Literature DB >> 31760895

LncRNA MINCR regulates irradiation resistance in nasopharyngeal carcinoma cells via the microRNA-223/ZEB1 axis.

Qingmu Zhong1, Yifeng Chen2, Zilong Chen1.   

Abstract

Emerging evidence suggests long non-coding RNA (lncRNA) could sponge microRNAs (miRs) and monitor gene expression. In this study, we intended to search the network involving lncRNA MINCR/miR-223/ZEB1 in nasopharyngeal carcinoma (NPC) cell radiosensitivity. MINCR expression in NPC tissues, precancerous lesions and chronic nasopharyngeal mucosal inflammation tissues, and in NP460, CNE2 and CNE2R cells was detected. The associations between MINCR expression and prognosis and radiotherapy efficacy of NPC patients were evaluated. The interactions among MINCR, miR-223 and ZEB1 were verified via dual luciferase reporter gene assay, RNA pull-down and FISH assays. The gain- and loss-of-functions were performed to explore their effects on NPC cell viability, apoptosis and radiosensitivity. Levels of MINCR, miR-223, ZEB1, and AKT/PI3K-related proteins were detected after different treatments. An in vivo analysis was carried out in nude mice. Consequently, MINCR was upregulated in NPC, and linked with worse prognosis and radiotherapy efficacy. MINCR intervention weakened NPC cell radioresistance. MINCR sponged miR-223 to regulate ZEB1. Inactivating AKT eliminated the increased radioresistance of CNE2 cells induced by overexpressing MINCR. Briefly, MINCR diminished NPC cell radiosensitivity by sponging miR-223, increasing ZEB1 and activating the AKT/PI3K axis. This study may offer novel insight for NPC treatment.

Entities:  

Keywords:  AKT/PI3K signaling pathway; Nasopharyngeal carcinoma; ZEB1; long non-coding RNA MINCR; microRNA-223; radioresistance

Mesh:

Substances:

Year:  2019        PMID: 31760895      PMCID: PMC6927709          DOI: 10.1080/15384101.2019.1692176

Source DB:  PubMed          Journal:  Cell Cycle        ISSN: 1551-4005            Impact factor:   4.534


Introduction

Nasopharyngeal carcinoma (NPC) is a malignant neoplasm occurring in the top and lateral walls of the nasopharyngeal cavity [1]. As a kind of malignant epithelial carcinoma in the head and neck, NPC has strong ability of local invasion and early distant metastasis, which is the major cause for poor prognosis in NPC patients at advanced period [2]. NPC patients usually manifest nasal and aural symptoms, including nasopharyngeal mass, dysfunction of Eustachian tube, cranial nerve palsy and cervical masses, sometimes complete nasal obstruction [3] Epstein-Barr virus infection is a well-recognized risk factor for NPC development, and other co-factors including dietary nitrosamine consumption, long-term exposure to wood dusts or chemical carcinogens, cigarette smoking and genetic susceptibility are also of great importance [4]. Although the management and treatment of NPC has been improved by imaging and advanced radiotherapy techniques, the prognosis of NPC patients is still unsatisfactory in the past decades mainly due to radioresistance [5]. Therefore, the future research for NPC therapeutic methods should focus on cell radioresistance. Long non-coding RNAs (lncRNAs) are regulatory RNAs that exert biochemical functions, including in the pathological mechanism of diseases, cell differentiation and proliferation, cancer metastasis and development, and especially NPC cell radioresistance [6]. MINCR is a Myc-induced lncRNA that regulates Myc transcription networks in Burkitt lymphoma cells, Myc-positive lymphoma and pancreatic ductal adenocarcinomas, and MINCR is highly expressed in brain, prostate, and testis [7]. At the post-transcriptional level, lncRNAs compete with microRNAs (miRs) to act as a “sponge” and that lncRNA functioning as a competing endogenous RNA (ceRNA) is a newly proposed hypothesis that has drawn increased attention [8]. In this study, lncRNA MINCR was found to bind to miR-223. Interestingly, overexpressed miR-223 suppresses FBXW7 expression in esophageal squamous cell carcinoma cells, then leading to abundant production of c-Myc and c-Jun proteins [9]. Recent evidence demonstrates that miR‑223 is effective in regulating chemotherapeutic drug sensitivity in non-small cell lung cancer [10]. In NPC, miRs play pivotal regulatory roles in cell growth, proliferation and radiosensitivity [11,12]. Importantly, differential expression of miR-223 is reported in serum of NPC patients [13]. Such statements encourage us to suppose the ceRNA network between MINCR and miR‑223 in NPC cell radioresistance with potential signaling pathway.

Materials and methods

Ethics statement

The study was performed with the approval of the Ethics Committee of First Hospital of Quanzhou Affiliated to Fujian Medical University. All participating patients subscribed the informed consent. Significant efforts were made to minimize the number of animals and their pains.

Tissue specimens

Tissue biopsy was obtained from 49 NPC patients, 16 patients with precarcinoma lesion (PL) and 34 patients with nasopharyngeal mucosa chronic inflammation (NMCI). They were admitted into the Department of Pathology in First Hospital of Quanzhou Affiliated to Fujian Medical University between January 2012 to January 2014. No patients had a medical history of other malignant tumors, radiotherapy or chemotherapy. Each NPC patient was given 10 Gy irradiation every week. Based on the Response Evaluation Criteria in Solid Tumors, NPC patients were assigned into responders (n = 21) and non-responders (n = 28) to irradiation. Their clinical stages were defined according to the 2002 AJCC/UICC staging classifications [14]. Of the 49 cases, three were at stage I, 13 at stage II, 16 at stage III, and 17 at stage IV. The overall survival (OS) was the duration from the initial date of treatment to date of death. The follow-up lasted for 60 months and was ended in case of tumor reoccurrence or death; otherwise, OS time was recorded to the last follow-up.

Cell culture

NPC cell lines, CNE2 and CNE2R, provided by American Type Culture Collection (ATCC, Manassas, VA, USA) were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% newborn calf serum at 37°C in a humidified condition with 5% CO2 and 95% air. The protein kinase B (AKT) inhibitor, GSK690693, was obtained from Selleck Chemicals (Houston, TX, USA).

Construction of overexpressing and interfering MINCR

Short interfering RNAs (siRNAs) (100 nM) specifically targeting MINCR were designed to construct MINCR-depleted CNE2R cells. The corresponding scramble siRNAs (100 nM) were delivered to NPC cells to serve as negative control (NC). The vectors containing MINCR (50 nM) were introduced for construction of MINCR-overexpressed NPC cells. All plasmids were provided by Shanghai GenePharma Co, Ltd (Shanghai, China). Subsequently, miR-223 mimic (50 nM) and ZEB1 vectors (50 nM) were transfected into MINCR-overexpressed CNE2 cells and MINCR-depleted CNE2R cells, respectively using LipofectamineTM 2000 (Invitrogen Inc., Carlsbad, CA, USA) as per the instructions, lasting for 48 hours.

