Literature DB >> 31709785

D-dopachrome tautomerase from Japanese sea bass ( Lateolabrax japonicus) is a chemokine-like cytokine and functional homolog of macrophage migration inhibitory factor.

Feng Xu1,2, Ming-Yun Li2, Jiong Chen1,2,3.   

Abstract

D-dopachrome tautomerase (DDT), a member of the macrophage migration inhibitory factor (MIF) protein superfamily, is a newly described cytokine with chemokine-like characteristics. However, research on fish DDT remains limited. In this study, we identified a DDT homolog (LjDDT) from the Japanese sea bass, Lateolabrax japonicus. Sequence analysis showed that LjDDT had typical sequence features of known DDT and MIF homologs and was most closely related to DDT of rock bream ( Oplegnathus fasciatus). LjDDT transcripts were detected in all tested tissues of healthy Japanese sea bass, with the highest expression found in the liver. Upon infection with Vibrio harveyi, LjDDT transcripts were significantly down-regulated in the three tested tissues, including the liver, spleen, and head kidney. Recombinant LjDDT (rLjDDT) and the corresponding antibody (anti-rLjDDT) were subsequently prepared. The administration of 100 μg/g anti-rLjDDT had a statistically significant protective effect on the survival of V. harveyi-infected fish. Moreover, rLjDDT was able to induce the migration of monocytes/macrophages (MO/MФ) and lymphocytes both in vitro and in vivo, but without significant influence on the migration of neutrophils. rLjDDT exhibited chemotactic activity for lipopolysaccharide (LPS) -stimulated M1-type MO/ MΦ in vitro, but not for cAMP-stimulated M2-type MO/MΦ. Furthermore, the knockdown of LjCD74, but not LjCXCR4, significantly down-regulated the rLjDDT-enhanced migration of MO/MΦ and relieved the rLjMIF-inhibited migration of MO/MΦ. These results indicate that LjCD74 may be the major chemotactic receptor of LjDDT and LjMIF in Japanese sea bass MO/MΦ. Combined rLjDDT+ rLjMIF treatment had no significant effect on the migration of MsiRNA, LjCD74si-, or LjCXCR4sitreated MO/MΦ compared to the control group, suggesting that the roles of LjDDT and LjMIF may be antagonistic. In conclusion, our study demonstrates for the first time that DDT may play a role in the immune responses of fish against bacterial infection through chemotactic recruitment of MO/MΦ via mediation of CD74 as an antagonist of MIF.

Entities:  

Keywords:  Cell migration; D-dopachrome tautomerase; Japanese sea bass; Macrophage migration inhibitory factor; Monocyte/macrophage

Mesh:

Substances:

Year:  2020        PMID: 31709785      PMCID: PMC6956724          DOI: 10.24272/j.issn.2095-8137.2020.003

