Literature DB >> 31758608

GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor-suppressor gene TGFβR2 in colorectal cancer.

Sho Nambara1, Takaaki Masuda1, Yuta Kobayashi1, Kuniaki Sato1, Taro Tobo2, Kensuke Koike1, Miwa Noda1, Yushi Ogawa3, Yousuke Kuroda1, Shuhei Ito1, Hidetoshi Eguchi1, Keishi Sugimachi1,4, Koshi Mimori1.   

Abstract

Chromosome 7q (Ch.7q) is clonally amplified in colorectal cancer (CRC). We aimed to identify oncogenes on Ch.7q that are overexpressed through DNA copy number amplification and determine the biological and clinical significance of these oncogenes in CRC. We identified general transcription factor 2I repeat domain-containing protein 1 (GTF2IRD1) as a potential oncogene using a CRC dataset from The Cancer Genome Atlas with a bioinformatics approach. We measured the expression of GTF2IRD1 in 98 patients with CRC using immunohistochemistry and RT-quantitative PCR (RT-qPCR). The biological effects of GTF2IRD1 expression were explored by gene set enrichment analysis (GSEA). Next, we undertook in vitro cell proliferation and cell cycle assays using siGTF2IRD1-transfected CRC cells. We further investigated the oncogenic mechanisms through which GTF2IRD1 promoted CRC progression. Finally, we assessed the clinical significance of GTF2IRD1 expression by RT-qPCR. GTF2IRD1 was overexpressed in tumor cells and liver metastatic lesions. The GSEA revealed a positive correlation between GTF2IRD1 expression and cell cycle progression-related genes. GTF2IRD1 knockdown inhibited cell proliferation and induced cell cycle arrest in Smad4-mutated CRC. GTF2IRD1 downregulated the expression of the gene encoding transforming growth factor β receptor 2 (TGFβR2), a tumor-suppressor gene in Smad4-mutated CRC. On multivariate analysis, high GTF2IRD1 expression was an independent poor prognostic factor. Clinicopathological analysis showed that GTF2IRD1 expression was positively correlated with liver metastasis. In conclusion, GTF2IRD1 promoted CRC progression by downregulating TGFβR2 and could be a prognostic biomarker on Ch.7q in CRC. GTF2IRD1 could also be a novel oncogene in CRC.
© 2019 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Entities:  

Keywords:  zzm321990GTF2IRD1zzm321990; zzm321990TGFβR2zzm321990; cell cycle; colorectal cancer; oncogene

Mesh:

Substances:

Year:  2019        PMID: 31758608      PMCID: PMC7004548          DOI: 10.1111/cas.14248

Source DB:  PubMed          Journal:  Cancer Sci        ISSN: 1347-9032            Impact factor:   6.716


INTRODUCTION

Colorectal cancer (CRC) is a leading cause of tumor‐associated morbidity and mortality worldwide, and its incidence continues to rise.1, 2 Despite recent advances in therapeutic approaches, including chemotherapy and molecular targeted therapy, relapse is frequently found among patients with CRC, particularly for those with advanced disease.3 Intratumor heterogeneity (ITH), defined as molecular and cellular heterogeneity within a single tumor, is thought to cause the development of resistance against chemotherapy and leads to therapeutic failure because the presence of distinct subpopulations of cells with different sensitivities to chemotherapeutic drugs increases the risk of resistance and recurrence.4 Therefore, identification of oncogenes expressed in all tumor cells within a single tumor is essential for the discovery of promising therapeutic targets despite ITH. Amplification of chromosome 7 is frequently found in CRC and colorectal adenoma tissue.5, 6, 7 Moreover, we showed that amplification of the long arm of chromosome 7 (Ch.7q) exists in all regions of a single tumor by undertaking multiregional copy number analysis of tumor tissues in CRC,8, 9 suggesting that amplification of Ch.7q is a fundamental and predominant event and that this region harbors oncogenes that affect the tumorigenesis of CRC. We recently established a screening system using a bioinformatics approach with public datasets to identify candidate oncogenes in CRC. Using this system, we identified phosphoserine phosphatase (PSPH) and eIF5‐mimic protein 1 (5MP1) as potential oncogenes on Ch.7p in CRC.10, 11 Furthermore, we found that their expression was significantly associated with cell cycle progression genes and was an independent poor prognostic factor in patients with CRC. This system enables us to comprehensively search for oncogenes in CRC. In this study, we aimed to identify novel potential oncogenes on Ch.7q in CRC using this screening system and to clarify the biological and clinical significance of the identified oncogenes in CRC.

MATERIALS AND METHODS

Selection of candidate genes

We obtained RNA sequencing data and DNA copy number data from 615 patients with CRC from The Cancer Genome Atlas (TCGA) from the Broad Institute’s Firehose (http://gdac.broadinstitute.org/runs/stddata__2015_08_21/data/COADREAD/20150821/). The RNA sequencing data also included expression profiles from 51 paired normal colon samples. Using these data, we extracted candidate genes from 819 genes on Ch.7q that showed positive correlations between DNA copy numbers and mRNA expression levels (cut‐off correlation coefficient, 0.4) (criteria 1) and showed overexpression in tumor tissues compared with normal tissues (more than 2‐fold change) (criteria 2).

Cell culture

Human CRC cell lines (SW620, COLO205, COLO320, DLD1, HCT116, and LoVo) were purchased from the cell bank at RIKEN BioResource Center (Tsukuba). SW620, COLO205, and DLD1 cells were maintained in RPMI‐1640. COLO320 and HCT116 cells were maintained in DMEM. LoVo cells were maintained in Ham’s F12 medium. All media contained 10% FBS with 100 U/mL penicillin and 100 U/mL streptomycin sulfate. All CRC cells were cultured in a humidified 5% CO2 incubator at 37°C.