2.5. mRNA and LncRNA reverse transcription polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissues and cells by the method of Trizol (Invitrogen, Carlsbad, CA, USA) and reversely transcribed into cDNA as per the instructions of PrimeScriptTM II 1st Strand cDNA Synthesis Kits (Takara, Dalian, China) [15]. RT-qPCR was conducted with the SYBR green Premix Ex Taq II (RR420A, Takara Holdings Inc., Kyoto, Japan) [16] on Applied Biosystems Step One Plus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). Each reaction was run for three times. Data were normalized to the fold change of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and relative expression of MINCR and ZEB1 was determined using the ΔΔCt method. Primer sequences are exhibited in Table 1.
Table 1.

Primer sequences of RT-qPCR.

PrimerSequence (5ʹ→3ʹ)
MINCRF: CCCAGTCTGAACTCACCATG
R: TTTGCCACATGGCACAGTAT
miR-223F: ACACTCCAGCTGGGACCCCATAAACTGTTT
R: TGGTGTCGTGGAGTCG
ZEB1F: ACTCTGATTCTACACCGC
R: TGTCACATTGATAGGGCTT
U6F: GCTTCGGCAGCACATATACTAA
R: AACGCTTCACGAATTTGCGT
β-actinF: ACAGTCAGCCGCATCTTCTT
R: GACAAGCTTCCCGTTCTCAG

Note: RT-qPCR, real-time quantitative polymerase chain reaction; miR-223, microRNA-223; F, forward; R, reverse.

Primer sequences of RT-qPCR. Note: RT-qPCR, real-time quantitative polymerase chain reaction; miR-223, microRNA-223; F, forward; R, reverse.

Colony formation assay

Cells were resuspended with RPMI-1640 medium (Gibco, Gaithersburg, MD, USA) in Luria-Bertani culture plate (D0110, Beijing Nobleryder Science and Technology Co., Ltd., Beijing, China). A total of 500 cells were seeded in the medium (10 cm) and cultured at 37°C with 5% CO2 for two weeks. Then cells were exposed to 0 Gy, 4 Gy and 8 Gy irradiation for 2 hours. After that, cells were fixed with 4% paraformaldehyde for 20 minutes, and then stained with crystal violet for 60 minutes. The plates were air dried to count clones with more than 50 cells under a microscope.

Cell counting kit-8 (CCK-8) assay

Cell proliferation after transfection was examined by a CCK-8 assay. In detail, cells were seeded into 96-well plates with 3 × 103 cells per well for 3 days, followed by being exposed to 8 Gy irradiation. Then, cells were incubated with 10 μL CCK-8 solution (5 mg/mL, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 4 hours. Two hours later, the medium in each well was added with 150 μL dimethyl sulfoxide (Sigma-Aldrich) to dissolve the formazan crystals. The optical density value was read at 490 nm using a microplate reader (Bio-Rad, Hercules, CA, USA) and the growth curves were drawn.

Flow cytometry

An apoptosis assay was performed using the fluorescein isothiocyanate Annexin V Apoptosis Detection Kit (KeyGen, Nanjing, Jiangsu, China) [17]. Propidium iodide was used with Annexin V to determine if cells were viable, apoptotic, or necrotic, and analyzed by flow cytometry (FACScan®) and CellQuest software (both from BD Biosciences, San Jose, CA, USA).

Subcellular localization of MINCR

The subcellular localization of MINCR was predicted using lncRNA subcellular localization data (lncatlas.crg.eu.) and verified with fluorescence in situ hybridization (FISH) using RiboTM lncRNA FISH Probe Mix (Green) (Ribo Biotech, Guangzhou, Guangdong, China). NPC cells (6 × 104/well) were mounted onto slides and fixed in 4% formaldehyde. Slides were pretreated with protease K (2 μg/mL), glycine and acetic anhydride, followed by pre-hybridization for 1 hour at 42°C and hybridization at 42°C using probes (250 μL, 300 ng/mL) against MICNR. Finally, slides were stained with phosphate-buffered saline with Tween-diluted 4ʹ,6-diamidino-2-phenylindole (DAPI). Finally, five random fields acquired from each slide were observed and photographed under a fluorescence microscope (Eclipse Ti microscope, Nikon Instruments, Chiyoda-ku, Tokyo, Japan).

Fractionation of nuclear and cytoplasmic RNA

The nuclear and cytoplasmic RNA fractions were isolated according to PARISTM Kit (Life Technologies, Inc., Gaithersburg, MD, USA). CNE2 cells were resuspended for 5–10 minutes in 500 µL cell fractionation buffer. The cytoplasmic nuclear fractions were separated by centrifugation at 500 g and 4°C for 5 minutes. The supernatant (cytoplasmic fractions) was put into a 2 mL sterile enzyme-free tube and then centrifuged. The pellet (nuclear fraction) was resuspended in 500 µL cell disruption buffer and centrifuged. The cytoplasmic and nuclear fractions were respectively immersed in 500 µL 2 × lysis/binding solution and centrifuged. Next, the factions were mixed with 500 µL absolute ethanol and then transferred into a filter cartridge, which was subsequently washed with Wash solution 1 and 2/3. Nuclear and cytoplasmic RNA were obtained after elution. MINCR expression was determined by RT-qPCR, with U6 used as the internal reference for nuclear RNA expression and GAPDH for cytoplasmic RNA expression. The primers are displayed in Table 1.

Dual luciferase reporter gene assay

Through online prediction software Starbase (http://starbase.sysu.edu.cn/) and TargetScan (http://www.targetscan.org/vert_72/), the binding sequence of miR-223 and MINCR and the binding sequence of miR-223 and 3’-untranslated region (3’UTR) of ZEB1 were predicted. The wild type (WT) plasmid and mutant type (MT) plasmid containing the binding sequence of MINCR and miR-223, the WT plasmid and MT plasmid containing the binding sequence of miR-223 and ZEB1 3ʹUTR were synthesized by Sangon Biotech (Shanghai) Co., Ltd (Shanghai, China). The synthesized plasmids were respectively inserted into pCMV-REPORTTM luciferase reporter vectors (Thermo Fisher Scientific Inc., Waltham, MA, USA). LipofectamineTM 2000 transfection kit (Invitrogen Inc., Carlsbad, CA, USA) was employed to co-transfect lncRNA MINCR with ZEB1 WT plasmid, ZEB1 MT plasmid, miR-223 mimic and miR NC into 293T cells. Twenty-four hours later, cells were lysed and luciferase activity was detected with Dual-Luciferase Reporter Assay System (Promega Corporation, Madison, Wisconsin, USA).

Biotinylated RNA pull-down assay

Cell lysates were treated with RNase-free DNase I (Sigma-Aldrich) and cultured with a mixture of biotinylated RNA fragments of miR-223 (1 µg) and streptavidin-coated magnetic beads (Sigma-Aldrich) at 4°C for 3 hours. After that, the RNA was extracted from the harvested RNA-RNA complexes for western blot analysis.