Source DB:  PubMed          Journal:  Zool Res        ISSN: 2095-8137


INTRODUCTION

Macrophage migration inhibitory factor (MIF) was first reported to inhibit the random migration of peritoneal lymphocytes and macrophages in hypersensitized guinea pigs (Bloom & Bennett, 1966; David, 1966). It is a pleiotropic proinflammatory cytokine with multiple biological functions in both innate and acquired immunity (Günther et al., 2019). MIF has chemokine-like characteristics (Bernhagen et al., 2007; Sinitski et al., 2019) and also plays a role in pathological diseases, including autoimmune diseases (Rijvers et al., 2018). MIF exerts its biological functions through autocrine and paracrine signaling via binding to and activating its receptors, including HLA class II histocompatibility antigen gamma chain (CD74), C-X-C motif chemokine receptor 4 (CXCR4), and C-X-C motif chemokine receptor 2 (CXCR2) (Bernhagen et al., 2007; Jankauskas et al., 2019; Klasen et al., 2014; Leng & Bucala, 2006; Rajasekaran et al., 2016; Rijvers et al., 2018). For example, MIF promotes the migration of B-cells through a zeta chain of the T-cell receptor-associated protein kinase 70 (ZAP70) -dependent pathway, which is mediated by the cooperative engagement of CXCR4 and CD74 (Klasen et al., 2014). D-dopachrome tautomerase (DDT), which is a newly described cytokine and a member of the MIF protein superfamily, has attracted increasing research attention (Furukawa et al., 2016; Ma et al., 2019; Merk et al., 2012). DDT was originally identified as an enzyme in the cytoplasm of human melanoma, human liver, and rat organs, which converts D-dopachrome into 5,6-dihydroxyindole (Odh et al., 1993). The DDT gene is related to MIF in terms of sequence, enzyme activity, and gene structure (Esumi et al., 1998; Sugimoto et al., 1999). Human DDT shares 34% amino acid identity with MIF and is located within 80 kb of MIF in genomes (Merk et al., 2012). Recent studies have revealed that DDT is a functional homolog of MIF (Coleman et al., 2008; Merk et al., 2012). In mammals, DDT is associated with numerous physiological processes, including cell recruitment and migration (Rajasekaran et al., 2016; Wang et al., 2017), tumorigenesis and cancer progress (Coleman et al., 2008; Guo et al., 2016; Wang et al., 2017), and inflammatory and autoimmune diseases (Benedek et al., 2017; Fagone et al., 2018; Günther et al., 2019; Kim et al., 2017). DDT also binds to and signals via CD74 but differs from MIF by lacking the pseudo-(E)LR motif necessary for activation of chemokine receptors (Jankauskas et al., 2019; Tilstam et al., 2017; Weber et al., 2008). DDT sequences have been found in many species of fish, but studies on their biological functions are rare (Oh et al., 2013). Recombinant DDT in the rock bream (Oplegnathus fasciatus) induces the expression of proinflammatory cytokines such as tumor necrosis factor alpha (TNF-α), interleukin-8 (IL-8), and interleukin-1β (IL-1β) in head kidney cells, indicating that DDT may be involved in the inflammatory responses of fish (Oh et al., 2013). The Japanese sea bass (Lateolabrax japonicus) is a euryhaline marine fish species commonly farmed in China, Japan, and Korea due to its high commercial value. With the growth of the marine aquaculture industry, outbreaks of infectious diseases have become increasingly frequent, leading to serious output declines and economic losses (Zhou et al., 2014). Vibrio harveyi has been identified as a major pathogen and cause of vibriosis disease in Japanese sea bass (Zhou et al., 2014). Studying the immune system of marine fish will provide a better understanding of their immune responses to antigenic substances and related mechanisms and may help to develop better disease management strategies for fish farmed under harsh environments. We previously found that Japanese sea bass MIF (LjMIF) can inhibit trafficking of monocytes/macrophages (MO/MΦ) and lymphocytes, enhance phagocytosis and intracellular killing of V. harveyi by MO/MΦ, and aggravate V. harveyi infection (Xu et al., 2019). In the present study, we identified a Japanese sea bass DDT (LjDDT) and investigated the relationship between LjDDT mRNA expression and V. harveyi infection. Moreover, we determined the effects of LjDDT on the regulation of immune cell trafficking and MO/MΦ function in vitro. The functional relationships between LjDDT and LjMIF and their receptors LjCD74 and LjCXCR4 were also investigated.

MATERIALS AND METHODS

Fish rearing

Healthy Japanese sea bass, weighing approximately 100 g, were obtained from a commercial farm in Xiangshan County, Ningbo City, China. Fish were maintained in experimental tanks filled with artificial seawater (salinity 20±2, pH 7.5±0.4, temperature 27±1 °C) and acclimated to laboratory conditions for two weeks prior to experimentation. All fish were healthy before the experiment. All experiments were performed in accordance with the Experimental Animal Management Law of China and approved by the Animal Ethics Committee of Ningbo University.

Sequence analysis of LjDDT

cDNA sequences of LjDDT were retrieved from three newly determined transcriptomes of Japanese sea bass annotated by the Beijing Genomics Institution, China (data not shown). The DDT homolog sequence was then amplified via polymerase chain reaction (PCR) using the cDNA template of Japanese sea bass and authenticated by further cloning, sequencing, and BLAST searching ( http://blast.ncbi.nlm.nih.gov/Blast.cgi). The signal peptide was predicted using SignalP v4.1 ( http://www.cbs.dtu.dk/services/SignalP/). The protein domain architecture was analyzed using SMART ( http://smart.emblheidelberg.de/). Multiple alignments were carried out using ClustalW ( http://clustalw.ddbj.nig.ac.jp/). Non-classical secretion was analyzed using SecretomeP 2.0 ( http://www.cbs.dtu.dk/services/SecretomeP/). Phylogenetic and molecular evolutionary analyses were conducted using MEGA v7 (Kumar et al., 2016). The cDNA sequences of DDTs or MIFs used in this study are listed in Supplementary Table S1.

Tissue mRNA expression analysis of LjDDT in Japanese sea bass under healthy and pathological conditions