Total RNA extraction and RT‐quantitative PCR

Total RNA from tissues and cell lines was extracted using a modified acid guanidinium thiocyanate‐phenol‐chloroform extraction (AGPC) method with Isogen (Nippon Gene). Reverse transcription was carried out using 8 µg total RNA with M‐MLV reverse transcriptase (Invitrogen), according to the manufacturer’s instructions. Quantitative PCR (qPCR) was undertaken using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) as previously described.12 The expression levels of general transcription factor 2I repeat domain‐containing protein 1 (GTF2IRD1) and transforming growth factor β receptor 2 (TGFβR2) mRNA were normalized to GAPDH mRNA as an internal control. Gene expression was presented as the values relative to the expression level of the cDNA from Human Universal Reference Total RNA (Clontech). The primer sequences for qPCR were as follows: GTF2IRD1, forward 5′‐GTGCCAGCCAAAGACAGCAG‐3′ and reverse 5′‐TGGCCATTGCACGAGTGAGA‐3′; TGFβR2, forward 5′‐TGGACCCTACTCTGTCTGTGGA‐3′ and reverse 5′‐CCCACTGCATTACAGCGAGAT‐3′; p21, forward 5′‐GCGACTGTGATGCGCTAATG‐3′ and reverse 5′‐ GAAGGTAGAGCTTGGGCAGG‐3′; and GAPDH, forward, 5′‐TTGGTATCGTGGAAGGACTCTA‐3′ and reverse, 5′‐TGTCATATTTGGCAGGTT‐3′.

Protein extraction

For total protein extraction, cells were lysed in lysis buffer (25 mmol/L Tris‐HCl [pH 7.5], 150 mmol/L NaCl, 0.2 mmol/L EDTA, 0.1% NP‐40, 5% glycerol, and proteinase inhibitor cocktail).

Immunohistochemical analysis

Immunohistochemistry for GTF2IRD1 in CRC cases with liver metastasis was carried out on formalin‐fixed, paraffin‐embedded tissues as previously described.13 The primary Ab against GTF2IRD was used at a dilution of 1:100. Rabbit polyclonal Abs to GTF2IRD were purchased from Sigma‐Aldrich. Tumor histology was independently reviewed by an experienced research pathologist (T.T.) at Kyushu University.

Immunoblotting analysis

Immunoblotting analysis was carried out as previously described.14 Briefly, equal amounts of protein (35 μg) were electrophoresed on 4%‐20% Tris‐glycine gels and then electroblotted onto Immobilon‐P Transfer Membranes (Merck Millipore) at 70 V for 4 hours at room temperature. Nonspecific binding sites were blocked with blocking buffer (TBS and 0.1% Tween‐20 with 5% nonfat milk powder) for 1 hour at room temperature, and the blots were incubated with specific primary Abs in blocking buffer (anti‐GTF2IRD1, anti‐TGFβR2, and anti‐phospho‐cyclin‐dependent kinase [CDK] 2 [Tyr15] Abs at a 1:250 dilution; anti‐phospho‐Smad2, anti‐Smad2, anti‐p21, anti‐phospho retinoblastoma (pRb), anti‐bone morphogenetic protein receptor type 1B (BMPR1b), and anti‐β‐actin Abs at a 1:1000 dilution) at 4°C overnight. After washing, the blots were incubated with an appropriate secondary Ab conjugated with HRP for 1 hour at room temperature. After washing, the detection was undertaken using an ImageQuant LAS 4000 Mini system (GE Healthcare Japan). Rabbit polyclonal Abs targeting GTF2IRD1 were purchased from Atlas Antibodies. Rabbit polyclonal Abs targeting TGFβR2 and mouse mAbs to β‐actin were purchased from Santa Cruz Biotechnology. Rabbit polyclonal Abs targeting phospho‐Smad2, Smad2, p21, and pRb were purchased from Cell Signaling Technology. Rabbit polyclonal Abs targeting BMPR1b were purchased from GeneTex. Rabbit polyclonal Abs targeting phospho‐CDK2 (Tyr15) were purchased from Abcam. Protein concentrations were quantified using Bradford protein assays.

GTF2IRD1 siRNA transfection

GTF2IRD1‐specific siRNA (Silencer Predesigned siRNA: sense CAUCGUCCAUGACAAGUCATT and antisense UGACUUGUCAUGGACGAUGGA) and negative control siRNA (Silencer Negative Control 1 siRNA) were purchased from Ambion. Small interfering RNA oligonucleotides were transfected into SW620 or COLO205 cells using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions.

Colony formation assay

Cells (1000 cells/well) were seeded in 6‐well plates. After incubation for 24 hours followed by siRNA transfection, the cells were cultured for an additional 14 days, and the colonies were stained using a Differential Quik Stain Kit (Sysmex) according to the manufacturer’s instructions. Visible colonies were photographed using a Chemiluminescence Imaging FUSION SOLO S (VILBER). Colony counts were determined using ImageJ software (NIH).

Cell proliferation assay

Colorectal cancer cell proliferation was assessed using an MTT assay kit (Roche Applied Science) as previously described.15 After incubation for 24 hours, followed by siRNA transfection, the cells were cultured for an additional 0‐5 days, and the absorbance of the samples was measured.

Cell cycle assay

Nocodazole (an inhibitor of tubulin assembly; 5 μg/mL) was added 48 hours after siRNA transfection, and the cells were incubated for an additional 16 hours. Cells were harvested, washed with PBS, and fixed in ice‐cold 70% ethanol at −20°C overnight. Samples were then washed with PBS and stained with propidium iodide containing RNase A for 20 minutes at 37°C. Cell cycle distribution was measured by flow cytometry (Sony).

