Knockdown of Methoprene-Tolerant Arrests Ovarian Development in the Sogatella furcifera (Hemiptera: Delphacidae).

Juvenile hormone (JH) is responsible for repressing larval metamorphosis and inducing vitellogenesis and egg production in insects. Methoprene-tolerant (Met) is known to be an intracellular receptor and transducer of JH. We examined the role of Met in ovarian development in the rice pest Sogatella furcifera (Horváth). We first cloned and sequenced S. furcifera Met (SfMet). The SfMet protein belongs to the basic helix-loop-helix/Per-Arnt-Sim (bHLH-PAS) family with a bHLH domain and two PAS domains (PAS-A and PAS-B). SfMet was expressed in all developmental stages and tissues but was most highly expressed in the ovaries of adult females. Furthermore, RNA interference (RNAi) mediated silencing of SfMet substantially reduced the expression of SfVg, decreased yolk protein deposition and blocked oocyte maturation and ovarian development. These results demonstrate that SfMet plays a key role in female reproduction in S. furcifera and suggest that targeting this gene could be an effective way of controlling this pest.

The sesquiterpenoid juvenile hormone (JH) and the steroid 20-hydroxyecdysone (20E) are the main hormones that regulate insect development, metamorphosis, and reproduction (Jindra et al. 2013, Roy et al. 2018). JHs are synthesized and secreted by the corpora allata (CA), which are a pair of endocrine glands located posterior to the brain (Toyomi et al. 2009). JH maintains the larval state by suppressing the expression of metamorphosis-initiation genes (Nijhout 1994). A drastic decrease in JH in the final instar allows a spike in 20E to induce the metamorphic molt (Kayukawa et al. 2017). The secretion of JH resumes in adults, in which it regulates the reproductive maturation of females, including vitellogenesis and oogenesis (Li et al. 2019, Santos et al. 2019).

JH acts through its receptor, methoprene-tolerant (Met) (Wilson and Ashok 1998, Jindra et al. 2013), a basic helix–loop–helix Per/Arnt/Sim (bHLH-PAS) transcription factor first identified in Drosophila melanogaster (Meigen) (Diptera: Drosophiladae) (Ashok et al. 1998). JH directly binds to the PAS-B domain of Met to form JH/Met (Charles et al. 2011), which enters into the nucleus by interacting with heat shock protein (He et al. 2014, He et al. 2017). In the nucleus, Met dimerizes with its partners, SRC (steroid receptor coactivator)/Taiman/FISC (Ftz-F1-interacting steroid receptor coactivator), to form a receptor complex that acts as a functional transcription factor (Miura et al. 2005, Li et al. 2011, Li et al. 2019). This JH receptor complex activates downstream gene transcription to transduce JH signals by binding to an E box-like sequence in the promoter region of JH response genes. For example, Krüppel homolog 1 (Kr-h1), a zinc-finger transcription factor that is one of the early response genes directly targeted by the JH receptor complex (Kayukawa et al. 2012).

Met is, therefore, essential for JH to effectively regulate physiological activity in insects. It has been demonstrated that Met is involved in the anti-metamorphic function of JH. For example, depletion of TcMet in young larvae of Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) induced premature pupation and precocious metamorphosis (Konopova and Jindra 2007). Similarly, in Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae), silencing of HaMet in final instar larvae resulted in premature and abnormal pupation (Ma et al. 2018). In addition to regulating metamorphosis, Met is known to be an intracellular receptor of JH that regulates the expression of the vitellogenin gene (Vg) (Zou et al. 2013, Santos et al. 2019). Vg is the precursor of vitellin and is involved in providing nutrition for oogenesis and embryonic development (Shang et al. 2018). JH induces the synthesis of Vg in the fat body and intercellular spaces in the follicular epithelium, after which it is absorbed by developing oocytes from the hemolymph via receptor-mediated endocytosis (Li et al. 2019, Santos et al. 2019). Knockdown of Met in female adults dramatically reduces the transcription of Vg, reduces Vg yolk protein deposition and Vg uptake in oocytes, ultimately impairing fecundity (Konopova et al. 2011, Lin et al. 2015, Ma et al. 2018, Yue et al. 2018).