In vivo bacterial challenge was performed as described previously (Xu et al., 2019). Briefly, the V. harveyi strain ATCC33866, which was purchased from the China General Microbiological Culture Collection Center (China), was cultured in Tryptic Soy Broth (TSB) medium at 28 °C with constant shaking at 200 r/min until the logarithmic growth phase. The harvested V. harveyi cells were washed three times and resuspended in 100 μL of sterile phosphate buffered saline (PBS). The experimental groups were infected by an intraperitoneal (ip) injection of V. harveyi (5×106 colony-forming units (CFU) per fish), according to the determined 50% lethal dose (LD50) in 72 h; the same volume of PBS was used for the control group. The liver, spleen, and head kidney were collected from fish at 6, 12, 24, 36, and 48 h post infection (hpi) for pathology-related mRNA expression analysis using quantitative real-time PCR (qRT-PCR). The liver, spleen, head kidney, trunk kidney, gill, intestine, brain, skin, muscle, and heart of healthy Japanese sea bass were also collected for tissue mRNA expression pattern analysis using qRT-PCR. DNase I digestion and first-strand cDNA synthesis were conducted as reported previously (Chen et al., 2019). Based on the cDNA sequence of LjDDT, primers LjDDT-F(+): 5'- AAACCAGAGGACAGGATGAATC-3' and LjDDT-R(-): 5'- CACACCGATAGCAGACACC-3' were designed for the detection of the LjDDT transcript by qRT-PCR. Amplification was performed using TB Green Premix Ex Taq II (Takara Bio, Japan), and the reaction mixture was incubated in an ABI StepOne Real-Time PCR System (Applied Biosystems, USA) as follows: 94 °C for 180 s, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, followed by melting curve analysis at 94 °C for 30 s, 72 °C for 30 s, and 94 °C for 30 s. Relative expression of LjDDT was normalized to that of Lj18S rRNA. Samples obtained under healthy and pathological conditions were assessed using the 2–ΔCT and 2–ΔΔCT methods, respectively. Each experiment was performed in triplicate and repeated four times.

Prokaryotic expression of LjDDT and antibody preparation

Primer pair LjDDT-p(+): 5'-G GAATTCATGCCTTTCATCAACT TAGAGAG-3' (underlined section is restriction site for EcoR I) and LjDDT-p(-): 5'-G CTCGAGTCACAAGAAGCTCATGACGG T-3' (underlined section is restriction site for Xho I) was designed for amplification of the complete open reading frame (ORF) sequence of LjDDT. After restriction enzyme digestion, the amplicon was cloned into the EcoR I/Xho I-digested pET- 28a (+) expression vector for the construction of plasmid pET- 28a-LjDDT. pET-28a-LjDDT was subsequently transformed into the Escherichia coli strain BL21 (DE3). The overexpression of recombinant LjDDT (rLjDDT) was induced by isopropyl-β-D-thiogalactopyranoside (IPTG). rLjDDT was purified using a nickel-nitrilotriacetic acid (Ni-NTA) column (QIAGEN, China) at 4 °C. Lipopolysaccharide (LPS) was removed using Detoxi-Gel (Thermo Fisher Scientific, USA). The purified rLjDDT was then used as an antigen to immunize mice to produce antiserum. The anti-rLjDDT IgG (anti-rLjDDT) and isotype IgG (IsoIgG) were purified from mouse sera using Protein G HP SpinTrap columns (GE Healthcare, USA) and their concentrations were determined using the Bradford protein assay. The specificity of the antibody was tested by Western blotting and visualized using an enhanced chemiluminescence (ECL) kit (Advansta, USA), as described previously (Ren et al., 2019). The lyophilized rLjDDT and anti-rLjDDT were kept at –20 ºC until use.

Fish survival assay

Healthy fish were randomly divided into eight groups for survival study: i.e., (1) Control, ip-injected with 100 μL of PBS 30 min post V. harveyi (1×104 CFU/fish) infection; (2) ip-injected with rLjDDT (1 μg/g body weight) 30 min post V. harveyi (1×104 CFU/fish) infection; (3) ip-injected with rLjDDT (10 μg/g body weight) 30 min post V. harveyi (1×104 CFU/fish) infection; (4) ip-injected with rLjDDT (100 μg/g body weight) 30 min post V. harveyi (1×104 CFU/fish) infection; (5) ip-injected with anti-rLjDDT (1 μg/g body weight) 1 h before V. harveyi (1×104 CFU/fish) infection; (6) ip-injected with anti-rLjDDT (10 μg/g body weight) 1 h before V. harveyi (1×104 CFU/fish) infection; (7) ip-injected with anti-rLjDDT (100 μg/g body weight) 1 h before V. harveyi (1×104 CFU/fish) infection; and (8) ip-injected with IsoIgG (10 μg/g body weight) 1 h before V. harveyi (1×104 CFU/fish) infection. Over the next 9 d, the fish were monitored daily for death or moribund state. The Kaplan-Meier method was used to analyze the 9 d survival rate.

Isolation of MO/MΦ, lymphocytes, and neutrophils from peripheral blood

MO/MΦ, lymphocytes, and neutrophils were separated from caudal vein blood of healthy Japanese sea bass according to a previously described method (Liu et al., 2018). Briefly, heparinized blood was collected, and cells were isolated following sedimentation with 6% dextran T 500 (Sigma, USA). After low-speed centrifugation at 400 g for 25 min at 24 °C, cells packed below Ficoll-Hypaque PREMIUM (GE Healthcare) (i. e., erythrocytes and neutrophils) were subjected to hypotonic lysis with ice-cold ACK (Ammonium-Chloride-Potassium) Lysis Buffer (0.15 mol/L NH4Cl, 0.01 mol/L KHCO3, 0.1 m mol/L EDTA) to eliminate red blood cells. The resulting neutrophil suspension was washed and suspended in RPMI 1640 medium (Invitrogen, China). The buffer layer above the Ficoll-Hypaque PREMIUM was collected and washed carefully, and the number of cells was determined using a hemocytometer (Sangon, China). Cells were cultured in 35 mm dishes for 12 h, and adherent MO/MΦ and non-adherent lymphocytes were carefully collected and cultured in complete medium (RPMI 1640 supplemented with 5% (v/v) Japanese sea bass serum, 5% (v/v) fetal bovine serum (FBS, Invitrogen), 100 U/mL penicillin, and 100 μg/mL streptomycin) at 24 °C with 5% CO2.

