| Literature DB >> 31728161 |
Caoimhe Lynch1, Kayleigh Hawkins1, Helen Lynch2,3, John Egan2, Declan Bolton4, Aidan Coffey1, Brigid Lucey1.
Abstract
The true prevalence of tet(A), which codes for a tetracycline efflux pump, in thermophilic Camplyobacter spp. requires clarification after reports emerged in Iran (2014) and Kenya (2016) of the novel detection of tet(A) in Campylobacter. During our investigation of antibiotic resistance mechanisms in a sample of Irish thermophilic Campylobacter broiler isolates, it was determined that 100% of tetracycline-resistant isolates (n = 119) harboured tet(O). Accessory tetracycline-resistance mechanisms were considered as tetracycline minimum inhibitory concentrations ranged from 4 to ≥ 64 mg/L. Primers previously reported for the detection of tet(A) in Campylobacter failed to produce an amplicon using a positive control strain (Escherichia coli K12 SK1592 containing the pBR322 plasmid) and a selection of Campylobacter isolates. Accordingly, we designed new tet(A)-targeting primers on SnapGene2.3.2 that successfully generated a 407 bp product from the positive control strain only. Further in silico analysis using BLASTn and SnapGene2.3.2 revealed that previously reported Campylobacter tet(A) sequences deposited on GenBank shared 100% homology with Campylobacter tet(O). We postulate that this gave rise to the erroneous report of a high tet(A) prevalence among a pool of Kenyan broiler Campylobacter isolates that were tested using primers designed based on these apparent tet(A) sequences. In conclusion, further work would be required to determine whether the homology between tet(A) potentially present in Campylobacter and known tet(A) genes would be sufficient to allow amplification using the primers designed in our study. Finally, the existence of tet(A) in thermophilic Campylobacter spp. remains to be demonstrated.Entities:
Keywords: Antibiotic resistance; Antibiotic resistance mechanisms; Antimicrobial susceptibility; Campylobacter; Mobile genetic elements; Plasmids; Tetracycline; tet(A); tet(O)
Year: 2019 PMID: 31728161 PMCID: PMC6842541 DOI: 10.1186/s13099-019-0338-1
Source DB: PubMed Journal: Gut Pathog ISSN: 1757-4749 Impact factor: 4.181
Primer used for the detection of tet(O) and tet(A)
| Primer | Sequence (5′–3′) | Amplicon size (bp) | Annealing temperature (°C) | References |
|---|---|---|---|---|
| TetO-FW | ACGGARAGTTTATTGTATACC | 171 | 52 | [ |
| TetO-RV | TGGCGTATCTATAATGTTGAC | |||
| Tet(A)-F | GTGAAACCCAACATACCCC | 888 | 50 | [ |
| Tet(A)-R | GAAGGCAAGCAGGATGTAG | [ | ||
| Tet(A)-Camp-F | ATCGTGGCCGGCATCACCGG | 407 | 54 | This study |
| Tet(A)-Camp-R | TCCTCGCCGAAAATGACCC |