In vitro invasion assay

Cell invasion capacities were assessed using the BD BioCoat Tumor Invasion System, 24 Multiwell (BD Bioscience) as previously described.15

Patients with CRC and collection of clinical samples

Primary CRC samples and paired normal tissues were obtained from 98 patients who underwent surgery at Kyushu University Beppu Hospital and affiliated hospitals from 1992 to 2007. All patients had a histological diagnosis of CRC and were closely followed at 3‐month intervals. The median follow‐up period was 3.0 years. All patients were treated in accordance with the Japanese Society of Cancer of the Colon and Rectum Guidelines for the Treatment of Colorectal Cancer. Written informed consent was obtained from all patients, and the Institutional Review Board of our university approved this study. Sample collection was carried out as previously described.14 Data on patient age, sex, histology, tumor depth of invasion, lymph node metastasis, lymphatic invasion, venous invasion, liver metastasis, and clinical stage were obtained from clinical and pathological records.

Cancer Cell Line Encyclopedia data analysis

We obtained normalized mRNA expression data and DNA copy number data from 58 available CRC cell lines from the Cancer Cell Line Encyclopedia (CCLE) dataset (http://www.broadinstitute.org/ccle/home). Candidate gene mRNA expression and DNA copy number data were extracted from this reference.

Gene set enrichment analysis

The correlations between GTF2IRD1 expression and previously annotated gene expression signatures were analyzed by applying gene set enrichment analysis (GSEA).16 We acquired CRC expression profiles from the NCBI’s Gene Expression Omnibus database (accession code GSE7963) and analyzed the expression profiles using GSEA. Gene sets of GTF2IRD1 targets were extracted from C2 curated gene sets in the Broad Institute database (http://www.broadinstitute.org/gsea/msigdb/collections.jsp).

The Cancer Genome Atlas data analysis

Paired RNA sequencing and survival data of 620 available patients with CRC were obtained from TCGA (http://cancergenome.nih.gov/). GTF2IRD1 mRNA expression, Smad4 mutation status, and survival data were extracted from this reference.

Statistical analysis

For continuous variables, data are expressed as mean ± SD, and statistical analyses were carried out using Student’s t tests. The degree of linearity was estimated by Pearson’s correlation coefficient. Categorical variables were compared using χ2 tests or Fisher’s exact tests. Overall survival was estimated using the Kaplan‐Meier method, and survival curves were compared using log‐rank tests. Based on the levels of GTF2IRD1 mRNA expression in our dataset, cases were divided into 2 groups by the minimum P value approach, a comprehensive method to find the optimal risk separation cut‐off point in continuous gene expression measurement.17 Data analyses were undertaken using JMP 12 software (SAS Institute) and R software version 3.1.1 (The R Foundation for Statistical Computing).18 Clinicopathological factors and clinical stages were classified using the TNM system of classification.

RESULTS

GTF2IRD1 is a potential oncogene in CRC

We identified 8 genes that satisfied the criteria described above. Among the 8 genes, we focused on GTF2IRD1 (Figure 1A) because this gene has been reported to promote mammary tumor growth.19 GTF2IRD1 mRNA expression in tumor tissues was 4.57‐fold higher than that in normal tissues (P < .0005; Figure 1B). GTF2IRD1 mRNA expression and copy numbers were positively correlated in TCGA dataset (R = .48, P < .001; Figure 1C). Consistent with this result, there was a significant positive correlation between GTF2IRD1 mRNA expression and copy numbers in the CCLE dataset (R = .35, P < .05; Figure 1C). Next, we undertook immunohistochemical analysis to confirm GTF2IRD1 protein expression in CRC tumor cells from our hospital. GTF2IRD1 was stained more intensely in the nuclei and cytoplasm of CRC tumor cells than in those of normal colon cells (Figure 1D). Notably, GTF2IRD1 showed similar strong staining in tumor cells from liver metastatic lesions from the same patients (Figure 1D). Moreover, RT‐qPCR analysis also showed that GTF2IRD1 mRNA expression in tumor tissues was significantly higher than that in paired normal tissues (P < .0005; Figure 1B). Indeed, GTF2IRD1 mRNA expression levels in tumor tissues were higher than those in normal tissues in 91.3% of 98 patients with CRC. In addition, GSEA revealed a positive correlation between GTF2IRD1 mRNA expression and the expression of a gene set involved in cell cycle progression (P < .05; Figure 1E). These findings suggested that GTF2IRD1 was a novel oncogene in CRC.
Figure 1

Identification of candidate oncogenes on chromosome 7q in colorectal cancer (CRC). A, Schematic diagram of the strategy for candidate oncogene selection. Criteria 1: Positive correlations between DNA copy numbers and mRNA expression levels (cut‐off correlation coefficient, 0.4). Criteria 2: Overexpressed in tumor tissues compared with normal tissues (>2‐fold change). B, Left, GTF2IRD1 mRNA expression between 615 CRC tissues and 51 normal colon tissues in The Cancer Genome Atlas (TCGA) dataset. Right, GTF2IRD1 mRNA expression in 98 CRC tissues and paired normal colon tissues in our dataset by RT‐quantitative PCR. ***P < .0005. C, Left, Correlation between GTF2IRD1 copy number and GTF2IRD1 mRNA expression in TCGA dataset. Right, Correlation between GTF2IRD1 copy number and GTF2IRD1 mRNA expression in the Cancer Cell Line Encyclopedia dataset. R, Pearson’s correlation coefficient. D, Immunohistochemical staining for GTF2IRD1 in normal colon and tumor tissues (left), and liver metastatic lesion tissues (right) in the same patients. Original magnification, 40× and 200×. E, Gene set enrichment analysis of the expression of GTF2IRD1 and cell cycle‐related genes using reference gene sets in the CRC dataset. KEGG, Kyoto Encyclopedia of Genes and Genomes; N, normal tissue; NES, Normalized Enrichment Score; T, tumor tissue

