Bingqiang Wei1, Lanlan Wang2, Paul W Bosland3, Gaoyuan Zhang4, Ru Zhang2. 1. College of Horticulture, Gansu Agricultural University, Lanzhou, 730070, China. bqwei@gsau.edu.cn. 2. Vegetable Institute, Gansu Academy of Agricultural Sciences, Lanzhou, 730070, China. 3. College of Agriculture, Consumer, and Environmental Sciences, New Mexico State University, Las Cruces, 88001, USA. 4. College of Horticulture, Gansu Agricultural University, Lanzhou, 730070, China.
Abstract
BACKGROUND: Cytoplasmic male sterility (CMS) and its restoration of fertility (Rf) system is an important mechanism to produce F1 hybrid seeds. Understanding the interaction that controls restoration at a molecular level will benefit plant breeders. The CMS is caused by the interaction between mitochondrial and nuclear genes, with the CMS phenotype failing to produce functional anthers, pollen, or male gametes. Thus, understanding the complex processes of anther and pollen development is a prerequisite for understanding the CMS system. Currently it is accepted that the Rf gene in the nucleus restores the fertility of CMS, however the Rf gene has not been cloned. In this study, CMS line 8A and the Rf line R1, as well as a sterile pool (SP) of accessions and a restorer pool (RP) of accessions analyzed the differentially expressed genes (DEGs) between CMS and its fertility restorer using the conjunction of RNA sequencing and bulk segregation analysis. RESULTS: A total of 2274 genes were up-regulated in R1 as compared to 8A, and 1490 genes were up-regulated in RP as compared to SP. There were 891 genes up-regulated in both restorer accessions, R1 and RP, as compared to both sterile accessions, 8A and SP. Through annotation and expression analysis of co-up-regulated expressed genes, eight genes related to fertility restoration were selected. These genes encode putative fructokinase, phosphatidylinositol 4-phosphate 5-kinase, pectate lyase, exopolygalacturonase, pectinesterase, cellulose synthase, fasciclin-like arabinogalactan protein and phosphoinositide phospholipase C. In addition, a phosphatidylinositol signaling system and an inositol phosphate metabolism related to the fertility restorer of CMS were ranked as the most likely pathway for affecting the restoration of fertility in pepper. CONCLUSIONS: Our study revealed that eight genes were related to the restoration of fertility, which provides new insight into understanding the molecular mechanism of fertility restoration of CMS in Capsicum.
BACKGROUND: Cytoplasmic male sterility (CMS) and its restoration of fertility (Rf) system is an important mechanism to produce F1 hybrid seeds. Understanding the interaction that controls restoration at a molecular level will benefit plant breeders. The CMS is caused by the interaction between mitochondrial and nuclear genes, with the CMS phenotype failing to produce functional anthers, pollen, or male gametes. Thus, understanding the complex processes of anther and pollen development is a prerequisite for understanding the CMS system. Currently it is accepted that the Rf gene in the nucleus restores the fertility of CMS, however the Rf gene has not been cloned. In this study, CMS line 8A and the Rf line R1, as well as a sterile pool (SP) of accessions and a restorer pool (RP) of accessions analyzed the differentially expressed genes (DEGs) between CMS and its fertility restorer using the conjunction of RNA sequencing and bulk segregation analysis. RESULTS: A total of 2274 genes were up-regulated in R1 as compared to 8A, and 1490 genes were up-regulated in RP as compared to SP. There were 891 genes up-regulated in both restorer accessions, R1 and RP, as compared to both sterile accessions, 8A and SP. Through annotation and expression analysis of co-up-regulated expressed genes, eight genes related to fertility restoration were selected. These genes encode putative fructokinase, phosphatidylinositol 4-phosphate 5-kinase, pectate lyase, exopolygalacturonase, pectinesterase, cellulose synthase, fasciclin-like arabinogalactan protein and phosphoinositide phospholipase C. In addition, a phosphatidylinositol signaling system and an inositol phosphate metabolism related to the fertility restorer of CMS were ranked as the most likely pathway for affecting the restoration of fertility in pepper. CONCLUSIONS: Our study revealed that eight genes were related to the restoration of fertility, which provides new insight into understanding the molecular mechanism of fertility restoration of CMS in Capsicum.