Western blot analysis

Cells were lysed in ice-cold radioimmunoprecipitation buffer containing protease inhibitor phenylmethylsulfonyl fluoride (1 mM). Equal protein samples (50 μg) were run on 10% sodium dodecyl sulfate -polyacrylamide gel electrophoresis (Bio-Rad, Hercules, CA, USA) and then transferred to polyvinylidene fluoride membranes (Amersham Pharmacia, Piscataway, NJ, USA). Next, western blots were probed with antibodies against ZEB1 (1:1,000; ab203829), AKT (1:1000; ab8805), p-AKT (1:10,000, ab81283), phosphoinositide-3-kinase (PI3K, 1:1000, ab191606), p-PI3K (1:1000, ab182651) and β-actin (1:5000; ab227387) (all purchased from Abcam, Cambridge, MA, USA) at 4°C overnight, and then probed with secondary antibody, horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G (IgG) (1:2,000; A0208; Beyotime Institute of Biotechnology, Shanghai, China). Each sample was repeated for three times. GAPDH served as a reference for normalization. At last, immunoblots were visualized with enhanced chemiluminescence (Amersham Pharmacia) and analyzed with ImageJ V1.48 software (National Institutes of Health, Bethesda, Maryland, USA).

Xenograft experiments

Nude mice (BALB/C nu/nu) (Chinese Academy of Medical Sciences, Beijing, China) were fed with autoclaved water and laboratory rodent chow. The culture medium (100 μL) was mixed with Matrigel (BD Biosciences) containing 3 × 106 CNE2R cells which were stably transfected si-MINCR or scramble siRNA, and then transplanted into the flanks of nude mice by subcutaneous injection. By the way, the tumor volume was measured every 5 days for totally 24 days and calculated as follows: Volume (mm3) = (a × b2)/2, where “a” indicated the largest diameter and “b” represented the perpendicular diameter. Once tumors reached about 70 mm3, the mice were randomly allocated into 3 groups (3 mice/group) and given 2 × 5 Gy irradiation.

Immunohistochemical staining

Tumor sections at 5 μm from NPC xenografts were stained with anti-p-AKT antibody (1:10,000, ab81283) and anti-Ki67 antibody (1:50, MIB-1, Immunotech, Marseille, France) at 4°C overnight and then reacted with anti-IgG secondary antibody (1:1,000; ab6721, Abcam) for 30 minutes. After that, visualization was performed using 3,3-diaminobezidine (DAB, DA1010, Solarbio, Beijing, China). Finally, 5 fields of view (200 ×) were randomly captured for each replicate under an inverted microscope (Nikon).

Statistical analysis

SPSS 21.0 (IBM Corp., Armonk, NY, USA) was applied for data analysis. Kolmogorov-Smirnov test showed whether the data were in normal distribution. The results were manifested as mean ± standard deviation. Comparison between the two groups was analyzed by unpaired t test, comparison among multiple groups was analyzed by one-way or two-way analysis of variance (ANOVA), and pairwise comparison after ANOVA was conducted by Sidak’s multiple comparisons test or Tukey’s multiple comparisons test. The log rank test was applied for post statistical analysis. The p value was obtained by two-tailed tests and p < 0.05 indicated significant difference.

Results

MINCR is upregulated in NPC and predicts poor prognosis

MINCR is reported to contribute to several types of cancers [18]. However, the role of MINCR in NPC tumorigenesis remains unknown. Thus, we analyzed nasopharyngeal mucosal tissues from 34 NMCI patients, nasopharyngeal PL tissues from 16 PL patients, and NPC biopsy tissues from 49 NPC patients. The results displayed highly expressed MINCR in NPC biopsy tissues (Figure 1(a)). Besides, NPC patients with high MINCR expression exhibited worse prognosis in the follow-up records (Figure 1(b)). Subsequently, 49 NPC patients, owing to irradiation effectiveness, were split into 2 groups, the resistant and sensitive groups. We analyzed the relationship between radiotherapy efficacy and MINCR level in NPC patients, and found that the higher MINCR level led to worse radiotherapy efficacy in NPC patients (Figure 1(c)). In order to determine the expression of MINCR and its clinical value in predicting radiotherapy efficacy on NPC patients, we evaluated the radiotherapy efficacy of MINCR on NPC by using receiver operator characteristic (ROC) curve and area under curve (AUC). The results showed that MINCR expression was of better prediction on radiotherapy efficacy in NPC patients (Figure 1(d)).
Figure 1.

MINCR is at a high level in NPC and predicts poor prognosis. a. MINCR expression in NMCI patients, PL patients and NPC patients detected by RT-qPCR; b. Relationship between MINCR expression and prognosis in NPC patients analyzed by Kalpan-Meier analysis (patients with high MINCR expression had 40.3 months median survival periods, while patients with low MINCR expression had 54.2 months median survival periods); c. The resistant group patients bore higher MINCR level determined by RT-qPCR; d. ROC analysis for prediction of MINCR level on radiotherapy efficacy (areas under the ROC curve: 0.719; sensitivity: 66.7% and specificity: 71.0%); e. Colony formation assay was performed to affirm CNE2R cells possessed with radioresistance compared to its parental cell CNE2; F. Relative MINCR level in CNE2R cells, CNE2 cells and nasopharyngeal epithial cell NP460 detected by RT-qPCR. Data were described as mean ± standard deviation. Data in panels A, C and E were analyzed by one-way ANOVA, followed by Sidak’s multiple comparisons test, or unpaired t test was used. *p < 0.05, **p < 0.01; In panel A, for NMCI patients, n = 34, for PL patients, n = 16 and for NPC patients, n = 49. In panel C, sensitive group contains 21 candidates and resistant group contains 28. In panel E and F, three independent experiments were performed. NPC, nasopharyngeal carcinoma; NMCI, nasopharyngeal mucosa chronic inflammation; PL, precarcinoma lesion; RT-qPCR, real-time quantitative polymerase chain reaction; ANOVA, analysis of variance.