Identification of candidate oncogenes on chromosome 7q in colorectal cancer (CRC). A, Schematic diagram of the strategy for candidate oncogene selection. Criteria 1: Positive correlations between DNA copy numbers and mRNA expression levels (cut‐off correlation coefficient, 0.4). Criteria 2: Overexpressed in tumor tissues compared with normal tissues (>2‐fold change). B, Left, GTF2IRD1 mRNA expression between 615 CRC tissues and 51 normal colon tissues in The Cancer Genome Atlas (TCGA) dataset. Right, GTF2IRD1 mRNA expression in 98 CRC tissues and paired normal colon tissues in our dataset by RT‐quantitative PCR. ***P < .0005. C, Left, Correlation between GTF2IRD1 copy number and GTF2IRD1 mRNA expression in TCGA dataset. Right, Correlation between GTF2IRD1 copy number and GTF2IRD1 mRNA expression in the Cancer Cell Line Encyclopedia dataset. R, Pearson’s correlation coefficient. D, Immunohistochemical staining for GTF2IRD1 in normal colon and tumor tissues (left), and liver metastatic lesion tissues (right) in the same patients. Original magnification, 40× and 200×. E, Gene set enrichment analysis of the expression of GTF2IRD1 and cell cycle‐related genes using reference gene sets in the CRC dataset. KEGG, Kyoto Encyclopedia of Genes and Genomes; N, normal tissue; NES, Normalized Enrichment Score; T, tumor tissue

GTF2IRD1 promotes proliferation of CRC cells

The results of GSEA motivated us to investigate whether GTF2IRD1 regulated cell cycle progression and consequent tumor proliferation. Accordingly, RT‐qPCR analysis was undertaken to quantify GTF2IRD1 mRNA expression in several CRC cell lines. Endogenous GTF2IRD1 mRNA expression was higher in SW620 and COLO205 cells (Figure 2A). Therefore, SW620 and COLO205 cells were selected for subsequent experiments. To examine the biological roles of GTF2IRD1 in CRC, we carried out knockdown experiments using siRNA. siGTF2IRD1 induced significant downregulation of GTF2IRD1 mRNA expression in SW620 and COLO205 cells (Figure 2B). Immunoblotting analysis confirmed a substantial decrease in GTF2IRD1 protein in siGTF2IRD1‐transfected SW620 and COLO205 cells (Figure 2B).
Figure 2

Effects of GTF2IRD1 knockdown on cell proliferation in colorectal cancer (CRC) cells. A, RT‐quantitative PCR (RT‐qPCR) analysis of GTF2IRD1 mRNA expression in 6 CRC cell lines. B, Left, RT‐qPCR for GTF2IRD1 mRNA expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. ***P < .0005. Right, Immunoblotting for total protein expression of GTF2IRD1 in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. C, Left, Colony formation assays. SW620 and COLO205 cells were cultured after GTF2IRD1 siRNA or control siRNA transfection for 14 d. Right, Total number of colonies. *P < .05, **P < .005. D, MTT proliferation assays. Proliferation rates of GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells were compared with those of control siRNA‐transfected cells (NC). *P < .05, **P < .005, ***P < .0005

Effects of GTF2IRD1 knockdown on cell proliferation in colorectal cancer (CRC) cells. A, RT‐quantitative PCR (RT‐qPCR) analysis of GTF2IRD1 mRNA expression in 6 CRC cell lines. B, Left, RT‐qPCR for GTF2IRD1 mRNA expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. ***P < .0005. Right, Immunoblotting for total protein expression of GTF2IRD1 in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. C, Left, Colony formation assays. SW620 and COLO205 cells were cultured after GTF2IRD1 siRNA or control siRNA transfection for 14 d. Right, Total number of colonies. *P < .05, **P < .005. D, MTT proliferation assays. Proliferation rates of GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells were compared with those of control siRNA‐transfected cells (NC). *P < .05, **P < .005, ***P < .0005 The effects of GTF2IRD1 on proliferation in CRC were examined by colony formation assays and MTT assays. GTF2IRD1 knockdown significantly reduced colony formation (Figure 2C). The MTT assays showed that GTF2IRD1 knockdown significantly inhibited cancer cell proliferation (Figure 2D). In contrast, GTF2IRD1 knockdown did not affect invasion potential (Figure S1).

GTF2IRD1 promoted cell cycle progression in CRC cells

Next, we undertook cell cycle analysis. GTF2IRD1 knockdown significantly decreased the S phase fraction (Figure 3A). Furthermore, there was a significant increase in the G1/S phase fraction in GTF2IRD1 knockdown cells in the presence of nocodazole, which prevents reentry of cells into G1 phase (Figure 3B). Immunoblotting analysis showed a substantial increase in phosphorylation of CDK2 at Tyr15 and decrease in phosphorylation of Rb, indicating G1/S arrest, in GTF2IRD1‐knockdown cells (Figure 3C). Taken together, these data indicated that GTF2IRD1 promoted cell proliferation by promoting cell cycle progression in CRC.
Figure 3

Effects of GTF2IRD1 knockdown on the cell cycle in colorectal cancer cells. A, Cell cycle distributions were analyzed by flow cytometry. *P < .05, **P < .005. B, Cell cycle distributions in the presence of nocodazole were analyzed by flow cytometry. ***P < .0005. C, Immunoblotting for phospho‐cyclin‐dependent kinase 2 (CDK2) (Tyr15) and pRb in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells (NC)