Capsicum species are one of the most popular spice and vegetable crops in the world and Capsicum annuum is the most widely grown among the five domesticated species (C. annuum, C. baccatum, C. chinense, C. frutescens, and C. pubescens) [1]. Hybrid vigor is a phenomenon that is advantageous for breeders because of increased fruit yield, enhance resistance, and improve quality. However, the production of F1 hybrid seed needs manual emasculation that can lead to a high cost for F1 seed production [2]. The unique mechanism cytoplasmic male sterility (CMS) is one of the most valuable methods to utilize plant heterosis or hybrid vigor [3] because lack of pollen production removes the need for manual emasculation. Thus, breeders use the CMS/Rf system to produce hybrid seeds more economically, and the system is widely exploited for hybrid seed production of a number of crops including Capsicum [4-6].Male sterility is the failure of plants to produce functional anthers, pollen, or male gametes. The CMS phenotype is maternally inherited because it is controlled by the plant’s mitochondrial genome [4]. It has been proven that CMS is caused by chimeric open reading frames (ORF) resulting from the rearrangements of the mitochondrial genome [7, 8]. These ORF may disturb the function of ATPase [9], destroy the mitochondrial membrane structure [10], and produce proteins that are cytotoxic [11], which, in turn, affect the normal development of pollen [12]. In pepper, CMS was first reported in 1958 from an Indian Capsicum annuum accession (PI164835) [13]. Since then, the CMS/Rf system has been used to produce F1 hybrid seeds of pepper [14]. Two candidate CMS genes, orf456 and atp6-2 loci, have since been identified [15, 16]. Another ORF, designated orf507, is a modified version of orf456, elongated through the deterioration of a stop codon. This ORF was also proven to be related to CMS and inhibit the formation of microspore in pepper [17].The CMS phenotype can be reversed by a nuclear Rf gene. These genes have been found to restore fertility through several different mechanisms. The CMS transcript can be processed by a Rf gene at the post-transcriptional level [18]. In rice, the transcript of B-atp6-orf79 is silenced by cleavage from the restorer gene RF1A [19]. Restorer of fertility genes can also act at the translational level, as Rfo in radish is thought to repress the translational processing of orf138 [20]. In maize, a putative aldehyde dehydrogenase (rf2) was found that may act to restore fertility through detoxification during pollen development [21].Restorer-of-fertility genes have been found in a range of flowering plant species. They have been reported in petunia [22], radish [20, 23–26], sugar beet [27, 28], maize [21], sorghum [29], and rice [19, 30–32]. These Rf genes have encoded a variety of different proteins. For example, Rf1 (bvORF20) encodes an OMA1-like protein in sugar beet [27, 28], Rf2 encodes an aldehyde dehydrogenase protein in maize [21], Rf17 gene encodes an acyl-carrier protein synthase [33] and the Rf2 gene encodes a glycine-rich protein in rice [34], indicating the existence of a diverse set of Rf genes. However, most Rf genes are known to encode Pentatricopeptide Repeat (PPR) proteins [8, 35, 36]. In pepper, so far all predicted Rf genes have encoded PPRs [36, 37]. A PPR gene, CaPPR6, was identified as a strong Rf candidate based on expression pattern and characteristics of coding sequence [37]. Recently, 12 candidate PPR genes with similarity to previously reported Rf genes were also identified in pepper [38]. These candidate Rf genes provide a basis for further study of fertility restoration in pepper.It has been suggested that fertility restorer in pepper may be controlled by two complementary genes [39]. Previous studies show that the fertility restorer of CMS in pepper is controlled by two major additive-dominant epistatic genes and an additive-dominant polygene [40], and two major QTLs and several minor QTLs [41]. It could be that the two major QTLs correspond with the two major additive-dominant genes, in which case the studies support one another. In contrast, another study indicates that one major QTL and four minor QTLs relate to fertility restoration in pepper [42]. Another phenotype of partial restoration has also been reported, in which the flower simultaneously produces functional and aborted pollen, which is thought to be controlled by a gene (pr) in the nucleus separate from Rf genes [43]. In addition, the CMS phenotype can be restored temporarily under low temperature, suggesting that temperature affects the expression of some fertility modification genes [44]. Together, these various types of fertility restoration demonstrate that CMS is complex, and currently do not have a complete understanding of the molecular mechanisms that underlie the CMS/Rf system in pepper.The RNA-Seq method directly sequences transcripts by using high-throughput sequencing technologies, and it has considerable advantages for providing genome-wide information, detection of novel transcripts, and allele-specific expression [45]. Bulked segregate analysis (BSA) is an efficient method for the rapid identification of molecular markers for specific traits or target gene loci [46]. Combing the advantage of BSA and RNA-seq, BSA RNA-seq (BSR) can be used to analyze the differentially expressed genes (DEGs), and single nucleotide polymorphisms (SNPs) between the two genetic pools [47, 48].In this study, BSR-seq was applied to identify DEGs related to the fertility restorer of CMS in pepper. In addition, the transcriptomes of two parent lines were sequenced. A set of candidate genes were selected that are associated with the fertility restoration in CMS in pepper based on both the BSR-seq and parental transcriptome sequencing. The results provide new insights into the study of molecular mechanisms of restorer fertility of CMS in pepper.
Results
Database estimation of transcript sequencing
Through the RNA-sequence of the fertility restorer line (R1), the CMS line (8A), a population of 30 fertile plants pool (RP), and a population of 30 sterile plants pool (SP), a total of 41.84 GB of aligned data were obtained. The aligned data of R1 and 8A were 8.24 GB and 6.98 GB, respectively, and that of RP and SP were 14.16 GB and 12.46 GB, respectively (Table 1). These raw data can be found in NCBI (https://www.ncbi.nlm.nih.gov/) with an accession number of SRA895207. The base ratios for quality scores of each aligned data was greater than Q30% at more than 91%, and GC content was more than 41%. This indicates that the aligned data were good for the subsequent searches.