Primary culture of Japanese sea bass head kidney-derived MO/MΦ

Head kidney-derived MO/MФ were isolated from healthy Japanese sea bass and cultured as described previously (Chen et al., 2014). Briefly, leukocyte-enriched fractions were obtained from the Ficoll-medium interface using a Ficoll density gradient (1.077±0.001 g/mL) (Invitrogen) and seeded into 35 mm dishes. After overnight incubation at 24 °C, non-adherent cells were removed by washing and adherent cells were subsequently cultured in complete medium at 24 °C with 5% CO2.

In vitro cell migration assay

In vitro cell migration assay was performed in a 24-well Transwell chamber (Corning, USA). For the assay of peripheral blood-derived cells, rLjDDT or rLjMIF in complete medium was added to the lower chambers at concentrations of 0, 1.0, and 10.0 μg/mL respectively; MO/MΦ, neutrophils, or lymphocytes were plated on the upper chambers. The chambers were incubated at 24 °C for 4 h. Cells that migrated from the upper to lower chambers were counted using light microscopy (Nikon, Japan). Each migration assay was performed in quadruplicate. For the polarized MO/MΦ assay, the isolated Japanese sea bass head kidney-derived MO/MФ were treated with 10.0 μg/mL LPS or 0.5 mg/mL cyclic adenosine monophosphate (cAMP) for 12 h to produce M1 or M2 type MO/MФ, as described previously (Chen et al., 2018). The in vitro chamber assay was then used to determine the chemotactic effect of rLjDDT (at concentrations of 0, 1.0, and 10.0 μg/mL, respectively) on M1 and M2 MO/MΦ, with non-stimulated MO/MΦ used as the control.

In vivo cell migration assay

Fish in the experimental groups were ip-injected with 1.0 μg/g or 10.0 μg/g rLjDDT or rLjMIF per fish in 100 μL of PBS; fish in the control group received the same volume of PBS. Peritoneal cells were collected at 24 hpi and rinsed with 2 mL of PBS using a single-use aseptic injector. After centrifugation at 800 g for 8 min at 24 °C, cell pellets were retained and resuspended in 1 mL of PBS. The direct cell counts were evaluated at 400× magnification using a hemocytometer. MO/MΦ, lymphocytes, and neutrophils were further identified microscopically via the Wright-Giemsa staining technique according to previously described methods (Yu et al., 2019).

In vitro MO/MΦ migration after LjCD74 and LjCXCR4 knockdown

Japanese sea bass head kidney-derived MO/MΦ were transfected with LjCD74 (MK605507) small interfering RNA (LjCD74si) (5'-GCUCCAAUGAGGAUGCAAATT-3') or LjCXCR4 (MK605474) siRNA (LjCXCR4si) (5'- CCAACACUCCAGGAUCAUUTT-3') for 48 h to knock down the expression of the target gene, with Mismatched siRNA (MsiRNA) (5'-UUCUCCGAACGUGUCACGUTT-3') treatment used as the negative control. qRT-PCR was used to confirm knockdown of LjCD74 and LjCXCR4 expression. These MO/MΦ were then plated on the upper chambers, and rLjDDT (or rLjMIF) in complete medium was added to the lower chambers at a concentration of 10.0 μg/mL. The in vitro cell migration assay was performed as described in the previous section.

Statistical analysis

All data are presented as mean±standard error of mean (SEM). Statistical analysis was performed using one-way analysis of variance (ANOVA) with SPSS v13.0 (SPSS Inc., Chicago, USA). A P-value of <0.05 were considered statistically significant.