Sogatella furcifera (Horváth) is a migratory pest of rice crops in Asia. This species causes major economic damage to rice crops by sucking phloem sap, oviposition and transmitting the southern rice black-streaked dwarf virus to rice plants (Zhou et al. 2008, Zhou et al. 2019). Insect reproduction has been a focus of pest control, and clarification of the genes related to reproduction should provide ideal targets for pest management. Although the role of Met in the reproduction of many insects have been systematically studied, relevant information is limited in S. furcifera. In this study, we cloned and characterized the open reading frame (ORF) sequence of SfMet from S. furcifera and analyzed its spatial and temporal expression profile. We then used RNA interference to knock down SfMet in female adults, and found that this reduced SfVg expression and severely impeded oocyte maturation and ovarian development. These results provide further evidence that SfMet is essential for female reproduction, and that targeting it could be a potential way of controlling this pest.

Materials and Methods

Insects

The S. furcifera used in this study were collected from paddy fields in Hunan Agricultural University, Changsha, China. The colony was reared on ‘Fengyou No. 9’ rice seedlings in a climatic chamber at 26 ± 1°C with 80 ± 5% relative humidity (RH) under a 16:8 (L:D) h photoperiod.

Sample Preparation

To determine the expression of SfMet in different developmental stages we measured its expression in randomly chosen samples of individuals from the 1st, 2nd, 3rd, 4th, and 5th instars (n = 30, 30, 15, 10, and 10 individuals contained in one replicate, respectively), and also in 96-h-old female and male adults (five insects in one sample). We also measured the expression of SfMet in female adults in the first 132 h after eclosion (0, 24, 48, 72, 96, and 132 h after eclosion, five insects contained in each sample). In addition, the expression level of SfMet in different tissues had also been measured, namely the head, midgut, ovary, fat body and thorax which were dissected from 96-h-old female adults in phosphate-buffered saline (PBS, pH = 7.4) (Each tissue sample contained 20 dissected organs). All samples were frozen immediately in liquid nitrogen and stored at −80°C until required for RNA extraction, three replicates were performed per sample.

RNA Extraction and cDNA Synthesis

Total RNA was extracted from S. furcifera whole bodies or tissues using a MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China). First-stand cDNA was synthesized by reverse transcribing 0.5 µg of total RNA in a 20 µl reaction mixture with a PrimeScript RT Reagent Kit and gDNA Eraser (TaKaRa). cDNA products were stored at −20°C until required.

Cloning and Bioinformatic Analysis

The cDNA sequence of SfMet was obtained from S. furcifera transcriptome databases. The ORF sequence was amplified with special primers (Table 1) and the resultant polymerase chain reaction (PCR) product inserted into the pMD-18T vector (Takara) for sequencing. The putative molecular weight (Mw) and isoelectric point (pI) were calculated using the compute pI/Mw tool of online EXPASy proteomics server (https://web.expasy.org/compute_pi/). The conserved domains of SfMet were identified using the InterPro program (https://www.ebi.ac.uk/interpro/beta/). The amino acid sequence of SfMet was aligned with those of other hemipteran insects using the DNAMAN 8.0 software package (Lynnon Corporation, Quebec, Canada). Finally, a neighbor-joining (NJ) phylogenetic tree was constructed using on a p-distance model and MEGA 5.0 software. One thouand bootstrap replications were performed to test topology.

Table 1.

The special primers used in this study

Purpose	Primer name	Primer sequence (5′→3′)	E (%)a	R 2
	Met-ORF-F	TCGCCGTTCCGACGACAATG	n.a.	n.a.
	Met-ORF-R	TATCAGCTCATCACAACGGGG
qPCR	qMet-F	TGTGGACTATGGTCGCCTTG	103.8	0.994
	qMet-R	GCTCAATGTAGCCGTGTGTC
	qKr-h1-F	GGCATTTGGCTACAACCACG	99.6	0.992
	qKr-h1-R	CCACCCACACTAGCATCAGG
	qVg-F	CACAAGGTTGCTTCTGGCATC	93.8	0.999
	qVg-R	TTGGCCAAAGCTAGAGTAGCC
	qTub-F	GAGGACACTACACCATCGGC	93.6	0.995
	qTub-R	TCAACAGCGAGGTGAATCCG
	qEf1α-F	AAGATCGGTTACAACCCGGC	103.8	0.989
	qEf1α-R	TCCTTGCGCTCAATGTTCCA
RNAi	Met-F	GGATCCTAATACGACTCACTATAGGACATCGACGGCAGGATTATCTACAb	n.a.	n.a.
	Met-R	GGATCCTAATACGACTCACTATAGGAGTTCTCAATGTCCTTGCAGTCGT
	EGFP-F	GGATCCTAATACGACTCACTATAGGGAGGACGACGGCAACTACAAG	n.a.	n.a.
	EGFP-R	GGATCCTAATACGACTCACTATAGGGGTCCATGCCGAGAGTGATCC

PCR efficiency.