MINCR is at a high level in NPC and predicts poor prognosis. a. MINCR expression in NMCI patients, PL patients and NPC patients detected by RT-qPCR; b. Relationship between MINCR expression and prognosis in NPC patients analyzed by Kalpan-Meier analysis (patients with high MINCR expression had 40.3 months median survival periods, while patients with low MINCR expression had 54.2 months median survival periods); c. The resistant group patients bore higher MINCR level determined by RT-qPCR; d. ROC analysis for prediction of MINCR level on radiotherapy efficacy (areas under the ROC curve: 0.719; sensitivity: 66.7% and specificity: 71.0%); e. Colony formation assay was performed to affirm CNE2R cells possessed with radioresistance compared to its parental cell CNE2; F. Relative MINCR level in CNE2R cells, CNE2 cells and nasopharyngeal epithial cell NP460 detected by RT-qPCR. Data were described as mean ± standard deviation. Data in panels A, C and E were analyzed by one-way ANOVA, followed by Sidak’s multiple comparisons test, or unpaired t test was used. *p < 0.05, **p < 0.01; In panel A, for NMCI patients, n = 34, for PL patients, n = 16 and for NPC patients, n = 49. In panel C, sensitive group contains 21 candidates and resistant group contains 28. In panel E and F, three independent experiments were performed. NPC, nasopharyngeal carcinoma; NMCI, nasopharyngeal mucosa chronic inflammation; PL, precarcinoma lesion; RT-qPCR, real-time quantitative polymerase chain reaction; ANOVA, analysis of variance. CNE2R was confirmed to be radioresistant cells at different dose of irradiation by colony formation assay (all p < 0.05) (Figure 1(e)). Subsequently, MINCR expression in normal nasopharyngeal epithelial cell line NP460, human NPC cell line CNE2 and radioresistant cell line CNE2R was determined by RT-qPCR. The result pointed out MINCR was notably overexpressed in radioresistant CNE2R cells (Figure 1(f)).

MINCR interference attenuates NPC cell radiosensitivity

To further verify the radio-sensitivity of MINCR to NPC cells, CNE2R cells interfering with MINCR expression and CNE2 cells overexpressing MINCR were constructed, and RT-qPCR verified the transfection was successful (all p < 0.05) (Figure 2(b)). Twelve days after CNE2 and CNE2R cells received irradiation at doses of 0, 4 and 8 Gy, colony formation assay showed that MINCR interference resulted in a decrease in radioresistance of NPC cells, and NPC cell proliferation was decreased further with the increase of irradiation dose (p < 0.05) (Figure 2(b)). Subsequently, we detected the proliferation of NPC cells after different treatments. The results inferred that interfering MINCR expression promoted NPC cell radiosensitivity (all p < 0.05) (Figure 2(c)). In addition, flow cytometry showed that silencing MINCR significantly increased apoptotic cells after irradiation (all p < 0.05) (Figure 2(d)). Briefly, NPC cells with interfering MINCR expression were more sensitive to irradiation.
Figure 2.

MINCR interference attenuates NPC cell radiosensitivity. Two siRNA targeted MINCR were transfected in CNE2R (si-MINCR-1 and si-MINCR-2 group) and an expression vector contained MINCR was transfected in CNE2 (Oe-MINCR group). Scramble siRNA (Mock group) and empty vector (Empty vector group) served as NC. a. RT-qPCR was performed to validate siRNA and expression vector transfection; b. Relative survival fraction and cell clones in CNE2 and CNE2R cells with silencing or overexpressing MINCR measured by colony formation assay; c. Optical density value of CNE2 and CNE2R cells with silencing or overexpressing MINCR measured by CCK-8 assay; d. Relative apoptosis of CNE2R and CNE2 cells with silencing or overexpressing MINCR measured by flow cytometry. Data were expressed as mean ± standard deviation. Data in panels A and D were analyzed with one-way ANOVA, followed by Sidak’s multiple comparisons test, while data in panels B and C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. NPC, nasopharyngeal carcinoma; siRNA, short interfering RNA; RT-qPCR, real-time quantitative polymerase chain reaction; CCK-8, cell counting kit-8; NC, negative control; ANOVA, analysis of variance.

MINCR interference attenuates NPC cell radiosensitivity. Two siRNA targeted MINCR were transfected in CNE2R (si-MINCR-1 and si-MINCR-2 group) and an expression vector contained MINCR was transfected in CNE2 (Oe-MINCR group). Scramble siRNA (Mock group) and empty vector (Empty vector group) served as NC. a. RT-qPCR was performed to validate siRNA and expression vector transfection; b. Relative survival fraction and cell clones in CNE2 and CNE2R cells with silencing or overexpressing MINCR measured by colony formation assay; c. Optical density value of CNE2 and CNE2R cells with silencing or overexpressing MINCR measured by CCK-8 assay; d. Relative apoptosis of CNE2R and CNE2 cells with silencing or overexpressing MINCR measured by flow cytometry. Data were expressed as mean ± standard deviation. Data in panels A and D were analyzed with one-way ANOVA, followed by Sidak’s multiple comparisons test, while data in panels B and C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. NPC, nasopharyngeal carcinoma; siRNA, short interfering RNA; RT-qPCR, real-time quantitative polymerase chain reaction; CCK-8, cell counting kit-8; NC, negative control; ANOVA, analysis of variance.

MINCR is sublocalized in the cytoplasm

The protein subcellular localization is of great importance for cell biology, system biology and drug breakthrough [19]. So we first predicted the subcellular localization of lncRNA MINCR through the LncATLAS database, and it turned out that MINCR was mainly in the cytoplasm (Figure 3(a)). Subsequently, we validated that MINCR was located in the cytoplasm of CNE2 cells by FISH experiments. The probes targeting MINCR in CNE2 cells were stained in green and the nucleus were stained in blue after DAPI staining (Figure 3(b)). Additionally, we extracted total RNA from CNE2 cells by fractionation of nuclear and cytoplasmic RNA, and detected the expression of MINCR in cytoplasm and nucleus respectively. The results showed that MINCR mainly existed in cytoplasm (p < 0.05) (Figure 3(c)).
Figure 3.

MINCR is sublocalized in the cytoplasm of CNE2 cells. a. Predicting subcellular localization of MINCR via the LncATLAS database; b. FISH experiments observed that probes targeting MINCR in CNE2 cells were stained in green and the nucleus were stained in blue. The merged image showed MINCR was sublocalized in cytoplasm in CNE2 cells; c. Nuclear and cytoplasmic expression of MINCR in CNE2 cells determined by RT-qPCR. Data were described as mean ± standard deviation, and representative of three independent experiments. Data in panel C were analyzed with two-way ANOVA, followed by and Tukey’s multiple comparison test. *, p < 0.05. FISH, fluorescence in situ hybridization; RT-qPCR, real-time quantitative polymerase chain reaction; ANOVA, analysis of variance.

MINCR is sublocalized in the cytoplasm of CNE2 cells. a. Predicting subcellular localization of MINCR via the LncATLAS database; b. FISH experiments observed that probes targeting MINCR in CNE2 cells were stained in green and the nucleus were stained in blue. The merged image showed MINCR was sublocalized in cytoplasm in CNE2 cells; c. Nuclear and cytoplasmic expression of MINCR in CNE2 cells determined by RT-qPCR. Data were described as mean ± standard deviation, and representative of three independent experiments. Data in panel C were analyzed with two-way ANOVA, followed by and Tukey’s multiple comparison test. *, p < 0.05. FISH, fluorescence in situ hybridization; RT-qPCR, real-time quantitative polymerase chain reaction; ANOVA, analysis of variance.

