| Literature DB >> 31737677 |
Yangchun Cao1, Kai Liu1, Shimin Liu2, Long Guo1, Junhu Yao1, Chuanjiang Cai1.
Abstract
This study aimed to investigate the effects of leucine (Leu) on the synthesis and secretion of digestive enzymes in cultured pancreatic tissue of dairy goats and on the signaling molecules. Fresh pancreatic tissue from dairy goats was cut into approximately 2 mm × 2 mm pieces and incubated in oxygenated Krebs-Ringer bicarbonate buffer containing 0 (the control), 0.40, 0.80, or 1.60 mM Leu at 39°C in a CO2 incubator for 180 min. The results showed that Leu increased the release of α-amylase, trypsin, and chymotrypsin in the buffer and tissue, as well as the total activity (P < 0.05), especially at 0.40 and 0.80 mM. Compared with the control, 1.60 mM Leu increased the release of α-amylase and the total activity of trypsin and chymotrypsin (P < 0.05) but had no effect on the tissue concentration of α-amylase, trypsin, and chymotrypsin or the total activity of α-amylase (P > 0.05). Leu improved the mRNA expression of α-amylase, trypsin, and chymotrypsin (P < 0.05), especially at 0.80 and 1.60 mM. The activity and mRNA expression of lipase were not affected (P > 0.05). Compared with the control, 0.40 and 0.80 mM Leu increased the expression of the γ isoform of 4EBP1 (P < 0.05), implying increased phosphorylation of 4EBP1. Leu increased the phosphorylation of S6K1 (P < 0.05). Compared with the control, 0.40 and 0.80 mM Leu decreased the eEF2 phosphorylation level (P < 0.05). Conclusively, these results suggested that Leu could regulate the synthesis of pancreatic enzymes by increasing the mRNA expression and phosphorylation level of protein factors in the mammalian target of rapamycin pathway and the optimal Leu level in this experiment was 0.80 mM.Entities:
Mesh:
Substances:
Year: 2019 PMID: 31737677 PMCID: PMC6815606 DOI: 10.1155/2019/7521715
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Primer sequences.
| Target genes | Reference sequence | Primer sequence (5′-3′) | Product size (bp) | Annealing temperature (°C) |
|---|---|---|---|---|
| Amylase | NM_001035016 | F: GAAATGGCCGTGTGACAGAATTTA | 142 | 64.3 |
| R: ACAAAGACAAGTGCCCTGTCAGAA | ||||
| Trypsin | NM_001113727 | F: TGTCTGCGGCTCACTGCTAC | 119 | 62.7 |
| R: GCTGGGATGGACGATACTCTTG | ||||
| Chymotrypsin | NM_001098965.1 | F: ATGTTGGGCATCACGGTCTT | 172 | 60.0 |
| R: TGTGCCTCCACGTGTTATCC | ||||
| Lipase | NM_001205820 | F: GTGGAAGCAAATGATGGACAAG | 81 | 61.8 |
| R: TGGGTTGAGGGTGAGCAGA | ||||
|
| AF481159 | F: ACCACTGGCATTGTCATGGACTCT | 152 | 60.0 |
| R: TCCTTGATGTCACGGACGATTTCC |
Effects of leucine on the activities of enzymes in vitro.
| Item | Levels of leucine (mM)1 | SEM2 |
| |||
|---|---|---|---|---|---|---|
| 0 | 0.40 | 0.80 | 1.60 | |||
| Tissue concentration (U/g) | ||||||
| | 572b | 681a | 658a | 581b | 48.5 | 0.017 |
| Trypsin | 3.45c | 5.69b | 7.67a | 3.88c | 0.573 | <0.001 |
| Chymotrypsin | 2.68b | 4.31a | 4.86a | 3.11b | 0.736 | 0.008 |
| Lipase | 402 | 497 | 530 | 525 | 38.8 | 0.258 |
| Release (U/g tissue) | ||||||
| | 221c | 308a | 310a | 268b | 37.6 | 0.012 |
| Trypsin | 1.05b | 2.57a | 2.48a | 2.71a | 0.474 | 0.029 |
| Chymotrypsin | 0.88b | 2.30ab | 2.61a | 2.77a | 0.385 | 0.024 |
| Lipase | 116 | 112 | 125 | 121 | 17.1 | 0.207 |
| Total activity (U/g tissue) | ||||||
| | 793b | 989a | 968a | 849b | 75.145 | <0.001 |
| Trypsin | 4.50c | 8.26ab | 10.15a | 6.59b | 0.652 | 0.005 |
| Chymotrypsin | 3.36c | 6.61ab | 7.47a | 5.88b | 0.536 | 0.012 |
| Lipase | 518 | 607 | 655 | 646 | 20.7 | 0.092 |
1One-way ANOVA. Differences were considered significant at P < 0.05. 2Pooled standard error of the means, n = 3, a–cMeans within a row not sharing the same superscript differ significantly (P < 0.05).
Figure 1Effects of leucine on pancreatic amylase (a), trypsin (b), chymotrypsin (c), and lipase (d) mRNA levels in vitro. Values are the mean and pooled standard error of the mean (SEM). The enzyme mRNA levels were normalized to those of β-actin mRNA, and values of the mRNA levels were compared with those of the control group as 1.00. Different letters represent significantly different values (P < 0.05, n = 3).
Figure 2Effects of leucine on the ratio of phosphorylated to total mTOR signalling pathway factors in pancreas tissue. (a) 4EBP1 (α, β, and γ forms are denoted); (b) S6K1; (c) eEF2. The data are the means and pooled standard errors of the means (SEM). Different letters represent significantly different values (P < 0.05, n = 3).