Effects of GTF2IRD1 knockdown on the cell cycle in colorectal cancer cells. A, Cell cycle distributions were analyzed by flow cytometry. *P < .05, **P < .005. B, Cell cycle distributions in the presence of nocodazole were analyzed by flow cytometry. ***P < .0005. C, Immunoblotting for phospho‐cyclin‐dependent kinase 2 (CDK2) (Tyr15) and pRb in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells (NC)

GTF2IRD1 downregulates TGFβR2

Expression of TGFβR2, a well‐known tumor suppressor gene in CRC, is downregulated by GTF2IRD1 in mouse embryonic fibroblasts. 20, 21 We initially evaluated the expression of this gene using siGTF2IRD1‐transfected SW620 and COLO205 cells. TGFβR2 mRNA and protein expression levels were significantly higher in siGTF2IRD1‐transfected cells than in mock‐transfected cells (Figure 4A,B). To further test whether TGFβR2 was a downstream target of GTF2IRD1, we measured phospho‐Smad2 levels in GTF2IRD1‐knockdown cells. Immunoblotting analysis showed that phospho‐Smad2 levels were significantly higher in siGTF2IRD1‐transfected cells. Furthermore, there was a strong increase in p21 mRNA and protein expression (Figure 4A,B), which is upregulated by activation of TGFβ. These data indicated that GTF2IRD1 downregulated membrane TGFβR2 levels, resulting in reduced TGFβ activity.
Figure 4

GTF2IRD1 downregulated the TGFβR2 gene in colorectal cancer (CRC) cells. A, RT‐quantitative PCR for TGFβR2 and p21 mRNA expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells (NC). ***P < .0005. B, Immunoblotting for TGFβR2, BMPR1b, phospho‐SMAD2, SMAD2, and p21 protein expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. C, Overall survival rate in patients with CRC according to GTF2IRD1 mRNA expression in tumor tissues in our dataset. D, Schema indicating that overexpression of GTF2IRD1 promotes cell cycle progression and tumor proliferation

GTF2IRD1 downregulated the TGFβR2 gene in colorectal cancer (CRC) cells. A, RT‐quantitative PCR for TGFβR2 and p21 mRNA expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells (NC). ***P < .0005. B, Immunoblotting for TGFβR2, BMPR1b, phospho‐SMAD2, SMAD2, and p21 protein expression in GTF2IRD1 siRNA‐transfected SW620 and COLO205 cells and control siRNA‐transfected cells. C, Overall survival rate in patients with CRC according to GTF2IRD1 mRNA expression in tumor tissues in our dataset. D, Schema indicating that overexpression of GTF2IRD1 promotes cell cycle progression and tumor proliferation Bone morphogenetic protein (BMP) is a member of the TGFβ superfamily, and BMPR1b is a BMP signal receptor. It is well known that TGFβ and BMP signals play an opposing role in kidney disease22 and bone formation.23 These motivated us to assess the expression of BMPR1b by GTF2IRD1‐knockdown experiments. Levels of BMPR1b expression were significantly lower in siGTF2IRD1‐transfected cells than in mock‐transfected cells (Figure 4B). This result suggested that GTF2IRD1 upregulated membrane BMPR1b levels.

GTF2IRD1 promotes proliferation of Smad4‐mutated CRC cells

It is well known that the Smad signaling pathway is composed of the TGFβR2, TGFβR1, and Smad proteins. The cytoplasmic Smad2 and Smad3 proteins are phosphorylated by TGFβ signal through TGFβR2 and TGFβR1, which allows them to form a heteromeric complex with Smad4. This Smad complex is translocated into the nucleus and activates gene transcription, including p21. Our experimental data showed that GTF2IRD1 downregulated TGFβR2 expression, resulting in the downregulation of phospho‐Smad2 and p21 expression. However, SW620 and COLO205 harbor loss of function mutation of Smad4,24 indicating that the TGFβ signal pathway is inactivated in these cells. Thus, we undertook the cell proliferation assay and immunoblotting analysis using Smad4‐wild CRC cells, COLO320, whose endogenous GTF2IRD1 mRNA expression was near to SW620 and COLO205 cells (Figure 2A). Unexpectedly, GTF2IRD1 knockdown did not upregulate colony formation (Figure S2A). The MTT assays showed that GTF2IRD1 knockdown did not promote cancer cell proliferation (Figure S2B). The TGFβR2 and phospho‐Smad2 protein expression levels in Smad4‐wild cells was higher as well as Smad4‐mutated cells, but p21 protein expression levels were lower in siGTF2IRD1‐transfected WT cells than in mock‐transfected WT cells (Figure S2c), indicating that GTF2IRD1 downregulated TGFβR2 expression, resulting in reduced p21 expression in Smad4‐mutated CRC, but not in Smad4‐wild CRC.

High expression of GTF2IRD1 mRNA predicts poor prognosis in CRC patients

Because our experimental data suggested that GTF2IRD1 was associated with tumor aggressiveness in CRC, we assessed the prognostic and clinical significance of GTF2IRD1 mRNA expression in CRC. First, we evaluated the survival rates according to GTF2IRD1 mRNA expression in patients with CRC. The overall survival rate in patients in the high GTF2IRD1 mRNA expression group was significantly lower than that in patients in the low expression group in our dataset (P < .0005; Figure 4C). In the univariate analysis, poor histology, higher T factor (≥SE), lymph node metastasis, lymphovascular invasion, liver metastasis, and high GTF2IRD1 mRNA expression were significantly associated with a lower overall survival rate (Table 1). The multivariate analysis indicated that liver metastasis (P < .05) and high GTF2IRD1 mRNA expression (P < .05) were independent poor prognostic factors in CRC (Table 1). Also, the survival rates according to Smad4 mutation status in patients with CRC were examined using TCGA dataset because our experimental data suggested that GTF2IRD1 showed malignant potential in Smad4‐mutated CRC. As expected, the overall survival rate in patients in the high GTF2IRD1 mRNA expression group was significantly lower than that in patients in the low expression group in Smad4‐mutated CRC cases (Figure S3A). In Smad4‐wild CRC cases, there was no significant difference in the overall survival rate between high and low GTF2IRD1 mRNA expression group (Figure S3B). These results imply that GTF2IRD1 acts as an oncogene in the Smad4‐mutated CRC case, but not in the Smad4‐wild CRC case.
Table 1