MINCR functions as a cerna of mir-223 to regulate ZEB1

How MINCR participates in radiotherapy resistance of NPC cells has not been reported. To study this, we first predicted a large number of miRs that bound to MINCR through StarBase [20]. As reported, overexpression of miR-223 can promote radiosensitivity of U87 cells by downregulating Ataxia-telangiectasia mutated (ATM) axis [21]. We suspected that MINCR may reduce NPC cell radiosensitivity by binding to miR-223. Therefore, according to the binding sequence predicted by Starbase, we designed a luciferase reporter plasmid based on cytomegalovirus (CMV), which contained the binding sites of miR-223 mimic and miR-NC with WT-MINCR or MT-MINCR, respectively. The results showed that miR-223 could specifically bind to MINCR (Figure 4(a,b)). Subsequently, RNA pull-down assay was performed in order to further verify the binding relationship between miR-223 and MINCR. The experimental results were in line with our expectations (all p < 0.05) (Figure 4(c)). Besides, RT-qPCR revealed that miR-223 expression was negatively correlated with MINCR in 49 NPC tissues (Figure 4(d)). We further detected miR-223 expression in NPC cells with overexpressed or silenced MINCR, and the results were identical to the above ones (all p < 0.05) (Figure 4(e)).
Figure 4.

MINCR sponges miR-223 and miR-223 targets ZEB1. a. MINCR contains the putative miR recognition sites complementary to miR-223 via the Starbase prediction; b. Luciferase reporter plasmid containing MINCR-WT or MINCR-MT was transfected into CNE2 cells together with miR-223 in parallel with miR-NC plasmid vector; c. The enrichment of miR-223 on MINCR was detected by RNA pull-down assay, relative to antisense-oligos; d. Plot analysis of the relationship between MINCR and miR-223 in the 49 NPC patients; e. Relative expression of miR-223 in NPC cells with overexpressed or silenced MINCR determined by RT-qPCR; f. miR-223 targeting site in ZEB1 3’UTR predicted by TargetScan; g. Luciferase reporter plasmid containing ZEB1-WT or ZEB1-MT was transfected into CNE2 cells together with miR-223 in parallel with miR-NC plasmid vector; h. The enrichment of miR-223 on ZEB1 was detected by RNA pull down assay, relative to antisense-oligos; i. Plot analysis of the relationship between MINCR and ZEB1 in the 49 NPC patients; j. Relative ZEB1 mRNA expression in NPC cells with overexpressed or silenced MINCR determined by RT-qPCR; K. Relative ZEB1 protein level in NPC cells with overexpressed or silenced MINCR determined by western blot analysis. The level of miR-223 was normalized to U6 while the ZEB1 mRNA and MINCR level was normalized to GAPDH. In panels B, D, F and H, all experiments were performed for three times, and one-way ANOVA was used to determine statistical significance. In panels C and G, Pearson’s correlation coefficient test was utilized. n = 49. Relative to the empty vector group, *, p < 0.05; compared with the mock group, #, p < 0.05. miR-223, microRNA-223; WT, wild type; MT, mutant type; NPC, nasopharyngeal carcinoma; RT-qPCR, real-time quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance.

MINCR sponges miR-223 and miR-223 targets ZEB1. a. MINCR contains the putative miR recognition sites complementary to miR-223 via the Starbase prediction; b. Luciferase reporter plasmid containing MINCR-WT or MINCR-MT was transfected into CNE2 cells together with miR-223 in parallel with miR-NC plasmid vector; c. The enrichment of miR-223 on MINCR was detected by RNA pull-down assay, relative to antisense-oligos; d. Plot analysis of the relationship between MINCR and miR-223 in the 49 NPC patients; e. Relative expression of miR-223 in NPC cells with overexpressed or silenced MINCR determined by RT-qPCR; f. miR-223 targeting site in ZEB1 3’UTR predicted by TargetScan; g. Luciferase reporter plasmid containing ZEB1-WT or ZEB1-MT was transfected into CNE2 cells together with miR-223 in parallel with miR-NC plasmid vector; h. The enrichment of miR-223 on ZEB1 was detected by RNA pull down assay, relative to antisense-oligos; i. Plot analysis of the relationship between MINCR and ZEB1 in the 49 NPC patients; j. Relative ZEB1 mRNA expression in NPC cells with overexpressed or silenced MINCR determined by RT-qPCR; K. Relative ZEB1 protein level in NPC cells with overexpressed or silenced MINCR determined by western blot analysis. The level of miR-223 was normalized to U6 while the ZEB1 mRNA and MINCR level was normalized to GAPDH. In panels B, D, F and H, all experiments were performed for three times, and one-way ANOVA was used to determine statistical significance. In panels C and G, Pearson’s correlation coefficient test was utilized. n = 49. Relative to the empty vector group, *, p < 0.05; compared with the mock group, #, p < 0.05. miR-223, microRNA-223; WT, wild type; MT, mutant type; NPC, nasopharyngeal carcinoma; RT-qPCR, real-time quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance. To further identify the downstream gene of miR-223 in radiotherapy resistance, we screened the target genes of miR-223 through Starbase and TargetScan websites, among which we focused on ZEB1. ZEB1 gene, as a transcription factor, can promote the metastasis of cancer cells [22]. Moreover, ZEB1 can enhance the radioresistance of cancer cells by promoting epithelial-mesenchymal transition (EMT) of cancer cells [23,24]. According to the prediction website Starbase, miR-223 and ZEB1 3ʹ-UTR had specific binding sites (all p < 0.05) (Figure 4(f)). Based on this sequence, we designed a luciferase reporter plasmid based on CMV, which contained the binding sites of miR-223 mimic and miR-NC with WT or MT ZEB1 3ʹ-UTR, respectively. The results showed that miR-223 could specifically bind to ZEB1 (Figure 4(g)). Subsequently, RNA pull-down assay was performed to further verify the binding relationship between miR-223 and ZEB1. The experimental results were in line with our expectations (all p < 0.05) (Figure 4(h)). Besides, RT-qPCR revealed that ZEB1 expression was positively correlated with MINCR in 49 NPC tissues (Figure 4(i)). We further detected ZEB1 expression in NPC cells with overexpressed or silenced MINCR, and the results were consistent with the above ones (all p < 0.05) (Figure 4(e)).

miR-223 attenuates NPC cell irradiation resistance induced by MINCR overexpression

To further confirm the roles of miR-223 and ZEB1 in radioresistance of NPC cells, we constructed the miR-223 mimic, miR-NC and ZEB1 overexpression vectors and empty plasmids, and transfected them into CNE2 cells with overexpressed MINCR and CNE2R cells with silenced MINCR, respectively. The expression of miR-223 and ZEB1 in CNE2 and CNE2R cells was detected by RT-qPCR, and the transfection was confirmed to be successful (all p < 0.05) (Figure 5(a)).
Figure 5.

