Correlation of follicle-stimulating hormone receptor gene Asn 680 Ser (rs6166) polymorphism with female infertility.

BACKGROUND AND AIMS: Female infertility is a complex multifactorial, and polygenic disease associated with genetic factors plays an essential role in its formation and follicle development, oocyte maturation, and steroidogenesis regulation in the ovary. The aim here is too study the genetic association between follicle-stimulating hormone receptor (FSHR) Asn680Ser; (rs6166) gene polymorphism with female Infertility in our population.
METHODS: In this prospective case-control study, we enrolled 106 infertile and 164 unrelated healthy control individuals. Genomic DNA was extracted from the 5 ml of venous blood using the modified salting-out method. A polymerase chain reaction-amplified exon 10 of FSHR and purified PCR products were sequenced on an ABI 3730XL DNA sequencer. The data were analyzed statistically.
RESULTS: We found that the presence of rare allele "G" and heterozygous and common homozygous genotypes significantly increased the risk of female infertility. No significant change in the FSHR 191756 G >A genotype frequency was observed, regardless of chromosomal integrity. The genotype frequency distribution of locus 680 was consistent with the Hardy-Weinberg Equilibrium (HWE) in both groups (P > 0.05).
CONCLUSION: No significant differences were found in allelic variants frequency and genotype distribution between each category of subjects when analyzing the FSHR SNPs in the exonic region (P value >0.05). FSHR Asn680Ser polymorphisms and female infertility (P > 0.05). Variations in FSHR gene have an essential influence on ovarian function and can account for several defects of female fertility. FSHR Asn680Ser (rs6166) gene polymorphism is associated with female infertility and can be used as a relevant molecular biomarker to identify the risk of infertility in our population. This finding can be important for disease pathogenesis. Copyright:

Introduction

Infertility is an inability to become clinically pregnant after 12 months or more of regular sexual intercourse. Infertility affects up to 15% of reproductive-aged couples worldwide. According to the World Health Organization (WHO) estimate, the overall prevalence of infertility in India is between 3.9 to 16.8%.[1] In Indian states, prevalence of infertility varies from state to state, such as 3.7 percent in Uttar Pradesh.[2] Female infertility is a complex disease which involves both environmental and genetic factors.[3] Genetic causes of infertility can be divided into cytogenetic anomalies and gene defects, aberrances[4] Several genes have been associated with Infertility including FMR1 and Bone Morphogenetic Protein 15 (BMP15).[5] Among autosomal gene mutations often found in women with POF are AR, CDKN1B, CYP19A1, GDF9, FIGLA, FOXL2, FOXO1a, FOXO3a, INHA, LHX8, NOBOX, NANOS3, SALL4 and FSHR.[6] Follicle-stimulating hormone 678 amino acids play a significant role in the development of follicles and regulation of steroidogenesis in the ovary and granulosa cells in the ovary.[7] The lessen of infertility is genetic and may be due to inactivating mutations in the gonadotropin and gonadotropin receptor genes.[8] While mutations affecting the FSHR gene are sporadic, polymorphism of the FSHR gene seems to be a common phenomenon.[9] FSHR inactivating mutations may cause premature ovarian failure, primary or secondary amenorrhea, infertility.[10] The interaction between FSH and its receptor is crucial for follicular development and maturation, which makes it indispensable for female fertility.[11] The FSHR Gene calculated molecular mass of ranges between 75 and 76.5 kDa and belongs to family 1 of G-protein coupled receptors encoded by this protein and consists of 678 amino acids (695 considering the first 17 amino acids that encode a hydrophobic signal peptide), grouped in 7 transmembrane domains.[12] The FSHR gene, which consisted of 10 exons and 9 introns, has been mapped to chromosome 2p21.[13] Most of the extracellular domain encodes 9 exons; the C-terminal part of the extracellular domain, the intracellular domain, and the Transmembrane domain, are encoded by the large exon 10 (1234 bp).[14] Some naturally occurring mutations in the FSH receptor have been reported in subjects with infertility, and until now, there are more than 900 SNPs (Single nucleotide polymorphism).[15] FSHR gene is polymorphic mainly two sites associated in allelic variations, and finally, in an altered amino acid sequence on the receptor protein.[16] More commonly studied in FSHR, position 307 that changes an alanine to threonine (Ala307Thr) and location 680 that switches an asparagine to serine (Asn680Ser).[17] Our study aims to correlation of follicle-stimulating hormone receptor gene Asn 680 Ser (rs6166) polymorphism with female infertility in Indian women.