RESULTS

The cDNA sequence of LjDDT, 962 nucleotides (nts) in length, was deposited in the GenBank Data Library under accession No. MH988689. The sequence contained a large ORF of 357 nts, which encoded a 118 amino acid (aa) polypeptide with a calculated molecular weight (MW) of 12.7 kDa and a theoretical isoelectric point (pI) of 6.81. Sequence analysis revealed that LjDDT had no signal peptide (Figure 1A) and may be secreted through a non-classical mode (Supplementary Figure S1). Multiple alignments revealed that LjDDT had characteristic features of known DDT proteins. LjDDT contained the "CXXC" motif at aa position 54–57 and three conserved active site residues, Pro2, Lys33, and Ile65 (Figure 1A). LjDDT showed a similar structure to that of LjMIF (Figure 1B).
1

Multiple alignments of amino acid sequences of LjDDT with other DDT homologs (A) or LjMIF (B)

Threshold for shading was >60%, with similar residues shaded gray and identical residues shaded black. LjDDT: Japanese sea bass DDT; LcDDT: Large yellow croaker DDT; FhDDT: Mummichog DDT; OmDDT: Rainbow smelt DDT; ElDDT: Northern pike DDT; OlDDT: Japanese ricefish DDT; SsDDT: Atlantic salmon DDT; OmyDDT: Rainbow trout DDT; TrDDT: Tiger puffer DDT; OfDDT: Rock bream DDT; BpDDT: Mudskipper DDT; OnDDT: Nile tilapia DDT; DrDDT: Zebrafish DDT; AmDDT: Mexican tetra DDT; MmDDT: Mouse DDT; LjMIF: Japanese sea bass MIF. GenBank accession Nos. of sequences used are listed in Supplementary Table S1. Active site residues Pro, Lys, and Ile are marked with“*”. “CXXC”motif is denoted with dotted box. Sequence comparison revealed that LjDDT shared the highest nucleotide identity (90.76%) with rock bream DDT. Phylogenetic tree analysis showed that teleost fish DDTs grouped together to form a distinct subcluster closely related to the subcluster of higher vertebrate DDTs; LjDDT was most closely related to the rock bream homolog (Figure 2; Supplementary Figure S2); the DDT and MIF clusters were distantly related (Supplementary Figure S2).
2

Phylogenetic tree of DDT nucleotide using neighbor-joining method (1 000 bootstrap replicates; maximum composite likelihood model) in MEGA v7

Site of Japanese sea bass DDT is marked with“◆”. Values at forks indicate percentage of trees in which this grouping occurred after bootstrapping (1 000 replicates; shown only when >60%). Scale bar shows number of substitutions per base. GenBank accession Nos. of sequences used are listed in Supplementary Table S1.

Analysis of LjDDT mRNA expression in healthy and V. harveyi-infected Japanese sea bass

The mRNA expression levels of LjDDT in the tissues of healthy and V. harveyi-infected Japanese sea bass were investigated by qRT-PCR. In healthy fish, the LjDDT transcript was detected in all tested tissues, including the liver, spleen, trunk kidney, gill, intestine, brain, head kidney, heart, skin, and muscle, with the highest level detected in the liver, followed by the spleen and trunk kidney (Figure 3A). Upon V. harveyi infection, LjDDT transcripts were substantially down-regulated at 12 hpi or later in the liver, at 12 and 24 hpi in the head kidney, and at 6 hpi or later in the spleen (Figure 3B–D). The most significant LjDDT down-regulation was observed in the spleen at 36 hpi (0.31-fold) (Figure 3C).
3

mRNA expression analysis of LjDDT in tissues of healthy (A) and V. harveyi-infected Japanese sea bass (B–D)

A: LjDDT mRNA expression level relative to that of Lj18S rRNA, calculated using 2–ΔCT method. B–D: Tissues were collected at different time points after bacterial infection. LjDDT mRNA expression levels relative to that of Lj18S rRNA were calculated using 2-ΔΔCT method. Data are expressed as mean±SEM of results from four fish. Values denoted by different letters are significantly different when compared by ANOVA (P<0.05).

Preparation of rLjDDT and corresponding antibody

After induction by IPTG, the recombinant Japanese sea bass DDT (rLjDDT) was overexpressed in E. coli BL21 (DE3). The MW of rLjDDT obtained from SDS-PAGE analysis was approximately 15 kDa, similar to the MW estimated from the sequence (12.7 kDa LjDDT plus 2.2 kDa His-tag) (Figure 4A). Western blot analysis revealed that the MW of native LjDDT in the serum and liver of Japanese sea bass was approximately 13 kDa, similar to the MW calculated from the sequence (12.7 kDa) (Figure 4B).
4

Prokaryotic expression and Western blot analysis of LjDDT

A: 12% SDS-PAGE analysis of bacterial lysates and purified rLjDDT. Lane M: protein marker; Lane 1: pET-28a-LjDDT/BL21 before IPTG induction; Lane 2: pET-28a-LjDDT/BL21 after IPTG induction; Lane 3: Purified rLjDDT. B: Western blot analysis of rLjDDT and native LjDDT in liver of Japanese sea bass. Lane 4: pET28a-LjDDT/BL21 before IPTG induction, negative control; Lane 5: Purified rLjDDT; Lane 6: Japanese sea bass serum; Lane 7: Japanese sea bass liver lysates.