Table 1
The estimation of RNA sequence data
Samples
Read Numbera
Base Numberb
GC Contentc
% ≥ Q30d
R1
32,694,918
8,239,119,336
41.70%
91.55%
8A
27,708,115
6,982,444,980
41.82%
91.32%
RP
56,202,271
14,162,972,292
42.48%
92.06%
SP
49,443,495
12,459,760,740
42.23%
91.50%
Note: apair-end reads number in aligned data; bbase number in aligned data; cGC content in aligned data; dThe percentage of bases whose quality value of aligned data is more than or equal to Q30
The estimation of RNA sequence dataNote: apair-end reads number in aligned data; bbase number in aligned data; cGC content in aligned data; dThe percentage of bases whose quality value of aligned data is more than or equal to Q30The aligned data had a high success rate of being mapped to a reference genome. The percentage of each aligned data being mapped to a reference genome was more than 85.50%, and the unique mapped rate was greater than 82.47% (Table 2).
Table 2
The comparison between sequence data and reference genomics
Samples
Total Reads
Mapped Readsa
Mapped Ratiob
Unique Mapped Readsc
unique Mapped Ratiod
R1
65,389,836
56,002,822
85.64%
54,068,310
82.69%
8A
55,416,230
47,886,185
86.41%
46,275,567
83.51%
RP
112,404,542
97,929,810
87.12%
94,135,100
83.75%
SP
98,886,990
84,549,668
85.50%
81,549,039
82.47%
Note: aaligned data that were mapped to the reference genome; b percentage of aligned data being mapped to the reference genome; cGC content of aligned data; d percentage of bases whose quality value of aligned data is more than or equal to Q30
The comparison between sequence data and reference genomicsNote: aaligned data that were mapped to the reference genome; b percentage of aligned data being mapped to the reference genome; cGC content of aligned data; d percentage of bases whose quality value of aligned data is more than or equal to Q30
Differentially Expressed Genes (DEGs) analysis
DEGs were discovered between R1/8A and between RP/SP (Table 3). There were 3790 DEGs between R1 and 8A, in which 2274 were up-regulated and 1516 were down-regulated for expression in R1 as compared to 8A. There were also 1762 DEGs between RP and SP, in which 1490 were up-regulated and 272 were down-regulated for expression in RP as compared to SP. In an overall comparison, there were 944 co-DEGs among the above groups (R1/8A, RP/SP). Within this comparison, 891 out of 944 DEGs were commonly up-regulated in restorer accessions and the remaining 53 out of 944 DEGs were down-regulated in restorer accessions (R1 and RP) as compared to CMS accessions (8A and SP). This indicates that 891 DEGs were up-regulated not only in RP as compared to SP, but also in R1 as compared to 8A, and 53 DEGs were down-regulated not only in RP as compared to SP, but also in R1 as compared to 8A. The 891 commonly up-regulated DEGs were the subject of subsequent study.
Table 3
Three groups of DEGs
DEG Set
DEG number
Up-regulated DEG number
Down-regulated DEG number
R1/8A
3790
2274
1516
RP/SP
1762
1490
272
R1/RP ∩ 8A/SP
944
891
53
Three groups of DEGs
Gene Ontology (GO) Annotation
The 891 common up-regulated DEGs in restorer accessions were assigned to three main categories, cellular component, molecular function, and biological process. These three categories were composed of 53 functional groups using GO assignment (Fig.1).
Fig. 1
The GO functional classification of up-regulated genes. Red bars represent all expressed genes, and blue bars represent DEGs
The GO functional classification of up-regulated genes. Red bars represent all expressed genes, and blue bars represent DEGsIn the cellular component category, the majority functional groups were cell part, cell, organelle, and membrane, including 589, 573, 475, and 397 genes, respectively. The most significant GO node that is enriched to the DEGs is external side of plasma membrane (GO:0009897), composed of Capana01g001287, Capana01g00392, Capana06g000150, Capana01g004065 and Capana09g002397 totaling 5 up-regulated DEGs (Table 4). The next were GO:0009535, GO:0005615, GO:0030173, GO:0005618, GO:0048046 and GO:0016021, including 4, 5, 6, 91, 60 and 97 up-regulated DEGs, respectively (Table 4).
Table 4
The enrichment results for the cellular component DEGs by topGO
GO IDa
Termb
Annotatedc
Significantd
Expectede
KSf
GO:0009897
external side of plasma membrane
131
5
3.63
3.20E-07
GO:0009535
chloroplast thylakoid membrane
715
4
19.83
5.90E-05
GO:0009522
photosystem I
89
0
2.47
0.00023
GO:0005615
extracellular space
95
5
2.63
0.00035
GO:0030173
integral to Golgi membrane
24
6
0.67
0.00047
GO:0005618
cell wall
2279
91
63.21
0.00064
GO:0048046
apoplast
1336
60
37.06
0.00085
GO:0009523
photosystem II
104
0
2.88
0.00133
GO:0030076
light-harvesting complex
43
0
1.19
0.00134
GO:0016021
integral to membrane
2151
97
59.66
0.00153
Note: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, the smaller the KS value, the more significant enrichment
The enrichment results for the cellular component DEGs by topGONote: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, the smaller the KS value, the more significant enrichmentIn the molecular function category, the dominant function types were catalytic activity and binding with 369 and 360 genes, respectively. The most significant GO node that is enriched to the DEGs is serine-type endopeptidase activity (GO:0004252), composed of Capana04g000159, Capana06g000150, Capana09g002397, Capana05g000136, Capana11g002184 and Capana01g001287 totaling 6 up-regulated DEGs (Table 5). The next GO nodes were protein kinase activity (GO:0004672), transmembrane receptor protein kinase activity (GO:0019199), 8-hydroxyquercitin 8-O-methyltransferase activity (GO:0030761) and isoflavone 4'-O-methyltransferase activity (GO:0030746), including 56, 4, 1 and 1 up-regulated DEGs, respectively (Table 5).