Methods

Study subjects

In this cross sectional study, we enrolled female patients with infertility (N = 106), controls (N = 164) (30.76 ± 4.53). The control subjects recruited had a regular menstrual cycle, and no history of pregnancy loss or other complications were recruited from the Department of Obstetrics and Gynecology, Sir Sunderlal Hospital, Institute of Medical Sciences, Banaras Hindu University, Varanasi.

A questionnaire was completed by each infertility patient to record the details of their lifestyle, habits, and family history. All subjects were of Indian ethnicity from eastern Uttar Pradesh and Bihar state of northern India. The average age of the infertile female included in the study in age was 18 to 37(mean age [±SD] 26.89 ± 4.01), years. The study was approved by the Institutional Medical Ethical Committee (No. Dean/2014 -15/EC/1489) on 17/10/2015 and all participants provided their consent. The control group consisted of 164 proven fertile, healthy females with a history of regular menstrual cyclicity.

Hormonal and biochemical

Analysis of Hormonal and Biochemical parameters serum; preparation was done immediately using a centrifuge, and stored in −20°C until processing of biochemical parameters. Fasting plasma glucose (enzymatic colorimetric method), serum FSH (Hitachi analyzer), LH, insulin, serum testosterone (free and total), were measured by Enzyme-linked immunosorbent assay (ELISA) in both patients and controls [Table 1]. Among 106 patients, the mean serum FSH concentration was 5.48 ± 1.98 mIU/mL, and the TSH level was 5.97 (2.55-10.4) mIU/mL. The association of serum FSH and TSH with Asn680Ser polymorphism were not statistically significant, P = 0.619; P = 0.963, respectively [Table 2].

Table 1

Main characteristics of study participants

Criteria	Control	Infertility	P
Participants	(n=164)	(n=106)
Age (years)	27±5.1	27±3.6	1.0000
body mass index (kg/m2)	23.43±3.4	24.23±3.4	>0.0001
Fasting insulin µIU/ml	6.66±3.19	16.94±7.26	>0.0001
Fasting Glucose mg/dl	86.85±7.1	88±8.6	0.0678
Education Lower then college	119	55
college Education and higher	61	10
Smoking	2	9
Alcohol consumers	0	0
Coffee consumption	40	60
Physical activity/sports	40	28
Prior hormonal contraception use	4	26
Regular menstrual cycle	151	9
Irregular menstrual cycle	13	97
Past infertility problems	3	63
Gynecological diseases in the past	3	21

n – Number of study participants; compared with the Control, infertility, group

Table 2

Endocrine profiles* of the patient group (n=106) *Median (min-max)

Variant	Luteinizing hormone (LH) (mIU/mL)	Follicle-stimulating hormone (FSH) (mIU/mL)	LH+FSH (ng/mL)	Thyroid Test
				T3	T4	TSH
Control (n=164)	7.9±5.46	6.47±3.16	1.5±1.2	110.06 (70-200)	11.41 (4.5-12.5)	2.90 (0.36-5.4)
Infertility (n=106)	11.97±6.08	5.48±1.98	2.62±1.2	114.08 (3.6-240)	8.25 (1.22-14.22)	5.97 (2.55-10.4)

Median values are given due to the absence of normal distribution for thyroid test. *Follicular 2nd-3rd Day of Cycle

Genomic DNA extraction and genotyping

Genomic DNA was extracted from the 5 ml of venous blood using a modified salting-out method.[18] The DNA concentration was determined using a spectrophotometric method by reading absorbance at 260 nm, followed by dilution to 100 ng (working concentration) in TE Buffer. The quality of DNA preparation was assessed on 2% agarose gel electrophoresis. Chromosomal analysis was performed on phytohaemagglutinin (PHA)-stimulated peripheral lymphocyte cultures using standard conventional cytogenetic methods.[19] Primer designing of rs6166/Asn680Ser FSHR Gene was performed using ensemble genome browser and primer3 web primers tools. The primer sequence is F, 5′TTTGTGGTCATCTGTGGCTGC -3′and R, 5′-CAAAGGCAAGACTGAATTATCATT-3′. Each reaction was performed in 20 μL reaction volume, where 100 ng DNA template was added to 1 μL of each primer (10 pmol), 160 mmol/L dNTP, 1 × PCR buffer, and 1 U Taq DNA polymerase (NEB) and ddH2O, under the PCR amplification, was performed by an initial step under the following conditions. 35 cycles of amplification were performed with the use of the applied biosystems PCR System. A denaturation step at 95°C for 5 min, followed by 35 cycles of an at 95°for 45 sec, annealing at 62°C for 45 sec, Extension at 72°C for 45 sec and a final Extension step 72°C for 5 min in a Thermocycler. The final amp icons were of 519 bp respectively. The amplified products were run on 2% agarose gel electrophoresis, stained with ethidium bromide and photographed.