Univariate and multivariate analysis of clinicopathological factors affecting overall survival rate in colorectal cancer patients

FactorUnivariate analysisMultivariate analysis
RR95% CI P valueRR95% CI P value
Age, >65/≤65 years1.8530.843‐4.178.124
Sex, male/female2.0270.856‐5.568.112
Histology grade: well, moderate/others0.1880.071‐0.651.012* 0.2750.091‐1.059.059
T factor, ≤SS/≥SE0.1930.078‐0.438<.001* 0.5120.181‐1.389.189
Lymph node metastasis, absent/present0.1890.069‐0.449<.001* 0.5810.187‐1.669.314
Lymphatic invasion, absent/present0.3490.154‐0.768.009* 0.6330.235‐1.703.362
Venous invasion, absent/present0.2250.101‐0.534.001* 0.3920.144‐1.072.068
Liver metastasis, absent/present0.0910.041‐0.219<.001* 0.2290.074‐0.691.009*
GTF2IRD1 mRNA expression, low/high0.2690.089‐0.664.003* 0.3360.103‐0.914.032*

Abbreviations: CI, confidence interval; RR, relative risk; SE, serosa; SS, subserosa.

Statistically significant.

Univariate and multivariate analysis of clinicopathological factors affecting overall survival rate in colorectal cancer patients Abbreviations: CI, confidence interval; RR, relative risk; SE, serosa; SS, subserosa. Statistically significant.

Clinicopathological significance of GTF2IRD1 mRNA expression in CRC

Next, we examined the association between GTF2IRD1 mRNA expression and clinicopathological factors in patients with CRC from our hospital (Table 2). The high GTF2IRD1 mRNA expression group (n = 53) had a higher frequency of liver metastasis (P < .05) compared with the low expression group (n = 45), suggesting that CRC cells with high expression of GTF2IRD1 should grow faster than with the low expression at metastatic regions, including liver, resulting in early clinical detection of metastasis of GTF2IRD1‐high expressed CRC cells because GTF2IRD1 can facilitate cell proliferation of CRC. There were no significant associations between GTF2IRD1 mRNA expression and age, sex, poor histology, depth of invasion, lymph node metastasis, lymphatic invasion, venous invasion, or clinical stage.
Table 2

Correlation between GTF2IRD1 mRNA expression of tumor tissues and clinicopathological factors in colorectal cancer

FactorsLow (n = 45)High (n = 53) P value
Number (%)Number (%)
Age (years)
<6516 (35.6)24 (45.3).329
≥6529 (64.4)29 (54.7)
Sex
Male32 (71.1)31 (58.5).194
Female13 (28.9)22 (41.5)
Histology
Well/moderate42 (93.3)49 (92.4).866
Others3 (6.7)4 (7.6)
Depth of invasion
≤SS28 (62.2)32 (60.4).852
≥SE17 (37.8)21 (39.6)
Lymph node metastasis
Absent29 (64.4)27 (50.9).178
Present16 (35.6)26 (49.1)
Lymphatic invasion
Absent30 (66.7)31 (58.5).405
Present15 (33.3)22 (41.5)
Venous invasion
Absent38 (84.4)43 (81.1).666
Present7 (15.6)10 (18.9)
Liver metastasis
Absent44 (97.8)44 (83.0).016*
Present1 (2.2)9 (17.0)
UICC TNM stage
Ⅰ, Ⅱ27 (60.0)25 (47.2).205
Ⅲ, Ⅳ18 (40.0)28 (52.8)

Abbreviations: SE, serosa; SS, subserosa.

Statistically significant.

Correlation between GTF2IRD1 mRNA expression of tumor tissues and clinicopathological factors in colorectal cancer Abbreviations: SE, serosa; SS, subserosa. Statistically significant.