miR-223 attenuates NPC cell irradiation resistance induced by MINCR overexpression. miR-223 mimic or expression vector containing ZEB1 was transfected into CNE2/Oe-MINCR or CNE2R/si-MINCR-1 and CNE2R/si-RNA-2, respectively. miR-NC (mock group) and empty vector (empty vector group) served as NC. a. Relative miR-223 expression in CNE2 cells with overexpressing MINCR and miR-223, and relative ZEB1 expression in CNE2R cells with silencing MINCR and overexpressing ZEB1 measured by RT-qPCR to validate transfection efficiency; b. Relative survival fraction and cell clones in CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by colony formation assay; c. Optical density value of CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by CCK-8 assay; D. Relative apoptosis in CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by flow cytometry. Data were manifested as mean ± standard deviation. Data in panels A, B and D were analyzed with one-way ANOVA and Sidak’s multiple comparisons test, while data in panel C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. miR-223, microRNA-223; NPC, nasopharyngeal carcinoma; CCK-8, cell counting kit-8; RT-qPCR, real-time quantitative polymerase chain reaction; NC, negative control; Oe, overexpression; ANOVA, analysis of variance.

miR-223 attenuates NPC cell irradiation resistance induced by MINCR overexpression. miR-223 mimic or expression vector containing ZEB1 was transfected into CNE2/Oe-MINCR or CNE2R/si-MINCR-1 and CNE2R/si-RNA-2, respectively. miR-NC (mock group) and empty vector (empty vector group) served as NC. a. Relative miR-223 expression in CNE2 cells with overexpressing MINCR and miR-223, and relative ZEB1 expression in CNE2R cells with silencing MINCR and overexpressing ZEB1 measured by RT-qPCR to validate transfection efficiency; b. Relative survival fraction and cell clones in CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by colony formation assay; c. Optical density value of CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by CCK-8 assay; D. Relative apoptosis in CNE2 cells with overexpressed MINCR and miR-223 and in CNE2R cells with silenced MINCR and overexpressed ZEB1 detected by flow cytometry. Data were manifested as mean ± standard deviation. Data in panels A, B and D were analyzed with one-way ANOVA and Sidak’s multiple comparisons test, while data in panel C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. miR-223, microRNA-223; NPC, nasopharyngeal carcinoma; CCK-8, cell counting kit-8; RT-qPCR, real-time quantitative polymerase chain reaction; NC, negative control; Oe, overexpression; ANOVA, analysis of variance. After 6 Gy doses of radiation, the proliferation and apoptosis of CNE2 and CNE2R were detected. The results suggested overexpression of miR-223 decreased the radioresistance induced by MINCR upregulation, while ZEB1 overexpression in MINCR-silenced CNE2R cells enhanced the radioresistance (all p < 0.05) (Figure 5(b–d)). Taken together, miR-223 attenuated NPC cell irradiation resistance.

MINCR interference promotes NPC cell radiosensitivity by inactivating the AKT/PI3K signaling pathway

In 2013, Chen et al reported that ZEB1 was positively correlated with p-AKT expression in NPC patients, and in their in vitro experiments, the sensitivity of NPC cells was significantly improved by adding GSK690693, an AKT inhibitor [25]. In light of this, we detected levels of p-AKT and p-PI3K in CNE2 and CNE2R cells in each group. The results showed that MINCR enhanced the function of ZEB1 and activated the AKT/PI3K signaling pathway (all p < 0.05) (Figure 6(a)) through competitively binding to miR-223. Subsequently, we added AKT specific inhibitor GSK690693 to CNE2 cells overexpressed MINCR to perform functional rescue experiments. The results showed that inhibiting AKT activation partially eliminated the increased radioresistance of CNE2 cells induced by overexpressed MINCR (all p < 0.05) (Figure 6(b–d)). To sum up, MINCR enhanced ZEB1 function and activated the AKT/PI3K signaling pathway, thus increasing NPC cell radioresistance.
Figure 6.

MINCR promoted NPC cell autophagy via AKT/PI3K signaling pathway activation. a. Western blot analysis was utilized for determining AKT/PI3K pathway content in CNE2 and CNE2R cell. Then, CNE2/Oe-MINCR was treated with AKT inhibitor GSK690693; b. Relative survival fraction and cell clones in CNE2 cells with overexpressing MINCR and AKT inhibitor detected by colony formation assay; c. Optical density value of CNE2 cells with overexpressing MINCR and AKT inhibitor detected by CCK-8 assay; d. Relative apoptosis in CNE2 cells with overexpressing MINCR and AKT inhibitor detected by flow cytometry. Data were manifested as mean ± standard deviation. Data in panels D were analyzed with one-way ANOVA and Sidak’s multiple comparisons test, while data in panel A, B and C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. miR-223, microRNA-223; AKT, protein kinase B; PI3K, phosphoinositide-3- kinase; NPC, nasopharyngeal carcinoma; Oe, overexpression; CCK-8, cell counting kit-8; ANOVA, analysis of variance.

MINCR promoted NPC cell autophagy via AKT/PI3K signaling pathway activation. a. Western blot analysis was utilized for determining AKT/PI3K pathway content in CNE2 and CNE2R cell. Then, CNE2/Oe-MINCR was treated with AKT inhibitor GSK690693; b. Relative survival fraction and cell clones in CNE2 cells with overexpressing MINCR and AKT inhibitor detected by colony formation assay; c. Optical density value of CNE2 cells with overexpressing MINCR and AKT inhibitor detected by CCK-8 assay; d. Relative apoptosis in CNE2 cells with overexpressing MINCR and AKT inhibitor detected by flow cytometry. Data were manifested as mean ± standard deviation. Data in panels D were analyzed with one-way ANOVA and Sidak’s multiple comparisons test, while data in panel A, B and C were analyzed with two-way ANOVA and Tukey’s multiple comparisons test. *, p < 0.05, **, p < 0.01. Three independent experiments were performed. miR-223, microRNA-223; AKT, protein kinase B; PI3K, phosphoinositide-3- kinase; NPC, nasopharyngeal carcinoma; Oe, overexpression; CCK-8, cell counting kit-8; ANOVA, analysis of variance.

MINCR knockdown reduces radiotherapy resistance of CNE2R cells in vivo

Subsequently, in order to further determine the effect of MINCR on NPC cell growth in vivo, CNE2R cells in nude mice and CNE2R xenograft tumor models stably transfected with MINCR-siRNA were constructed. After radiotherapy, the growth rate and weight of MINCR-siRNA tumors decreased significantly (all p < 0.05) (Figure 7(a)). Moreover, the immunohistochemical results of p-AKT and Ki67 showed that the contents of p-AKT and Ki67 decreased significantly after interfering MINCR expression (all p < 0.05) (Figure 7(b–c)).
Figure 7.

