kirstan K Meldrum Journal: J Urol Date: 2008-10-31 Impact factor: 7.450