Effect of rLjDDT and anti-rLjDDT on survival rate of V. harveyi-infected Japanese sea bass

The 9 d survival rate experiment investigated the effects of rLjDDT and anti-rLjDDT on V. harveyi-infected Japanese sea bass. Compared with the IsoIgG-treated group, fish administered with 10 μg/g or 100 μg/g anti-rLjDDT achieved a survival rate of 20% and 43.3%, respectively, at 9 d post infection (dpi), but only 100 μg/g anti-rLjDDT showed statistical significance (Figure 5). The administration of 100 μg/g rLjDDT accelerated the death of V. harveyi-infected fish, and all fish died at 7 dpi (Figure 5). Fish in the other five groups all died at 9 dpi (Figure 5).
5

Effect of LjDDT on survival rate of V. harveyi-infected Japanese sea bass

Fish were ip-injected with equal volumes of rLjDDT, IsoIgG, or anti-rLjDDT, respectively, 30 min after V. harveyi infection (1×104 CFU/fish) or 1 h before V. harveyi infection (1×104 CFU/fish). Control group received an equal volume of PBS. Fish mortality was monitored daily for 9 d. n=30.

In vitro chemotaxis assay of rLjDDT on different cells

In vitro transwell cell migration assay was conducted to test the chemotactic activity of rLjDDT and rLjMIF on MO/MΦ, lymphocytes, and neutrophils isolated from Japanese sea bass peripheral blood. Results showed that rLjDDT promoted the migration of MO/MФ and lymphocytes in a dose-dependent manner (Figure 6A, B), but had no effect on the migration of neutrophils (Figure 6C). Migration of MO/MФ and lymphocytes was also inhibited by rLjMIF in a dose-dependent manner (Figure 6A, B), but had no effect on the migration of neutrophils (Figure 6C). The administration of rLjDDT combined with equivalent rLjMIF showed no significant effect on cell migration compared with the negative control (Figure 6A–C).
6

In vitro effect of rLjDDT and rLjMIF on migration of MO/MФ (A), lymphocytes (B), and neutrophils (C) at different concentrations (0, 1.0, and 10.0 μg/mL, respectively)

Cells were counted under a light microscope at 400× magnification. Data are expressed as mean±SEM. n=4. Values denoted by different letters are significantly different when compared by ANOVA (P< 0.05).

In vivo chemotaxis assay of rLjDDT on different cells

The numbers of migrated MO/MΦ, lymphocytes, and neutrophils in the abdominal cavity of Japanese sea bass were investigated 24 h after administration of rLjDDT and rLjMIF. rLjDDT administration induced a substantial increase in MO/MΦ (10.0 μg/g) and lymphocyte (1.0 or 10.0 μg/g) numbers in the abdominal cavity of Japanese sea bass compared with the control; no obvious change in neutrophil number was observed (Figure 7A–C). rLjMIF administration had no significant effect on MO/MΦ, lymphocyte, or neutrophil numbers in the abdominal cavity of Japanese sea bass compared with the negative control (Figure 7A–C). Only the administration of 10.0 μg/g rLjDDT+rLjMIF combined induced a substantial increase in MO/MΦ numbers in the abdominal cavity of Japanese sea bass compared with the negative control (Figure 7A–C).
7

In vivo effect of rLjDDT and rLjMIF administration on MO/MФ (A), lymphocyte (B), and neutrophil (C) numbers in abdominal cavity of Japanese sea bass at different concentrations (0, 1.0, and 10.0 μg/g respectively)

Cells were counted under a light microscope at 400× magnification 24 h after administration of rLjDDT and rLjMIF. Data are expressed as mean± SEM. n=4. Values denoted by different letters are significantly different when compared by ANOVA (P<0.05).

In vitro effect of rLjDDT on migration of LPS- or cAMP-stimulated MO/MΦ

MO/MΦ polarization plays an important role in modulating proinflammatory responses in fish (Lu & Chen, 2019). The in vitro effect of rLjDDT on the migration of LPS- or cAMP-stimulated MO/MΦ was also determined. LPS- or cAMP-stimulation induced M1 and M2 polarization of Japanese sea bass MO/MΦ, respectively, with the up-regulation of iNOS (M1) and arginase activity (M2) (Figure 8A, B). rLjDDT promoted the migration of LPS-stimulated MO/MΦ (12.4% cells for 1.0 μg/mL rLjDDT, 15.3% cells for 10.0 μg/mL rLjDDT), whereas the random migration of LPS-stimulated MO/MΦ was 5.9% (Figure 8C). However, rLjDDT had no substantial effect on the migration of cAMP-stimulated MO/MΦ (Figure 8D).
8

Effect of rLjDDT on migration of polarized Japanese sea bass MO/MΦ

LPS and cAMP were used to induce M1 and M2 polarization of MO/MΦ, respectively. Activities of iNOS (A) and arginase (B) were determined. After incubation with rLjDDT for 4 h, migration percentage of LPS- (C) or cAMP- (D) stimulated MO/MΦ was determined. Non-stimulated resting MO/MΦ were used as negative control (NC). Data are expressed as mean±SEM. n=4; Values denoted by different letters are significantly different when compared by ANOVA (P<0.05).