Table 5
The enrichment results of molecular function DEGs by topGO
Note: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, the smaller the KS value, the more significant enrichment
The enrichment results of molecular function DEGs by topGONote: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, the smaller the KS value, the more significant enrichmentIn the biological process category, the dominant terms were metabolic process, response to stimulus, biological regulation, developmental process and cellular component organization or biogenesis including 574, 564, 511, 460, 368, 351, and 332 genes, respectively. The most significant GO node that is enriched to the DEGs is mucilage extrusion from seed coat (GO:0080001), composed of Capana04g000159, Capana05g000136, apana09g002397, Capana01g001287 and Capana06g000150 totaling five up-regulated DEGs (Table 6). The next nodes were GO:0016045, GO:0006898, GO:0010204, GO:0048359, GO:0010359, GO:0010102 and GO:0052544, including 9, 6, 1, 10, 7, 9 and 8 up-regulated DEGs, respectively (Table 6).
Table 6
The enrichment results of the biological process DEGs by topGO
Note: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, The smaller the KS value, the more significant enrichment
The enrichment results of the biological process DEGs by topGONote: aGO term ID; bGO function; call genes annotated the function; dDEGs annotated the function; eExpected value of the DEGs annotated the function; fStatistical significance of enrichment nodes, The smaller the KS value, the more significant enrichment
Kyoto Encyclopedia of Genes and Genomes (KEGG ) Metabolic Pathway of DEGs
The up-regulated shared DEGs were annotated to 49 KEGG metabolic pathways in five categories including genetic information processing, metabolism, organismal systems, cellular processes, and environmental information processing (Fig. 2). The metabolic pathways composed of the most up-regulated DEGs were starch and sucrose metabolism, oxidative phosphorylation, and plant-pathogen interaction. The next metabolic pathways composed of nine up-regulated DEGs were inositol phosphate metabolism, and the phosphatidylinositol signaling system (Fig. 2). KEGG pathways that may be involved in fertility recovery or pollen development include energy metabolism, carbohydrate metabolism, protein and amino acid metabolism, lipid metabolism, substance absorption and transport, and signal transduction (Additional File 1: Table S1). Interestingly, two metabolic pathways, phosphatidylinositol signaling system and inositol phosphate metabolism, were enriched as the most reliable pathway for enrichment significance (Fig. 3). Within these two metabolic pathways most genes were the same, with eight out of nine genes being shared between the two pathways.
Fig. 2
Statistic analysis of up-regulated differentially expressed genes in KEGG pathways
Fig. 3
Scatter plot of KEGG pathway enrichment for up-regulated DEGs. Each small shape in the figure represents a KEGG path, and the path names are shown in the legend on the right. The horizontal coordinate is the enrichment factor, the smaller the enrichment factor, the more significant the enrichment level of DEGs in the pathway. The ordinate is -log10 (Q value), the larger the ordinate, the more reliable the enrichment of DEGs in the pathway
Statistic analysis of up-regulated differentially expressed genes in KEGG pathwaysScatter plot of KEGG pathway enrichment for up-regulated DEGs. Each small shape in the figure represents a KEGG path, and the path names are shown in the legend on the right. The horizontal coordinate is the enrichment factor, the smaller the enrichment factor, the more significant the enrichment level of DEGs in the pathway. The ordinate is -log10 (Q value), the larger the ordinate, the more reliable the enrichment of DEGs in the pathwayIn the phosphatidylinositol signaling system (ko04070), scored as the most enriched system, nine genes were up-regulated (Fig. 4). Among these nine genes, five (Capana00g002844; Capana00g004424; Capana10g001436; Capana10g002170; Capana10g002470) encode phosphatidylinositol-4-phosphate 5-kinase (PI(4)P5K) and catalyzes the phosphatidylinositol-4-phosphate (PI(4)P) to phosphatidylinositol-4,5-biphosphate (PI(4,5)P2). Meanwhile, two genes (Capana03g002795 and Capana06g002131) encode phospholipase C (PLC), which could hydrolyze phosphatidylinositol (PI), PI(4)P or PI(4,5)P2 to generate double messenger molecules inositol triphosphate (IP3) and diacylglycerol (DG). Two genes (Capana05g000173 and Capana07g002321) encode inositol phosphate phosphatase and phosphatidate cytidylyltransferase, respectively, which could participate in the reduction of IP3 and DG to PI.
Fig. 4
The gene node participating in phosphatidylinositol signaling system. The red square frame means up-regulated expressed genes in the node
The gene node participating in phosphatidylinositol signaling system. The red square frame means up-regulated expressed genes in the node
Related Genes Selection and expression
According to conjoined analysis of the gene FPKM (fragments per kilobase of exon per million fragments mapped) value, difference multiple, qRT-PCR value, functional annotation and metabolic pathway classification, eight genes, related to fertility restoration of CMS in Capsicum were selected. The eight genes were Capana00g002348, Capana00g004424, Capana02g000930, Capana00g003267, Capana01g002849, Capana05g002270, Capana01g004065 and Capana06g002131, and they encode fructose kinase, phosphatidylinositol phosphokinase, pectin lyase, extragalacturonase, pectin esterase, cellulose synthase, and bundle arabinogalactan protein, respectively (Table 7). All listed genes are key enzymes and proteins in anther and pollen development.