T7 RNA polymerase promoter is indicated with italics; n.a. = not applicable.

Quantitative Real-Time PCR

Quantitative real-time PCR (qPCR) was used to determine the spatio-temporal distribution of SfMet. qPCR was performed using TB Green Premix Ex Taq II (TaKaRa) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, California, United States). The reaction was performed in a 10 μl volume containing 1 μl of cDNA, 5 μl of TB Green Premix Ex Taq II, 0.4 μl of each primer (10 mM) and 3.2 μl of ddH2O. The two-step qPCR program protocol was as follows: one cycle of 95°C for 30 s, followed by 40 cycles of 5 s at 94°C, and 30 s at 60°C. Three technical replicates were performed for each sample. The qPCR primers were designed using information on the NCBI (National Center for Biotechnology Information) profile sever (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The efficiency of each primer pair was determined by generating standard curves from a fivefold dilution series of cDNA templates. Relative expression levels of SfMet were analyzed using the 2-△△Ct method, normalized to two reference genes, SfTub (a-1 tubulin, GenBank accession No. KP735521) and SfEF1α (elongation factor 1α, GenBank accession No. KP735517). The primer sequences and their amplification efficiencies are shown in Table 1.

RNAi Experiment

Products for a dsRNA template were obtained by amplifying a 552 bp fragment of SfMet and a 401 bp fragment of EGFP (enhanced green fluorescent protein, GenBank accession No. U55762) with special primers containing a T7 promoter sequence. dsRNAs of SfMet and the negative control EGFP were then prepared using the T7 RiboMAX Express RNAi System (Promega, Wisconsin, United States) following the manufacturer’s protocol.

To investigate the function of SfMet in ovarian development, 100 ng (2,000 ng/µl) dsRNA targeting SfMet was injected into newly emerged female adults as described previously (Hu et al. 2019). A control group were given the same dose of dsEGFP. RNAi efficiency, and the expression levels of SfKr-h1 and SfVg, were determined 48, 72, and 96 h, after injection. After 132 h, the ovaries of females in the treatment and control groups were observed, compared and photographed with an SMZ-161 microscope equipped with a D3400 digital camera (Nikon, Tokyo, Japan).

Statistical Analysis

All analyses were performed using the GraphPad Prism 8 software package (GraphPad Software Inc., San Diego, CA). The statistical significance of differences in the relative expression of SfMet among different developmental stages or tissues was assessed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc tests. The statistical significance of differences in expression levels between adults treated with dsMet and those treated with dsEGFP was assessed with Student’s t-test. All data are expressed as mean ± SE.

Results

Sequence Data

The ORF sequence of SfMet (GenBank accession No. MN229742) is 2,877 bp long, encodes a 958 amino acid protein with a calculated molecular weight (Mw) of 106.96 kDa and a theoretical isoelectric point (pI) of 6.20. SfMet is a typical bHLH-PAS transcription factor, containing the bHLH, PAS-A, and PAS-B motifs (Fig. 1). Sequence alignment and identity analysis revealed that SfMet has highest amino acid identity with Nilaparvata lugens (Stål) (Homoptera: Delphacidae) NlMet (73.78%). The neighbor-joining phylogenetic tree indicates that the amino acid sequence of SfMet is highly homologous to that of other hemipteran insects (Fig. 2).

Fig. 1.

Identification and sequence analysis of Sogatella furcifera Methoprene-tolerant (SfMet). (A) Gene structure of SfMet predicted by InterPro tool. (B) Alignment of amino acid sequences of SfMet with those of other hemipteran species; Nilaparvata lugens (NlMet, ALT45968.1), Myzus persicae (MpMet, AYI50057.1), Planococcus kraunhiae (PkMet, BAU79435.1), and Aphis gossypii (AgoMet, ANZ54966.1). The bHLH, PAS-A and PAS-B domains are indicated by the black line.

Fig. 2.