Effects of LjCD74 and LjCXCR4 knockdown on rLjDDT and rLjMIF-induced migration of MO/MΦ

As CD74 and CXCR4 are considered receptors of DDT in mammals (Fagone et al., 2018; Klasen et al., 2014), we determined whether LjCD74 and LjCXCR4 knockdown influenced rLjDDT-induced migration of MO/MΦ. We first used RNAi to knock down the expression of LjCD74 and LjCXCR4 in Japanese sea bass MO/MФ. When MO/MФ were transfected with LjCD74si or LjCXCR4si, the mRNA expression of LjCD74 and LjCXCR4 decreased to 23.38%± 8.05% and 21.79%±4.44%, respectively, of the normal control at 48 h (Figure 9A, B), suggesting that LjCD74 and LjCXCR4 were effectively knocked down by LjCD74si and LjCXCR4si, respectively. The transfection of MsiRNA had no obvious effect on LjCD74 or LjCXCR4 expression (Figure 9A, B). We next used LjCD74si and LjCXCR4si to explore whether LjCD74 and LjCXCR4 mediated the effect of LjDDT on MO/MФ migration. After transfection with MsiRNA, 11.02% and 2.04% of MO/M Ф migrated to the lower chambers containing 10.0 µg/mL rLjDDT and rLjMIF, respectively (Figure 9C). Only 6.13% of MO/MФ migrated to the lower chambers without rLjDDT or rLjMIF (Figure 9C). After knockdown of LjCD74, approximately 6.01% and 4.27% of the MO/MФ migrated to the lower chambers containing 10.0 µg/mL rLjDDT and rLjMIF, respectively, compared to 5.74% in the group treated with 10.0 µg/mL rLjDDT+rLjMIF combined (Figure 9C). After knockdown of LjCXCR4, 12.63% and 2.36% of the MO/MФ migrated to the lower chambers containing 10.0 µg/mL rLjDDT and rLjMIF, respectively, compared to 5.71% in the group treated with 10.0 µg/mL rLjDDT+rLjMIF combined (Figure 9C).
9

Effect of LjCD74 and LjCXCR4 knockdown on rLjDDT and rLjMIF-induced migration of MO/MΦ, respectively

Histogram displays effect of LjCD74 (A) and LjCXCR4 (B) siRNA transfection on knockdown of MO/MΦ LjCD74 and LjCXCR4 mRNA expression by RT-qPCR analysis. C: Migration percentage of Japanese sea bass MO/MФ was examined in a Transwell chamber in presence or absence of 10.0 μg/mL rLjDDT, rLjMIF, or rLjDDT+rLjMIF combined. Each bar represents mean±SEM, n=4. Values denoted by different letters are significantly different when compared by ANOVA (P<0.05).