Table 7
The selected genes related to the restorer-of-fertility and their expression and function annotation
cellulose synthase-like protein D1-like [Solanum tuberosum]
Capana01g004065
0.148665
55.2292
0.128079
158.337
8.39073
9.87305
fasciclin-likearabinogalactan protein 3 [Solanum lycopersicum]
Capana06g002131
5.21E-05
1.04156
0.203871
0.65287
4.64828
4.27352
PLC
The selected genes related to the restorer-of-fertility and their expression and function annotationAccording to RNA-sequencing, these genes were dramatically up-regulated in the restorer parent (R1) and restorer pool (RP). The majority of these selected genes related to fertility restoration showed very little expression in the CMS 8A and SP plants, and one selected gene, Capana00g004424, had no detected expression in CMS line 8A and SP (Table 7). The lack of expression of these genes was validated by qRT-PCR between 8A and R1, as well as SP and RP. The qRT-PCR results indicated that these genes were up-regulated in both R1 and RP, as compared to 8A and SP, which was completely consistent with the sequencing results (Fig. 5).
Fig. 5
The qRT-PCR validation of eight genes related to fertility restorer between 8A and R1, as well as SP and RP. (a) The relative expression of Capana00g002348 in four accessions. (b) The relative expression of Capana00g004424 in four accessions. (c) The relative expression of Capana02g000930 in four accessions. (d) The relative expression of Capana00g003267 in four accessions. (e) The relative expression of Capana01g002849 in four accessions. (f) The relative expression of Capana05g002270 in four accessions. (g) The relative expression of Capana01g004065 in four accessions. (h) The relative expression of Capana06g002131 in four accessions
The qRT-PCR validation of eight genes related to fertility restorer between 8A and R1, as well as SP and RP. (a) The relative expression of Capana00g002348 in four accessions. (b) The relative expression of Capana00g004424 in four accessions. (c) The relative expression of Capana02g000930 in four accessions. (d) The relative expression of Capana00g003267 in four accessions. (e) The relative expression of Capana01g002849 in four accessions. (f) The relative expression of Capana05g002270 in four accessions. (g) The relative expression of Capana01g004065 in four accessions. (h) The relative expression of Capana06g002131 in four accessionsThe relative expression of two obviously down-regulated genes (NewGene11661 and NewGene949) both in fertile accessions R1 and RP as compared to sterile accessions 8A and SP were validated by qRT-PCR. The results indicated that two genes were also down-regulated in R1 compared to 8A (Fig. 6).
Fig. 6
The qRT-PCR validation of two obviously down-regulated genes between 8A and R1
The qRT-PCR validation of two obviously down-regulated genes between 8A and R1Tissue from four different developmental stage buds tested the relative expression, and the different stages are shown in Fig. 7. The qRT-PCR results show that the expression of these genes had a lower and relatively stable level among four developmental stages of flower buds in 8A. However, in the F1 generation, the relative expression varied among the different developmental stages. In the F1 generation, as the flower buds developed, the relative expression had a dramatic increase. At stage III, the expression increased rapidly until it peaked at stage IV (Fig. 8).
Fig. 7
The four developmental stages of flower buds used for qRT-PCR analysis
Fig. 8
The expression of genes related to fertility restorer in different developmental stage of buds between 8A and F1. (a) The relative expression of Capana00g002348. (b) The relative expression of Capana00g004424. (c) The relative expression of Capana02g000930. (d) The relative expression of Capana00g003267 in four accessions. (e) The relative expression of Capana01g002849. (f) The relative expression of Capana05g002270. (g) The relative expression of Capana01g004065. (h) The relative expression of Capana06g002131
The four developmental stages of flower buds used for qRT-PCR analysisThe expression of genes related to fertility restorer in different developmental stage of buds between 8A and F1. (a) The relative expression of Capana00g002348. (b) The relative expression of Capana00g004424. (c) The relative expression of Capana02g000930. (d) The relative expression of Capana00g003267 in four accessions. (e) The relative expression of Capana01g002849. (f) The relative expression of Capana05g002270. (g) The relative expression of Capana01g004065. (h) The relative expression of Capana06g002131In addition, the relative expression of two down-regulated genes were analyzed in four developmental stages of the buds between 8A and F1. The relative expression of NewGene11661 improved with the development of flower buds in two accessions, and the expression in every stage of 8A were higher than in R1 (Fig. 9). Unfortunately, although the relative expression of NewGene949 was higher in every stage in 8A than in R1, there was not agreement with the expected tendency (Fig. 9).