Neighbor-joining phylogenetic tree of Sogatella furcifera SfMet and those in other insects, using Portunus trituberculatus (PtMet) as the outgroup. Numbers at the nodes of branches indicate bootstrap values (%) based on 1,000 replicates. The number in parenthesis are the GenBank accession numbers for each species’ gene. The blue triangle indicates the protein sequence of SfMet. DmMetA and DmMetB, Drosophila melanogaster; GmmMet, Glossina morsitans morsitans; SmMet, Sitodiplosis mosellana; Cppmet, Culex pipiens pipiens; AsMet, Anopheles sinensis; BmMet, Bombyx mori; DsMet, Dendrolimus spectabilis; PiMet, Plodia interpunctella; HaMet, Helicoverpa armigera; MseMet, Mythimna separate; TcMet, Tribolium castaneum; CbMet, Colaphellus bowringi; LdMet, Leptinotarsa decemlineata; MsMet, Monochamus saltuarius; MaMet and MalMet, Monochamus alternatus; DpMet, Diploptera punctate; ZnMet, Zootermopsis nevadensis; NlMet, Nilaparvata lugens; PkMet, Planococcus kraunhiae; MpMet, Myzus persicae; AgoMet, Aphis gossypii.

Expression of SfMet

We profiled the expression of SfMet in 1st to 5th instar nymphs and 96-h-old female and male adults. The SfMet transcript was detected in all of the above, and there was no significant difference in expression between developmental stages (Fig. 3A). Expression levels, however, increased in female adults in the first 132 h after eclosion (Fig. 3B). Expression of SfMet in 96-h-old females was highest in the ovary, followed by the fat body and midgut, and lowest in the thorax (Fig. 3C).

Fig. 3.

Tissues and temporal expression profiles of SfMet. (A) Relative expression levels of SfMet in the first to fifth nymphal instars (N1, N2, N3, N4, N5), female (F) and male adults (M). (B) Relative expression levels of SfMet in females at different times after emergence. HAE, hours after emergence. (C) Relative expression levels of SfMet in various tissues of females. Mg, midgut; Ov, ovary; Hd, head; Th, thorax; Fb, fat body. Bars indicate the mean (±SE) of three biological replicates. Different letters above bars represent significant differences (ANOVA followed by Tukey’s test, P < 0.05).

RNAi Knockdown

Newly emerged female adults were injected with dsMet to investigate the function of SfMet in Vg synthesis. Injecting dsMet reduced the expression of SfMet 48, 72, and 96 h after injection by 46.6, 51.9, and 45.4%, respectively (Fig. 4A). Injection of dsMet also reduced the expression of SfKr-h1 48, 72, and 96 h after injection by 29.1, 34.3, and 52.5%, respectively (Fig. 4B), and SfVg mRNA levels by 89.3, 45.5, and 61.1%, respectively, relative to their expression in the dsEGFP control group (Fig. 4C).

Fig. 4.

Functional analysis of SfMet in the ovarian development of female Sogatella furcifera. Expression levels of SfMet (A), SfKr-h1 (B), and SfVg (C) in whole bodies of females 48, 72, and 96 h after injected with dsMet and dsEGFP. (D) Effect of SfMet RNAi on ovarian development with dsEGFP as a control. Ovaries were dissected 132 h post-injection. Scale bar, 0.5 mm. Asterisks represent values statistically different from the EGFP dsRNA group (t-test: *P < 0.05, **P < 0.01).

Ovaries from both dsMet and dsEGFP treated females were observed 132 h after injection to assess the effect of silencing SfMet on ovarian development. Depletion of SfMet caused markedly less yolk protein deposition and prevented ovarian development (Fig. 4D).

Discussion

Preventing the premature metamorphosis of larvae and stimulating vitellogenesis in adult females are the two major functions of JH (Riddiford 2008, Li et al. 2019, Santos et al. 2019). The molecular action of JH relies on the intracellular receptor Met, which acts as a JH-activated regulator inducing vitellogenesis in adult females (Smykal et al. 2014, Roy et al. 2018). We successfully cloned the ORF sequence of SfMet from S. furcifera. Its sequence alignment and predicted structure indicate that it is a homologue of other insect JH intracellular receptors, and that it contains a conserved HLH domain and two variably spaced PAS (PAS-A and PAS-B) domains (Li et al. 2010, Li et al. 2011, Zhang et al. 2019). There is evidence to suggest that the bHLH domain is required for JH III induction of the Kr-h1 (Cui et al. 2014). PAS-A, another Met domain, is important for dimerization with FISC in Aedes aegypti (L.) (Diptera: Culicidae) (Li et al. 2011), and the PAS-B domain of Met is involved in binding to JH, regulating the protein-protein interaction with SRC (Tai/FISC) to form the JH receptor complex and recognize JHRE (Charles et al. 2011, Kayukawa and Shinoda 2015). These features of Met highlight its importance to the action of JH.