DNA sequencing

To find SNPs demonstrated in infertility patients, with Control to illustrate gene variants, exon 10 of FSHR (519bp) was amplified from genomic DNA using a standard primer. The purified PCR products of the amplified FSHR gene region were sequenced and analyzed on an ABI 3730XL DNA sequencer. (Eurofins Genomics India Pvt. Ltd.). The obtained sequences of these samples were analyzed at National Center for Biotechnology Information (NCBI) website using the Multiple Sequence Alignment by CLUSTALW search tool and examined SNPs presence of using an analysis tools FinchTV 1.4.0 developed by Geospiza, Inc.

Statistical analysis

Case-control study

Hardy-Weinberg equilibrium (HWE) Testing of Biological Ascertainment performed with the use of the Chi-square test with two degrees of freedom to compare the observed alleles and genotype frequencies. Among the subjects with the expected genotype frequencies were compared between Case and controls their respective 95% confidence intervals (95%CIs) were calculated to assess the relative risk (RR) conferred by a particular allele and genotype. All statistical analyses were performed using the Statistical Package for the Social Sciences (SPSS).

Results

Case-control study of FSHR gene polymorphisms in infertile female.

The genotype frequencies in the control group for all of the polymorphisms fitted well in the Hardy-Weinberg equilibrium (P >.05). The results of this study presented no significant differences between the Infertility and Control. There were polymorphisms in the FSHR coding region in infertile women from India [Figure 1]. The results of the statistical analysis of the distribution of FSHR polymorphism genotype and allele frequencies between infertile female and controls are shown in Table 3a and 3b. The presence of rare allele “G” and heterozygous and Common homozygous genotypes significantly increased the case compared with the control subjects. Similarly, the frequency of heterozygous and rare homozygous genotypes was significantly higher in the patients compared with the control subjects, indicating its association with infertility [Tables 3a and 3b]. The genotypes of FSHR codons 680 in patients and controls were in Hardy–Weinberg Equilibrium (HWE) and showed a demographic representation. However, there were statistically no significant separate associations between the Asn 680 Ser polymorphisms and Female infertility risk (all P values >0.05) [Figure 2]. The allele and genotype frequencies for 191756 G >A polymorphism in the FSHR gene were compared between the groups [Table 3b]. The frequencies of the FSHR genotypes at position 680 were Asn/Ser had compartavely higher frequency in infertile patients as compared to that of controls. Asn/Asn (AA) genotype in Infertility patients was 10 (09.43%) comparatively Control, 10 (06.10%) odd ratio was O1.60 (0.64-3.99) P value 0.31. The genotype frequency Asn/Ser (AG) was higher in Infertility patients 50 (47.17%) comparatively Control 82 (50.00%) odd ratio was 0.89 (0.54-1.45) P value 0.64. Genotype frequency Ser/Ser (AG) patients was 46 (43.40%) comparatively Control 72 (42.86%) odd ratio was 0.97 (0.59-1.60) P value 0.93 were more frequent in case then in case then in control subjects, however, no significant association was evident (all P values >0.05).

Figure 1

DNA sequencing results for the FSHR gene Asn680Ser polymorphisms. A. Chromatogram shows GG allele in control sample and indicate the presence of heterozygous AG allele in Infertility sample

Table 3a

Allele frequencies of the FSHR polymorphisms between infertile Female and controls

Asn680Ser	Allele [n (%)]		OR (95%CI)	P
	Case	Controls
Asn (A)	146 (38.22%)	236 (61.78%)	1.15 (0.97-1.69)	0.44
Ser (G)	66 (41.77%)	92 (58.23%)	0.86 (0.59-1.25)	0.44

FSHR=follicle stimulating hormone receptor, OR=odds ratio, CI=confidence interval, P value from Chi-squared test

Table 3b

Genotype frequencies of the FSHR polymorphisms between infertile Female and controls

Genotype	Case [n %)]	Control, [n %)]	OR (95%CI)	P
Asn/Asn (AA)	10 (09.43%)	10 (06.10%)	1.60 (0.64-3.99)	0.31
Asn/Ser (AG)	50 (47.17%)	82 (50.00%)	0.89 (0.54-1.45)	0.64
Ser/Ser (GG)	46 (43.40%)	72 (42.86%)	0.97 (0.59-1.60)	0.93