Fig. 9
The relative expression of two down-regulated genes in different developmental stage of buds between 8A and F1. (a) The relative expression of NewGene11661. (b) The relative expression of NewGene949
The relative expression of two down-regulated genes in different developmental stage of buds between 8A and F1. (a) The relative expression of NewGene11661. (b) The relative expression of NewGene949
Discussion
Male sterility and the fertility restorer system are an extremely complex biological process involving substance and energy metabolism, signal transduction pathway, substance transportation, pollen wall morphogenesis, tapetum formation and programmed cell death (PCD), and a series of related gene expression regulation processes.Anthers are the strongest energy reservoir in the flower organs, and have a very active metabolism during development. A large number of sugars are transported to the anther [49], which can regulate the expression of genes as both a substrate of carbohydrate and a signal molecule in anthers [50]. In this study, one gene encoding fructokinase had an up-regulated expressed value of log2FC more than 8.5 times in R1/8A as well as RP/SP in a sucrose and starch metabolism pathway, which indicated that fructokinase is one of the key genes that regulates the fertility restorer of CMS in pepper.Generally, pectin and callose in pollen mother cell (PMC) are degraded absolutely, otherwise the microspore cannot be separated from the tetrad [51, 52]. The pectin methylesterification, is degraded by de-methylated esterification first by methylesterases (PMEs), then the combined action of PME, pectin lyases (PLs), and polygalacturonases (PGs) [53, 54]. In Arabidopsis, QRT1 gene encodes a PME, QRR2, and QRT3 encoding an external PG and an endonuclear PG, respectively. The loss of function of QRT1 didn’t reduce the level of pectin methylesterification. If the level of the pectin methylesterification is higher, it cannot be degraded by PG [55]. In this study, three genes encoding PME, PL and exo-PG were selected. What is more, these genes had up-regulated expression and the log2FC were as high as 11.4473, 10.2657, and 8.97438, respectively. The results presented are in agreement with Hamid et al [56] that showed that eight pectin lyase-like superfamily protein coding genes and five pectin methylesterase genes were up-regulated in fertile plants as compared to Cytoplasmic Genic Male Sterility (CGMS) in cotton. In addition, a fasciclin-like protein gene was also up-regulated in restorer materials in this study. This result was similar to the reports of Hamid et al. [56], in which three cytoskeleton organization genes were up-regulated in fertile lines in cotton. These up-regulated genes may have a positive role in the degradation of pectin and the normal release of microspores.It is well known that celluloses and hemicelluloses are the important components of pollen intine. Cellulose composed of a class of β-1,4-glucan molecular long chain plays an important role in cell wall toughness and strength. The deposition of cellulose on intine is mainly carried out by cellulose synthase complexes (CSCs) that is located on the cell membrane [57, 58]. In Arabidopsis, the deposition of cellulose in intine and extine was not well-distributed in the mutant of CESA1 gene and CESA3 gene, which resulted in abnormal pollen development. Fortunately, we also choose one gene encoding cellulose synthase that is up-regulated dramatically in restorer accessions.It is commonly thought that the phosphatidylinositol signal system is one of the important signal systems for plant seed germination, growth and reproduction, senescence and response to environmental factors [59]. Pollen development undergoes a series of complex cell division and differentiation processes, which involve the dynamic changes of many cell components and internal subcellular components, including vacuole and cytoskeleton [60]. Many components of phosphatidylinositol signaling system participate in the vacuolar diversification during pollen development and vesicle transport in pollen tube growth. In this study, eight genes were up-regulated in phosphatidylinositol signal system. There are five genes that encode PI(4)P5K, which can catalyze PI(4)P to PI(4,5)P2. Previous studies have shown that PI(4)P is very important for pollen and stigma affinity, and PI(4,5)P2 plays an important role in vesicle transport and cell skeleton rearrangement [61]. PI(4)P5K is a very important enzyme in the development of the anther, it would lead to an abnormal morphology of the pollen tube if PI(4)P5K was lost, thus inhibiting the germination of pollen and the growth of the pollen tube [62-65]. In Arabidopsis, PIP5K1 and PIP5K2 are important for vacuole biogenesis and early pollen development, pollen grains from flowers of the pip5k1+/−pip5k2+/−mutants show defects in vacuoles and exine wall formation [65]. In addition, two genes encode PLC, and PLC is the most important in phosphatidylinositol signal system, which could hydrolyze PI, PI(4)P and PI(4,5)P2, to double as the messenger molecules inositol trisphosphate (IP3) and diacylglycerol (DG). It is also known that there is a calcium dependent PLC activity in pollen tubes, and PLC and IP3 are involved in the germination and growth of pollen tubes [66]. PLC can monitor the growth of the pollen tube not only by adjusting the content of PI(4,5)P2, but also by regulating the concentration of Ca2+ and membrane secretion.The development of pollen walls plays a key role in the development of pollen, and it leads to male sterility in plants if the development of the pollen outer wall is blocked. Sporopollenin is the main substance that constitutes the outer wall of pollen, and the sporopollenins are mainly composed of polymerized phenols and long-chain fatty acid derivatives, which are difficult to decompose and can effectively protect pollen from degradation from the outside. There is also a thick oil-bearing layer outside of the pollen grain, including hydrophobic lipids and proteins, composed of long-chain fatty acid derivatives [67, 68]. Previous studies showed that sporopollenin biosynthesis is closely associated with fatty acid metabolism [69, 70]. Therefore, lipid accumulation plays an important role in pollen morphogenesis. In this study, some up-regulated genes related to lipid metabolism pathway were discovered, and these metabolic genes may be involved in the synthesis of lipids in the tapetum, which are then transported to the pollen wall surface (Additional file 1: Table S1). It