We found that SfMet is expressed in both nymphs and adults of both sexes in S. furcifera. This is not unexpected given that JH is involved in processes that occur throughout an insect’s life-span, including mating, foraging, aging, polymorphism, and caste differentiation in social insects (Marchal et al. 2014). In addition, increased transcription of SfMet was observed within 132 h of the emergence of adult females. Ovarian development in S. furcifera began after eclosion, and oviposition began about 96 h after emergence. We, speculate, therefore, that JH may be involved in ovarian maturation in S. furcifera; similar results had been reported in N. lugens (Lin et al. 2015). SfMet was also, however, quite highly expressed in the midgut. JH has been found to be synthesized by the gut of adult Drosophila (Diptera: Drosophiladae); this gut specific JH regulates the survival and cellular growth of intestinal stem cells and enteroblast populations through the JH receptors Gce/Met and Tai-dependent manner. This local JH plays an important role in damage responses and is necessary for intestinal tumor growth driven by activating mutations in the Wnt and EGFR/Ras pathways (Rahman et al. 2017). However, further research is required to determine whether S. furcifera also synthesizes JH in the gut, and whether the relatively high level of SfMet in the midgut plays the same role as it does in Drosophila.

Vitellogenesis is the central processes of female reproduction and JH is the leading hormone inducing vitellogenesis in many insects (Parthasarathy et al. 2010, Zhu and Noriega 2016, Santos et al. 2019). The JH receptor complex formed by Met and its partner SRC (Tai/FISC/Gce) is the central part of the JH signaling pathway (Roy et al. 2018). Our results show that SfMet is highly expressed in the fat body and ovary of adult female S. furcifera. Furthermore, knockdown of SfMet significantly reduced SfVg and reduced yolk protein deposition in oocytes, preventing normal ovarian development. These results demonstrate that JH plays an important role in vitellogenesis via Met in S. furcifera. Studies on other insects have also demonstrated that Met is involved in JH-regulated reproduction. For instance, depletion of HaMet reduced Vg transcription and prevented ovarian development in H. armigera, and treatment with a JH analog did not restore Vg expression (Ma et al. 2018). These results have been corroborated in Locusta migratoria (L.) (Orthoptera: Acrididae) (Song et al. 2014), Pyrrhocoris apterus (L.) (Heteroptera: Pyrrhocoridae) (Smykal et al. 2014) and T. castaneum (Parthasarathy et al. 2010).

The nucleic complex formed by Met and Tai (SRC/FISC) interacts with promoters of the downstream gene Kr-h1 called JH response elements (JHREs) (Kayukawa et al. 2012). Kr-h1 has been found to play a crucial role in regulating vitellogenesis and oogenesis (Zhang et al. 2018, Santos et al. 2019). Our results show that knockdown of SfMet reduced the transcript level of SfKr-h1. Therefore, we speculate that SfKr-h1 transduces JH signaling during vitellogenesis and also regulates the synthesis of Vg and ovarian development in S. furcifera. Indeed, previous research has demonstrated that depletion of LmMet reduced the expression of LmKr-h1, and that silencing LmMet or LmKr-h1 can stop oocyte maturation and arrest ovarian development in L. migratoria. These results indicate that the JH-Met-Kr-h1 signaling pathway is involved in reproduction in L. migratoria (Song et al. 2014). Other studies suggest that the JH-Met-Kr-h1 signaling pathway is conserved in insects, presumably because of its universal role in regulating female reproductive development (Marchal et al. 2014, Yue et al. 2018, Gijbels et al. 2019).

In summary, our results demonstrate that the depletion of SfMet suppresses Vg expression in the fat body and prevents oocyte development and maturation in S. furcifera. This JH-mediated signal conveyed by SfMet may be transduced by SfKr-h1 in S. furcifera. These findings illustrate the key role of SfMet in reproduction in S. furcifera, and suggest that targeting SfMet could be an effective way of controlling this pest.