MINCR knockdown reduces irradiation resistance of CNE2R cells in vivo. CNE2R cells stably MINCR-siRNA and scramble siRNA were inoculated subcutaneously into BALB/c nude mice at 5 × 106 per mouse (n = 3 in each group). Tumor growth was measured continuously every 5 days, and 20 days later, tumor growth was monitored every 3 days. Irradiation treatments were performed with 5 Gy of irradiation on day 15 and 25 after subcutaneously implantation. At 35 days post-implantation, the mice were euthanized by carbon dioxide asphyxiation. a. Relative tumor volume in CNE2R xenograft tumor models stably transfected with MINCR-siRNA; b. Relative tumor weight in CNE2R xenograft tumor models stably transfected with MINCR-siRNA; c, Relative content of p-AKT- and Ki67-positive tumor cells detected by immunohistochemical staining. In panels A and C, two-way ANOVA was used to determine statistical significance of quantification of immunostaining, whereas in panel B one-way ANOVA was used. *, p < 0.05, compared to the mock group. AKT, protein kinase B; ANOVA, analysis of variance.

MINCR knockdown reduces irradiation resistance of CNE2R cells in vivo. CNE2R cells stably MINCR-siRNA and scramble siRNA were inoculated subcutaneously into BALB/c nude mice at 5 × 106 per mouse (n = 3 in each group). Tumor growth was measured continuously every 5 days, and 20 days later, tumor growth was monitored every 3 days. Irradiation treatments were performed with 5 Gy of irradiation on day 15 and 25 after subcutaneously implantation. At 35 days post-implantation, the mice were euthanized by carbon dioxide asphyxiation. a. Relative tumor volume in CNE2R xenograft tumor models stably transfected with MINCR-siRNA; b. Relative tumor weight in CNE2R xenograft tumor models stably transfected with MINCR-siRNA; c, Relative content of p-AKT- and Ki67-positive tumor cells detected by immunohistochemical staining. In panels A and C, two-way ANOVA was used to determine statistical significance of quantification of immunostaining, whereas in panel B one-way ANOVA was used. *, p < 0.05, compared to the mock group. AKT, protein kinase B; ANOVA, analysis of variance.

Discussion

Although chemotherapy and radiotherapy are widely used in single interventions or in combination with other anticancer drugs for NPC, drug resistance is still a leading impediment to successful treatment and ultimately causes recurrence and poor prognosis [1,12]. It has been well established for the importance of the ceRNA network between lncRNA-mRNA interactions in tumorigenesis of cancers [26]. Inspired by that finding, we evaluated the ceRNA regulatory network between MINCR and miR‑223 in NPC biological process with the potential signaling pathway. As expected, we found that MINCR sponged miR-223 to increase ZEB1 expression and activate the AKT/PI3K axis, and thus diminishing NPC cell radiosensitivity. We firstly observed MINCR was highly expressed in NPC tissues and radioresistant CNE2R cells, and NPC patients with high MINCR expression had worse prognosis and worse radiotherapy efficacy. There was no study about the effects of MINCR on NPC, but several researches on the role of MINCR in other cancers could be referred. For instance, upregulation of MINCR in gallbladder cancer was markedly relevant to larger tumor sizes, lymph node metastasis, and shorter overall survival time [18]. Besides, MINCR interference resulted in decreased proliferation and radioresistance of NPC cells, and increased apoptotic cells after irradiation. MINCR knockdown is bound up with impaired cell cycle progression and reduced cellular proliferation [7]. MINCR depletion suppressed cell growth and invasion and stimulated cell apoptosis, by inhibiting the EMT in oral squamous cell carcinoma cells, and interrelated with lower TNM stage and less distant metastasis [27]. Since MINCR is a newly discovered lncRNA, there is little research about its mechanism in cancer cell radioresistance. But the carcinogenic role of other lncRNA in NPC has been widely reported. For example, MALAT1 depletion could reinforce NPC cell radiosensitivity by working as a ceRNA to modulate slug expression through competition for miR-1 [6]. More importantly, we found the beneficial effects of MINCR interference on reduced NPC cell radioresistance were achieved via miR-223, ZEB1 and the AKT/PI3K axis. Specifically, miR-223 could bind to MINCR, and it was negatively correlated with MINCR in NPC tissues. The ceRNA network involving MINCR was also discovered in gallbladder cancer cell, in which MINCR could act as a sponge for miR-26a-5p to regulate EZH2 [18]. Additionally, miR-223 could bind to ZEB1, and ZEB1 expression was positively correlated with MINCR in NPC tissues. Extrogenous miR-223 in CNE2 cells would decrease the ability of colony formation, migration and invasion by reducing its another target gene MAFB [28]. miR-223 overexpression attenuated NPC cell irradiation resistance. Consistently, downregulation of miR-223 was observed in serum of NPC patients in a prior study, serving as a tumor suppressor gene [13]. Similarly, miR-223-3p overexpression increased resistance to anticancer agents in human head and neck cell lines [29]. In NPC cell lines exposed to ionizing radiation, ZEB1 expression increased and inhibited AKT activation increased radiation sensitivity [25]. Forced overexpression of ZEB1 dramatically reduced the radiosensitivity induced by NEAT1 knockout and NEAT1 positively regulated ZEB1 expression through miR-204, which was in line with our results [30]. Moreover, inhibited AKT activation eliminated the radioresistance of CNE2 cells induced by overexpressed MINCR. AKT activation has been demonstrated to correlate with the metastasis, mortality, and radiotherapy resistance of NPC cells [31]. Interestingly, inhibition of ZIP4 inhibited metastasis, dissemination and invasion, and enhanced the radiosensitivity in human NPC cells by inactivating the PI3K/AKT axis [32]. miR-223 regulated the growth, invasion and chemotherapeutic resistance of glioblastoma stem cells to temozolomide via the PI3K/AKT signaling pathway [33]. In a word, we provided compelling evidences to state that lncRNA MINCR worked as a ceRNA for miR-223 to positively regulate ZEB1, and MINCR silencing strengthened the NPC cell radiosensitivity through the miR-223/ZEB1 axis and inactivating the PI3K/AKT axis. This study may offer new perspective for further understanding of NPC and finding new targets for effective therapies. Analysis of abovementioned results may give the chance to create the background for future clinical investigation and application in NPC. Thus, more studies in radiosensitivity of NPC cells are required in the future to develop clinical values.
  32 in total

1.  The role of MALAT1/miR-1/slug axis on radioresistance in nasopharyngeal carcinoma.

Authors:  Chuan Jin; Bingchuan Yan; Qin Lu; Yanmin Lin; Lei Ma
Journal:  Tumour Biol       Date:  2015-10-20

2.  The long non-coding RNA NEAT1 regulates epithelial to mesenchymal transition and radioresistance in through miR-204/ZEB1 axis in nasopharyngeal carcinoma.

Authors:  Yaoyong Lu; Tao Li; Ganbao Wei; Liangbo Liu; Qinsheng Chen; Lufei Xu; Kunqiang Zhang; Dehao Zeng; Rongwei Liao
Journal:  Tumour Biol       Date:  2016-03-28

3.  MiR-1204 sensitizes nasopharyngeal carcinoma cells to paclitaxel both in vitro and in vivo.

Authors:  Xiaowei Peng; Peiguo Cao; Jingjing Li; Dong He; Shuang Han; Jianda Zhou; Guolin Tan; Wei Li; Fenghui Yu; Jianjun Yu; Zan Li; Ke Cao
Journal:  Cancer Biol Ther       Date:  2015       Impact factor: 4.742

4.  MicroRNA-223 enhances radiation sensitivity of U87MG cells in vitro and in vivo by targeting ataxia telangiectasia mutated.