had also been reported in cabbage that in the protein interaction network around CYP704B1, more than 1/3 of the protein species were involved in fatty acid metabolism, and all of them were significantly reduced in 83121A [71].Vesicle transport and lipid carrier transport are the two main modes of sporopollen transportation. Adenosine triphosphate binding cassette (ABC) is a protein family in which ABC members were involved in the transmembrane transport of substances. In Arabidopsis thaliana, more than 120 ABC proteins have been identified. They are involved in the transport of ions, hormones, secondary metabolites, lipids, and proteins. The ABCG26/GBC27 belongs to the G subfamily of ABC protein and is expressed in microspore and tapetum, which may be involved in the transport of sporopollen [72, 73]. In this study, two up-regulated ABC transport genes were discovered that may be involved in the transportation of sporopollen (Additional file 1: Table S1).In addition, the synthesis of fatty acid needs ATP and acetyl-CoA that come from cell respiration and energy metabolism. Plant energy metabolism mainly includes the tricarboxylic acid cycle, glycolysis, pentose phosphate pathway, and the electron transport and oxidative phosphorylation. This energy metabolism provides ATP and acetyl-CoA for the synthesis of fatty acids. Previous studies have shown that the impairment of respiratory chain enzymes and enzyme complexes can lead to CMS [74, 75]. Similar to the results in eggplant [76], this study found many up-regulated genes in the restorer line to participate in energy pathways, such as oxidative phosphorylation, glycolysis, and citrate cycle (Additional file 1: Table S1).The relative expression of NewGene11661 was down-regulated in the F1 while up-regulated in 8A, and the expression increased with the development of flower buds. However, it did not improve more dramatically than other candidate genes. NewGene11661 was annotated as UDP-glycosyltransferase gene. The UDP glycosyltransferase could catalyze conjugation of lipophilic chemicals with sugar donated by UDP-glycoside, generating water-soluble products that can be easily excreted and resulting in the detoxification and elimination of their substrate [77, 78]. However, the roles of this enzyme in the development pollen or CMS have been rarely reported and needs further study.
Conclusion
By RNA sequencing, in this study 891 DEGs were up-regulated and 53 DEGs were down-regulated in restorer accessions as compared to the CMS accessions. The 891 up-regulated DEGs in restorer accessions were assigned to three main functional categories: cellular component, molecular function, and biological process, all of which were composed of 53 functional groups using GO assignment. The up-regulated DEGs were annotated to 49 KEGG metabolic pathways in five categories including genetic information processing, metabolism, organismal systems, cellular processes, and environmental information processing. As in Fig. 3, two metabolic pathways, phosphatidylinositol signaling system and inositol phosphate metabolism, were statistically the most likely pathways for affecting fertility restoration. Finally, eight DEGs were selected that encoded fructose kinase, phosphatidylinositol phosphokinase, pectin lyase, extragalacturonase, pectin esterase, cellulose synthase, and bundle arabinogalactan protein. The qRT-PCR results showed that the expression of these genes had a lower and relatively stable level between four developmental stages of the flower bud in 8A. But in the F1 generation, with the development of flower buds, the relative expression had a tendency to significant increase, especially at the stage III, where the expression increased rapidly and peaked at stage IV. The tendency to significantly increase the eight candidate genes supports RNA differential expression and are likely to be involved in pepper fertility restoration.
Materials and Methods
Plant sample collection and preparation
The CMS 8A line was completely sterile, and the fertility restorer line R1 completely restored the fertility of 8A (Fig. 10). The F2 population from the self-pollination of the F1 individuals showed segregation for fertility. The restore fertility pool (RP) was constructed from 30 polar fertile plants and the sterile pool (SP) was constructed from 30 polar sterile plants. The flower buds of 8A, R1, SP, and RP at the tetrad stage were used for total RNA extraction. Four different developmental stages of flower buds of 8A and F1 analyzed the relative expression of fertility restoration related genes.
Fig. 10
The flower pictures of CMS line 8A and fertility restorer line R1
The flower pictures of CMS line 8A and fertility restorer line R1
RNA extraction and library construction and RNA Sequencing
Total RNA was extracted separately from the flower buds of 8A, R1, SP, and RP according to the instructions of Trizol Reagent (Life technologies, California, USA). The RNA purity was checked using the NanoPhotometer® spectrophotometer (IMPLEN, CA, USA). The RNA concentration was measured using Qubit® RNA Assay Kit in Qubit®2.0 Flurometer (Life Technologies, CA, USA). The RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Then the mRNA was enriched using magnetic beads with Oligo (dT) for reverse transcription. The cDNA library was constructed following the manufacturer’s instructions for NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530). Finally, the cDNA libraries of the four flower buds from 8A, R1, SP, and RP have been sequenced on a flow cell using the Illumina HiSeq™ 2500 sequencing platform.
Transcriptome analysis using reference genome-based reads mapping
Low quality reads, such as adaptor sequences, unknown nucleotides greater than 5%, or low quality score (Q-value)≤ 20 bases, were removed by Perl script. The aligned reads that were filtered from the raw reads were mapped to the Pepper Genome Database (release 2.0) [79] using TopHat2 software [80]. The aligned records in BAM/SAM format examined to remove potential duplicate molecules. Gene expression levels were estimated using FPKM values by the Cufflinks software [81]. Identification of new genes was based on transcript discovery with Cufflinks, and then filtering the genes encoding for a short peptide chain (less than 50 amino acid residues). By comparing the raw gene model and the result of transcriptome assembly, gene structure was optimized. SpliceGrapher integrated splice graphs generated from Cufflinks output and read alignments to produce comprehensive alternative splicing predictions [82].