DISCUSSION

In this study, we identified GTF2IRD1 as a driver gene on Ch.7q of CRC using our bioinformatics approach and determined the biological and clinical significance of GTF2IRD1 expression in CRC. To the best of our knowledge, this is the first study to provide evidence that GTF2IRD1 might act as a novel oncogene in CRC. GTF2IRD1 is a member of the GTF2I gene family, which encodes a set of multifunctional transcription factors. GTF2IRD1 is located in the Williams‐Beuren syndrome critical region 7q11.23.25, 26 This syndrome is a genetic disorder associated with multiple systemic abnormalities, including craniofacial dysmorphology and several symptoms, such as hypertension and anxiety.27 Additional studies have reported that there is a positive correlation between the expression of GTF2IRD1 and that of cell cycle progression‐related genes and genes involved in the noncanonical Wnt‐calcium pathway, which is known to modulate migration.28, 29 Consistent with these data, our GSEA revealed that GTF2IRD1 expression in CRC was positively correlated with cell cycle‐related gene sets, and in vitro analysis showed that GTF2IRD1 promoted cell cycle progression and consequently accelerated cell proliferation. Our clinical study showed that GTF2IRD1 was overexpressed due to copy number amplification at Ch.7q in CRC. The expression of GTF2IRD1 was positively associated with the malignant pathological phenotype. Furthermore, high expression of GTF2IRD1 was an independent poor prognostic factor in CRC. Huo et al revealed that high GTF2IRD1 expression correlated with poor overall survival in patients with breast cancer, lung cancer, and ovarian cancer.19 These clinical findings strongly supported that GTF2IRD1 is a tumor‐promoting oncogene in human cancers, including CRC. Moreover, high GTF2IRD1 expression could be a novel biomarker of poor prognosis in patients with CRC. Next, we assessed the mechanisms through which GTF2IRD1 promoted CRC progression. We found that GTF2IRD1 downregulated TGFβR2 expression, resulting in reduced TGFβ activity in Smad4‐mutated CRC (Figure 4D). Our schema was strongly supported by the fact that suppression of TGFβ activity accelerated cell cycle progression and consequent cell proliferation.30, 31 Mutational inactivation of TGFβR2 occurs in approximately 30% of CRCs and promotes the formation of CRC by inhibiting the tumor‐suppressor activity of the TGFβ signaling pathway.21, 32 In a recent paper, GTF2IRD1 was reported to repress obesity‐associated adipose tissue fibrosis and improve systemic glucose homeostasis by suppressing the TGFβ signaling pathway.33 Loss of chromosome 18q21 including Smad4 has been detected in up to 60% of CRC, and Smad4 was reported to harbor loss of function mutation frequently in CRC,34, 35 suggesting that Smad4 is dysfunctional in the majority of CRC. Ijichi et al reported that p21 was upregulated through Smad2/3‐dependent transcriptional activation through a Smad4‐independent manner in Smad4‐null pancreatic cancer cells.36 This report suggested a novel mechanism of p21 regulation that Smad4 is not involved. In our study, p21 expression was downregulated in Smad4‐mutated CRC cells, but not in Smad4‐wild CRC cells, suggesting that GTF2IRD1 acts as an oncogene possibly in a Smad4‐independent manner in Smad4‐mutated CRC cases, but not in Smad4‐wild CRC cases. Survival analysis according to Smad4 mutation status supported our hypothesis described above. Our results and the reports suggested that downregulation of TGFβR2 could be an important pathway in Smad4‐mutated CRC formation and progression, but not in Smad4‐wild CRC, resulting in the difference of malignant phenotype between Smad4‐mutated and Smad4‐wild CRC. Further studies will be required to confirm this. Recently, some reports have focused on the cross‐talk between TGFβ signal and the BMP signaling pathway in the progression of cancers. BMP7 attenuates TGFβ‐mediated tumor suppression in proliferation or invasion in prostate cancer or breast cancer respectively.37, 38 In our study, GTF2IRD1 downregulated TGFβR2, but upregulated BMPR1b expression in CRC cells, suggesting that the upregulation of BMPR1b by GTF2IRD1 might indirectly decrease TGFβR2 expression, resulting in suppression of TGFβ signal (Figure 4D). Some limitations exist in this study. First, only COLO320 was available as Smad4‐wild CRC cells for in vitro analysis. Second, we could not identify the novel signal mediator regulating p21 instead of Smad4. Further in vitro and in vivo experiments are required to clarify these mechanisms. In summary, our study identified GTF2IRD1 as a novel oncogene on Ch.7q and showed that GTF2IRD1 promoted cell cycle progression by downregulation of TGFβR2 in CRC. Furthermore, because overexpression of GTF2IRD1 due to copy number amplification of Ch.7q is considered to be a universal driver event present in all CRC cells, GTF2IRD1 could be a therapeutic target to overcome ITH in patients with CRC.

DISCLOSURE

No potential conflicts of interest were disclosed. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  38 in total

1.  Single nucleotide polymorphism array profiling identifies distinct chromosomal aberration patterns across colorectal adenomas and carcinomas.

Authors:  Peter Zarzour; Lies Boelen; Fabio Luciani; Dominik Beck; Anuratha Sakthianandeswaren; Dmitri Mouradov; Oliver M Sieber; Nicholas J Hawkins; Luke B Hesson; Robyn L Ward; Jason W H Wong
Journal:  Genes Chromosomes Cancer       Date:  2015-02-27       Impact factor: 5.006

Review 2.  Targeting TGF-β Signaling in Cancer.

Authors:  Selcuk Colak; Peter Ten Dijke
Journal:  Trends Cancer       Date:  2017-01-03

3.  Clonal origin of trisomy for chromosome 7 in the epithelial compartment of colon neoplasia.

Authors:  J Herbergs; J W Arends; E M Bongers; F C Ramaekers; A H Hopman
Journal:  Genes Chromosomes Cancer       Date:  1996-06       Impact factor: 5.006

4.  GTF2IRD1 in craniofacial development of humans and mice.

Authors:  May Tassabehji; Peter Hammond; Annette Karmiloff-Smith; Pamela Thompson; Snorri S Thorgeirsson; Marian E Durkin; Nicholas C Popescu; Timothy Hutton; Kay Metcalfe; Agnes Rucka; Helen Stewart; Andrew P Read; Mark Maconochie; Dian Donnai
Journal:  Science       Date:  2005-11-03       Impact factor: 47.728

5.  SMAD4 mutations in colorectal cancer probably occur before chromosomal instability, but after divergence of the microsatellite instability pathway.

Authors:  K L Woodford-Richens; A J Rowan; P Gorman; S Halford; D C Bicknell; H S Wasan; R R Roylance; W F Bodmer; I P Tomlinson
Journal:  Proc Natl Acad Sci U S A       Date:  2001-07-31       Impact factor: 11.205

6.  Decreased Expression of Fructose-1,6-bisphosphatase Associates with Glucose Metabolism and Tumor Progression in Hepatocellular Carcinoma.