FSHR=follicle-stimulating hormone receptor, OR=odds ratio, CI=confidence interval, P value from the Chi-squared test

Figure 2

DNA sequencing results for the FSHR gene Asn680Ser polymorphisms. A. DNA sequencing of the Asn680Ser polymorphism (AA sequence altered) Homozygous is indicated by the arrow. FSHR: follicle-stimulating hormone receptor

Analysis of Asn680Ser SNP genotypes and allele frequencies

As shown in Table 3a, there was an absence of statistically significant differences in genotype frequencies according to the diagnosed cause of female infertility. The infertile group was compared with the fertile control group for the Asn680Ser SNP. FSHR 191756 G >A polymorphism for A allele frequency in infertility patients was 38.22% while in control subjects were 61.78%, and G allele frequency in infertility patients was 41.77% while in control subjects was 58.23% in the Control group, respectively. Comparison of allele frequencies showed lack of statistically significant difference in allele frequencies of the FSHR 191756 G >A between infertility versus the control group. However, the observed genotype frequencies show non-significant differences in either group (P > 0.05). The allelic frequency distribution of locus 680 was consistent with the Hardy–Weinberg Equilibrium (HWE) in both groups (P > 0.05).

Discussion

Understanding of genetic factors related to infertility will influence the clinical management of Infertility. Further, it will help to ensure that families with or at risk of significant inherited disorders related to infertility can be identified and referred as appropriate for a professional opinion. Furthermore, Primary care is perfectly placed to identify families at highest risk of genetic conditions for infertility. FSH Play an essential role in normal reproductive functions.[20] Due to the crucial parts of FSH on follicular growth and ovarian steroidogenesis in females mutations in the FSH receptor gene could affect reproductive ability, especially in women.[1021] The Molecular mechanism of the FSHR genotype for ovarian response in the physiological and therapeutic setting has been demonstrated in several studies.[22] The Genetics mechanism of FSHR variant activity is now the key to understanding follicular selection and dominance in the human and to design novel, patient-tailored therapeutic approaches, not only to ovarian stimulation, but also to infertility and, possibly, fertility preservation.[23] For example, some mutations or polymorphisms in the FSH receptor gene show an altered pattern of receptor expression on the cell surface, a previous study by Kuijper et al., 2010. Frequency distribution of polymorphisms In the FSHr gene in infertility patients of different ethnicity distribution patterns were found a significantly lower prevalence of Ser680Ser FSHR variant (10.4%).

Moreover, a significantly higher incidence of Asn680Asn variant (50.7%) in Asians, compared with Caucasians and Mediterranean.[24] A study by Jun et al. testified that the correlation Frequency of Asn/Ser, Asn/Asn, and Ser/Ser was 45.6%, 41.8%, and 12.5%, respectively.[25] These aspects should be investigated in the future by comparing the effects of the two FSHR variants in human granulosa cells.[26] Unlike other previous studies, where basal FSH and LH levels were measured on cycle day 2 or 3, we measured random levels of FSH and LH during the ovulatory period.[27]

Interestingly, we found that serum FSH and LH levels were significantly higher in anovulatory subjects who carried the Thr307Ala or Asparagine 680 Serine genotypes,[2829] which were consistent with the present study result. However, the present study found a critical difference among these genotypes regarding hormone profile, although a slightly higher level of FSH was observed for Asn680Ser groups. Studies reported so far indicate that mutations, polymorphisms and alternatively spliced variants in FSHR have varied effects on receptor function.

Conclusions

This case-control based association study confirmed that there was an absence of a significant association of Asn680Ser polymorphisms and Female infertility risk. Variations in FSHR gene has an essential influence on ovarian function and can account for several defects of female fertility. Furthermore, studies, including prospective studies on the impact of genetic factors and environmental, on women's fertility, are needed. Broadly study the effects of FSHR polymorphisms on various reproductive health traits; the most studied rs6166 SNP should be evaluated. However, it is already clear that the relationship of FSHR Asparagine 680 Serine variant polymorphism to lower fecundity can have clinical relevance; e.g. more conservative infertility management can be suggested for women with unexplained infertility who share this genetic variation.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form, the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship

This research was sponsored by Multi-Disciplinary Research Units (MRUs) grant by ICMR and Department of Health Research.

Conflict of interest

There is no conflict of interest.