Identification of DEGs
To evaluate DEGs among lines 8A, R1, SP, and RP, the EBSeq [83] was employed with screening criteria FC ≥ 2 / log2FC ≥ 1 and False Discovery Rate (FDR) < 0.01. The differential multiple / FC represents the ratio of the expression between the two groups. By adjusting the difference between P-values, the FDR is obtained. Because the differential expression analysis of transcriptome sequencing is an independent statistical hypothesis test for a large number of gene expression values, there is a false positive problem. To address this, in the process of differential expression analysis, the accepted Benjamini-Hochberg correction method corrected the significant P-value obtained from the original hypothesis test, and finally FDR was used as the key index for screening DEGs.
GO classification and enrichment analysis
Perl script plotted GO functional classification for the unigenes with a GO term hit to view the distribution of gene functions. GO enrichment analysis of the DEGs was implemented by the GOseq R packages based Wallenius non-central hyper-geometric distribution [84], which can adjust for gene length bias in DEGs.
KEGG pathway and enrichment analysis
KEGG is a database resource for understanding high-level functions and utilities of the biological system, such as the cell, the organism, and the ecosystem, from molecular-level information, especially large-scale molecular datasets generated by genome sequencing and other high-throughput experimental technologies (http://www.genome.jp/kegg/) [85]. This study used KOBAS software to test the statistical enrichment of differential expression genes in KEGG pathways [86].
Screening of fertility restoration related genes
Genes related to fertility were selected according to comprehensive estimation of gene log2FC value and gene function. Firstly, genes that were dramatically up-regulated (log2FC ≥ 7) in restorer accessions as compared to sterile accessions were selected. Genes were selected on the basis of having FPKM values higher in restorer accessions and having FPKM values close to zero in sterile accessions (Table 7). Secondly, this group was filtered according to function, choosing genes playing an important role in the normal development of pollen as found in previous studies, or are involved mostly in the important or enriching pathways in this study to further evaluate.
Expression analysis of fertility restoration related genes
Extraction of RNA was performed under the conditions described above. The first strand cDNA synthesis was carried out using the 1st strand cDNA synthesis kit (Revert Aid Premium Reverse Transcriptase) (Thermo Scientific, EP0733). A total of eight fertility restorer related genes and two down-regulated genes were tested for their relative expression and the CaActin (GenBank Accession: GQ339766.1) gene was the internal control (Table 8). The total volume of each reaction is 20 μL. Using SG Fast qPCR Master Mix (High Rox) (2×), qRT-PCR was carried out (BBI, B639273). The qRT-PCR was performed on an ABI Stepone plus Real-Time PCR System (Applied Biosystems, USA) with the following cycling parameters: 95°C for 3 m, followed by 45 cycles of: 95 °C for 7 s, 57°C for 10 s, 72°C for 15 s. The relative expression was calculated by using the 2−ΔΔCt method described by Livak and Schmittgen [87]. All reactions were performed with at least three replicates.
Table 8
The test genes and their primers for qRT-PCR
Gene
Forward Primer
Reverse Primer
length
Sequence
Tm
Sequence
Tm
Capana00g002348
AGGGTCCAAAATGGGCTGT
59.0
CTCCCCAAAACATACGACGA
58.3
190
Capana00g004424
CAGGTGAATGGAAGAATGGTG
57.7
ACATAAAAGCTCCCATCAGTCC
57.8
139
Capana02g000930
TGCAAAGCTACAAAACCATCG
59.2
ATCACCTTCATCCCCAGTCCT
59.6
191
Capana00g003267
GTGGTGGTACTCTAAACGGACAA
58.7
TGAATCTGGTGCTGTAATCTTGAG
59.1
215
Capana01g002849
TATGGCGATGGATGATTGC
57.2
GGTAGGCGTAGACCTTTGAAAG
58
149
Capana05g002270
CCCTTGAGGAACTATGGCGTA
59.5
CTTCATCATCACCAGCAGACTTT
58.7
150
Capana01g004065
TGTTGTAGGCTCTGTGCGTG
57.7
GGCTGAGATAGGTGCCATTG
57.9
133
Capana06g002131
TCAGGGCTAATGGTGGTTGT
57.7
TTCTTTACTTCATCAGCAGGGA
57.1
238
NewGene11661
GCCCATCGCTGTTCTTATTG
58.3
TGAAGACGGGCGTGAGTGT
59.2
116
NewGene949
TTTGAGGTGGGGTGGTTGT
57.9
AGTGGTTGCCATGAAGGTTG
58.1
166
CaActin
TGCCTGATGGACAAGTTATTACC
58.8
TGAGCACAATGTTACCGTAGAGG
59.7
174
The test genes and their primers for qRT-PCRAdditional file 1: Table S1. The KEGG Pathway related to the pepper restoration of fertility or pollen development.
Authors: Cole Trapnell; Brian A Williams; Geo Pertea; Ali Mortazavi; Gordon Kwan; Marijke J van Baren; Steven L Salzberg; Barbara J Wold; Lior Pachter Journal: Nat Biotechnol Date: 2010-05-02 Impact factor: 54.908