Authors:  Hidenari Hirata; Keishi Sugimachi; Hisateru Komatsu; Masami Ueda; Takaaki Masuda; Ryutaro Uchi; Shotaro Sakimura; Sho Nambara; Tomoko Saito; Yoshiaki Shinden; Tomohiro Iguchi; Hidetoshi Eguchi; Shuhei Ito; Kotaro Terashima; Katsumi Sakamoto; Masakazu Hirakawa; Hiroshi Honda; Koshi Mimori
Journal:  Cancer Res       Date:  2016-04-06       Impact factor: 12.701

7.  Overexpression of CXCR7 Is a Novel Prognostic Indicator in Gastric Cancer.

Authors:  Sho Nambara; Tomohiro Iguchi; Eiji Oki; Patrick Tan; Yoshihiko Maehara; Koshi Mimori
Journal:  Dig Surg       Date:  2016-12-10       Impact factor: 2.588

8.  Cyclin-dependent kinase 1 gene expression is associated with poor prognosis in gastric carcinoma.

Authors:  Taka-Aki Masuda; Hiroshi Inoue; Koujiro Nishida; Hideto Sonoda; Yasuji Yoshikawa; Yoshihiro Kakeji; Tohru Utsunomiya; Masaki Mori
Journal:  Clin Cancer Res       Date:  2003-11-15       Impact factor: 12.531

9.  Smad4-independent regulation of p21/WAF1 by transforming growth factor-beta.

Authors:  Hideaki Ijichi; Motoyuki Otsuka; Keisuke Tateishi; Tsuneo Ikenoue; Takayuki Kawakami; Fumihiko Kanai; Yoshihiro Arakawa; Naohiko Seki; Kiyoshi Shimizu; Kohei Miyazono; Takao Kawabe; Masao Omata
Journal:  Oncogene       Date:  2004-02-05       Impact factor: 9.867

10.  RNA-Seq analysis of Gtf2ird1 knockout epidermal tissue provides potential insights into molecular mechanisms underpinning Williams-Beuren syndrome.

Authors:  Susan M Corley; Cesar P Canales; Paulina Carmona-Mora; Veronica Mendoza-Reinosa; Annemiek Beverdam; Edna C Hardeman; Marc R Wilkins; Stephen J Palmer
Journal:  BMC Genomics       Date:  2016-06-13       Impact factor: 3.969

View more
  8 in total

1.  The novel driver gene ASAP2 is a potential druggable target in pancreatic cancer.

Authors:  Atsushi Fujii; Takaaki Masuda; Michio Iwata; Taro Tobo; Hiroaki Wakiyama; Kensuke Koike; Keisuke Kosai; Takafumi Nakano; Shotaro Kuramitsu; Akihiro Kitagawa; Kuniaki Sato; Yuta Kouyama; Dai Shimizu; Yoshihiro Matsumoto; Tohru Utsunomiya; Takao Ohtsuka; Yoshihiro Yamanishi; Masafumi Nakamura; Koshi Mimori
Journal:  Cancer Sci       Date:  2021-03-05       Impact factor: 6.716

2.  Upregulation of miR-1269 Contributes to the Progression of Esophageal Squamous Cell Cancer Cells and Is Associated With Poor Prognosis.

Authors:  Xiuhui Bai; Qiang Wang; Xueqi Rui; Xiaohua Li; Xianming Wang
Journal:  Technol Cancer Res Treat       Date:  2021 Jan-Dec

Review 3.  The Roles of Transmembrane Mucins Located on Chromosome 7q22.1 in Colorectal Cancer.

Authors:  Hussain Almasmoum
Journal:  Cancer Manag Res       Date:  2021-04-14       Impact factor: 3.989

4.  Histopathological and Molecular Profiling of Clear Cell Sarcoma and Correlation with Response to Crizotinib: An Exploratory Study Related to EORTC 90101 "CREATE" Trial.

Authors:  Che-Jui Lee; Elodie Modave; Bram Boeckx; Silvia Stacchiotti; Piotr Rutkowski; Jean-Yves Blay; Maria Debiec-Rychter; Raf Sciot; Diether Lambrechts; Agnieszka Wozniak; Patrick Schöffski
Journal:  Cancers (Basel)       Date:  2021-12-01       Impact factor: 6.639

5.  Circulating Tumor Cell-Free DNA Genes as Prognostic Gene Signature for Platinum Resistant Ovarian Cancer Diagnosis.

Authors:  Camille C Gunderson; Rangasudhagar Radhakrishnan; Rohini Gomathinayagam; Sanam Husain; Sheeja Aravindan; Kathleen M Moore; Danny N Dhanasekaran; Muralidharan Jayaraman
Journal:  Biomark Insights       Date:  2022-03-28

6.  GTF2IRD1 overexpression promotes tumor progression and correlates with less CD8+ T cells infiltration in pancreatic cancer.

Authors:  Chuanzhao Zhang; Baohua Hou; Hongkai Zhuang
Journal:  Biosci Rep       Date:  2020-09-30       Impact factor: 3.840

7.  A Dynamic Transcription Factor Signature Along the Colorectal Adenoma-Carcinoma Sequence in Patients With Co-Occurrent Adenoma and Carcinoma.

Authors:  Zongfu Pan; Ying He; Wenjuan Zhu; Tong Xu; Xiaoping Hu; Ping Huang
Journal:  Front Oncol       Date:  2021-05-21       Impact factor: 6.244

8.  Oxysterol binding protein-like 3 (OSBPL3) is a novel driver gene that promotes tumor growth in part through R-Ras/Akt signaling in gastric cancer.

Authors:  Qingjiang Hu; Takaaki Masuda; Kensuke Koike; Kuniaki Sato; Taro Tobo; Shotaro Kuramitsu; Akihiro Kitagawa; Atsushi Fujii; Miwa Noda; Yusuke Tsuruda; Hajime Otsu; Yosuke Kuroda; Shuhei Ito; Eiji Oki; Koshi Mimori
Journal:  Sci Rep       Date:  2021-09-28       Impact factor: 4.379

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.