Authors:  Liping Liang; Ji Zhu; Nicholas G Zaorsky; Yun Deng; Xingzhong Wu; Yong Liu; Fangqi Liu; Guoxiang Cai; Weilie Gu; Lijun Shen; Zhen Zhang
Journal:  Int J Radiat Oncol Biol Phys       Date:  2014-03-15       Impact factor: 7.038

5.  Activation of AKT is associated with metastasis of nasopharyngeal carcinoma.

Authors:  Ying Liu; Long-Hua Chen; Ya-Wei Yuan; Qi-Sheng Li; Ai-Ming Sun; Jian Guan
Journal:  Tumour Biol       Date:  2011-11-25

6.  Binding of vascular anticoagulant alpha (VAC alpha) to planar phospholipid bilayers.

Authors:  H A Andree; C P Reutelingsperger; R Hauptmann; H C Hemker; W T Hermens; G M Willems
Journal:  J Biol Chem       Date:  1990-03-25       Impact factor: 5.157

7.  Long non-coding RNA MINCR promotes gallbladder cancer progression through stimulating EZH2 expression.

Authors:  Shou-Hua Wang; Yong Yang; Xiao-Cai Wu; Ming-Di Zhang; Ming-Zhe Weng; Di Zhou; Jian-Dong Wang; Zhi-Wei Quan
Journal:  Cancer Lett       Date:  2016-06-23       Impact factor: 8.679

8.  Systematical analysis of lncRNA-mRNA competing endogenous RNA network in breast cancer subtypes.

Authors:  Shunheng Zhou; Lihong Wang; Qian Yang; Haizhou Liu; Qianqian Meng; Leiming Jiang; Shuyuan Wang; Wei Jiang
Journal:  Breast Cancer Res Treat       Date:  2018-02-01       Impact factor: 4.872

9.  miR-324-3p suppresses migration and invasion by targeting WNT2B in nasopharyngeal carcinoma.

Authors:  Yong Liu; Yuanzheng Qiu; Chao Liu; Guo Li; Nianting Yang; Zhongwu Su; Shuiting Zhang; Tengbo Deng; Shuling Ren; Shanhong Lu; Yongquan Tian
Journal:  Cancer Cell Int       Date:  2017-01-03       Impact factor: 5.722

10.  Inhibition of ZIP4 reverses epithelial-to-mesenchymal transition and enhances the radiosensitivity in human nasopharyngeal carcinoma cells.

Authors:  Qi Zeng; Yi-Min Liu; Jun Liu; Jian Han; Jian-Xin Guo; Shun Lu; Xue-Mei Huang; Ping Yi; Jin-Yi Lang; Peng Zhang; Chun-Ting Wang
Journal:  Cell Death Dis       Date:  2019-08-05       Impact factor: 8.469

View more
  14 in total

1.  Suppression of LINC00460 mediated the sensitization of HCT116 cells to ionizing radiation by inhibiting epithelial-mesenchymal transition.

Authors:  Jiani Zhang; Lixin Ding; Gaofeng Sun; Huacheng Ning; Ruixue Huang
Journal:  Toxicol Res (Camb)       Date:  2020-04-24       Impact factor: 3.524

2.  miR-26a-5p suppresses nasopharyngeal carcinoma progression by inhibiting PTGS2 expression.

Authors:  Binlin Cai; Xiu Qu; Dan Kan; Yi Luo
Journal:  Cell Cycle       Date:  2022-01-25       Impact factor: 4.534

3.  LncRNA HOTAIR influences cell proliferation via miR-130b/PTEN/AKT axis in IDD.

Authors:  Wen-Kang Chen; Han-Jing Zhang; Ming-Xiang Zou; Cheng Wang; Yi-Guo Yan; Xin-Li Zhan; Xue-Lin Li; Wen-Jun Wang
Journal:  Cell Cycle       Date:  2022-01-02       Impact factor: 4.534

Review 4.  The Mechanism of Long Non-coding RNA in Cancer Radioresistance/Radiosensitivity: A Systematic Review.

Authors:  Wenhan Wu; Shijian Zhang; Jia He
Journal:  Front Pharmacol       Date:  2022-05-05       Impact factor: 5.988

5.  LncRNA PSMA3-AS1 Promotes Lung Cancer Growth and Invasion via Sponging MiR-4504.

Authors:  Fangfang Li; LianLing Yu; Jun Zhu
Journal:  Cancer Manag Res       Date:  2020-07-01       Impact factor: 3.989

6.  IncRNA ZFAS1 contributes to the radioresistance of nasopharyngeal carcinoma cells by sponging hsa-miR-7-5p to upregulate ENO2.

Authors:  Jiaojiao Peng; Feng Liu; Hong Zheng; Qi Wu; Shixi Liu
Journal:  Cell Cycle       Date:  2020-12-20       Impact factor: 4.534

Review 7.  MicroRNAs and Their Influence on the ZEB Family: Mechanistic Aspects and Therapeutic Applications in Cancer Therapy.

Authors:  Milad Ashrafizadeh; Hui Li Ang; Ebrahim Rahmani Moghadam; Shima Mohammadi; Vahideh Zarrin; Kiavash Hushmandi; Saeed Samarghandian; Ali Zarrabi; Masoud Najafi; Reza Mohammadinejad; Alan Prem Kumar
Journal:  Biomolecules       Date:  2020-07-12

8.  LINC02532 Contributes to Radiosensitivity in Clear Cell Renal Cell Carcinoma through the miR-654-5p/YY1 Axis.

Authors:  Xiaoguang Zhou; Bowen Zeng; Yansheng Li; Haozhou Wang; Xiaodong Zhang
Journal:  Molecules       Date:  2021-11-22       Impact factor: 4.411

Review 9.  Biomarkers in Human Peripheral Blood Mononuclear Cells: The State of the Art in Amyotrophic Lateral Sclerosis.

Authors:  Orietta Pansarasa; Maria Garofalo; Eveljn Scarian; Francesca Dragoni; Jessica Garau; Rosalinda Di Gerlando; Luca Diamanti; Matteo Bordoni; Stella Gagliardi
Journal:  Int J Mol Sci       Date:  2022-02-25       Impact factor: 5.923

10.  Long noncoding RNA SLC9A3‑AS1 increases E2F6 expression by sponging microRNA‑486‑5p and thus facilitates the oncogenesis of nasopharyngeal carcinoma.

Authors:  Jiansheng Li; Dongzhi Li; Xianhua Zhang; Cuijuan Li; Fengjuan Zhu
Journal:  Oncol Rep       Date:  2021-06-24       Impact factor: 3.906

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.