| Literature DB >> 31768101 |
Abstract
Head and neck cancer (HNC) is the sixth most common cancer worldwide and therefore presents a global public health problem. There are no standard algorithms for the diagnosis and follow-up of the disease, and no effective current treatment approaches exist. Therefore, the discovery of new biomolecules and the design of new strategies to aid in early diagnosis is necessary, along with establishing prognostic factors of HNC. In several cancer studies, the upregulation of SET Domain, Bifurcated 1 (SETDB1) has been reported to be tumor-inducing and to indicate a cancer-invasive prognosis, leading to the modulation of genes associated with different signaling pathways; however, the literature is sparse regarding the relationship between SETDB1 and HNC. In our study, three HNC primary cell lines and their corresponding metastatic cell lines were used. The quantitative reverse transcriptase-polymerase chain reaction and western blotting data indicated that the SETDB1 mRNA and protein expression levels were higher in all metastatic cell lines compared to their primary cell lines (P < 0.05 for all). To investigate the role of SETDB1 in HNC biology, in vitro functional analyses were carried out using small interference RNA (siRNA) technology, cell viability, scratch wound-healing, and the caspase-3 activity assay of gene expression of SETDB1 to compare primary and metastatic cell lines of HNC. Metastatic cells were more susceptible to this suppression, which decreased the vitality of cells and their ability of wound-healing and induced level of caspase-3 activity (P < 0.05 for all). This functional study has shown that SETDB1 plays an important role in head and neck carcinogenesis. Therefore, SETDB1 may be an attractive therapeutic target molecule and also a potential diagnostic and prognostic biomarker in HNC.Entities:
Keywords: Head and neck cancer; SETDB1; caspase-3 activity; cell viability; qRT-PCR; scratch wound-healing; siRNA; western blot
Year: 2019 PMID: 31768101 PMCID: PMC6823912 DOI: 10.3906/biy-1903-71
Source DB: PubMed Journal: Turk J Biol ISSN: 1300-0152
The characteristics of the HNC cell lines.
| Cell lines | Origin | Sex/age | Classification | |
| Primary cell lines (A series) | 16A | Tongue | F/77 | T3N0M0/III |
| 42A | Laryngeal | M/43 | T4N3bM0 | |
| 74A | Tongue | M/51 | T3N1M0 | |
| Metastatic cell lines (B series) | 16B | Neck | F/77 | T3N0M0/III |
| 42B | Neck | M/43 | T4N3bM0 | |
| 74B | Neck | M/51 | T3N1M0 | |
HNC = Head and neck cancer; M = male; F = female; TNM = tumor stage involvement size, lymph node status, distance of metastases.
The primer sets.
| Target gene | Direction | Primers |
| SETDB1 | F | 5’ TTAACACAGGCCCTGAATTTCT 3’ |
| R | 5’ TACCCCTGTGGGTAGACACTCT 3’ | |
| GAPDH | F | 5’ GAAGGTGAAGGTCGGAGTC 3’ |
| R | 5’ GAAGATGGTGATGGGATTTC 3’ |
SETDB1= SET Domain, Bifurcated 1; GAPDH = glyceraldehyde-3- phosphate dehydrogenase; Forward = F; Reverse = R.