DISCUSSION

As a second member of the MIF superfamily, DDT is involved in various pathological roles in inflammatory, autoimmune, and chronic respiratory mammalian diseases (Günther et al., 2019; Jankauskas et al., 2019; Sinitski et al., 2019). It is clear that DDT and MIF are pleiotropic cytokines in mammals, which not only share an overlapping spectrum of activities, but also distinct functions (Benedek et al., 2017; Furukawa et al., 2016; Tilstam et al., 2017; Vincent et al., 2018). In the present study, we identified one gene-encoding DDT homolog (LjDDT) in Japanese sea bass. Without determination of complete genomic sequences, we cannot know whether the Japanese sea bass has two or more DDTs. Sequence comparison and phylogenetic tree analysis revealed that LjDDT was highly conserved and most closely related to the rock bream homolog. LjDDT also shared 29.2% aa identity with LjMIF, and their canonical N-terminal proline residues and enzyme activity-related sites were highly conserved. LjDDT also lacked an N-terminal signal peptide or an internal secretory sequence, thus it may be released from cells via a noncanonical protein secretion pathway, like MIF (Merk et al., 2009). The sequence similarity between LjDDT and LjMIF suggests that their biological functions may be highly correlated. Assessment of gene expression profiles should help clarify the functionality of the DDT gene. In mammals, earlier studies revealed that DDT is constitutively expressed in rat and human tissues, with the highest level found in the liver (Nishihira et al., 1998; Zhang et al., 1995). Further studies have found that the expression of DDT is altered under pathological conditions. For instance, both serum protein and mRNA expression levels of DDT are significantly higher in burn patients compared to healthy individuals (Kim et al., 2016); whereas DDT mRNA expression is down-regulated in inflammatory adipose tissue in patients with wound healing disorders (Kim et al., 2017). DDT homologs in fish have also been found in many species, although their expression profiles have been rarely studied (Oh et al., 2013; Shen et al., 2012). In zebrafish, DDT transcripts have been detected in whole embryos throughout embryogenesis (Shen et al., 2012). In rock bream, DDT transcripts have been ubiquitously detected in all tested tissues, with the highest expression found in the liver, followed by blood, heart, and kidneys (Oh et al., 2013). In the present study, LjDDT was found to be constitutively expressed in all tested tissues of healthy Japanese sea bass, with the highest expression in the liver, consistent with previously reported results in other animals (Nishihira et al., 1998; Oh et al., 2013; Zhang et al., 1995). After V. harveyi infection, LjDDT mRNA expression was significantly down-regulated in the three tested immune tissues, i. e., liver, spleen, and head kidney. The expression profile of LjDDT was different to that of LjMIF, as determined in our previous work (Xu et al., 2019). This suggests that LjDDT may be functionally different from LjMIF, which coincides with previously described human results (Kim et al., 2017). However, the highest expression levels of LjDDT and LjMIF were all found in the liver (Xu et al., 2019), indicating that DDT expression is closely associated with the immune response of Japanese sea bass against V. harveyi. Survival rates can intuitively reflect the degree of damage to healthy organisms caused by pathogenic infections (Fernández et al., 2018). In mammals, DDT is associated with host immunity in relation to inflammatory responses and disease severity (Merk et al., 2011; Pohl et al., 2017; Valiño-Rivas et al., 2018). For example, the administration of a specific anti-DDT antibody protects mice from lethal endotoxemia (Merk et al., 2011). In this study, we found that the administration of 10 μg/g and 100 μg/g anti-rLjDDT reduced mortality in V. harveyi-infected fish, but only the 100 μg/g anti-rLjDDT treatment showed statistical significance. On the other hand, the administration of 100 μg/g rLjDDT accelerated death in V. harveyi-infected fish. Our results coincide well with those reported previously in mice (Merk et al., 2011), suggesting that LjDDT plays a role in Japanese sea bass immunity. Immune cell migration is a key component of many pathological processes, such as inflammation and cancer metastasis, which makes it an exciting and crucial field of study (Luster et al., 2005). MIF has a well-known chemokine-like function involving the trafficking and recruitment of macrophages and lymphocytes in vertebrates (Abe et al., 2001; Bernhagen et al., 2007; Jin et al., 2007; Schober et al., 2008; Xu et al., 2019), but there is little information on the chemotactic activity of DDT (Kim et al., 2017; Merk et al., 2011; Pasupuleti et al., 2014). DDT inhibits chemotaxis of human peripheral blood monocytes to monocyte chemoattractant protein-1 (MCP-1) (Merk et al., 2011) and functionally cooperates with MIF in promoting endothelial cell migration in the development of renal carcinoma (Pasupuleti et al., 2014). Injection of LPS combined with MIF can lead to higher peritoneal macrophage accumulation in mouse epididymal fat pads compared with the LPS-group, but with no such effect for LPS combined with DDT (Kim et al., 2017). In this study, we found that rLjDDT induced the migration of MO/ MФ and lymphocytes both in vitro and in vivo. In our previous study, we found that rLjMIF can inhibit the migration of MO/ MФ and lymphocytes (Xu et al., 2019). The opposite effect of rLjDDT and rLjMIF on immune cells suggests that they antagonistically regulate MO/MФ and lymphocyte trafficking. MO/MΦ polarization plays an important role in modulating proinflammatory responses in fish (Lu & Chen, 2019). In teleosts, LPS from gram-negative bacteria can induce M1 polarization and cAMP can induce M2 polarization (Joerink et al., 2006). In this study, we investigated the chemotactic activity of rLjDDT on polarized Japanese sea bass MO/MΦ. We found that rLjDDT exhibited chemotactic activity for LPS-stimulated M1-type MO/MΦ, but not for cAMP-stimulated M2- type MO/MΦ. As M1 macrophages are proinflammatory (Wang et al., 2019), our results suggest that LjDDT may be involved in the proinflammatory responses of Japanese sea bass. The receptor mechanisms by which MIF activates target cells have long been unclear. MIF is known to not only interact with CD74, but also bind to CXCR2 and CXCR4 (Klasen et al., 2014; Presti et al., 2018; Schwartz et al., 2009; Soppert et al., 2018; Weber et al., 2008). MIF participates in the recruitment of many cell types via CXCR4 (Pawig et al., 2015). CD74 can form functional complexes with CXCR4 to mediate MIF-specific signaling (Schwartz et al., 2009). DDT also binds to CD74 with high affinity (Merk et al., 2011), but lacks the essential motif for binding to CXCR2 (Merk et al., 2012). In this study, compared with normal and MsiRNA groups, the knockdown of LjCD74 expression in MO/MΦ significantly decreased the rLjDDT-enhanced migration of MO/MΦ, and relieved the rLjMIF-inhibited migration of MO/MΦ. The knockdown of LjCXCR4 had no significant influence on rLjDDT-enhanced or rLjMIF-inhibited migration of MO/MΦ. The combination treatment of rLjDDT+rLjMIF had no significant effect on the migration of normal, MsiRNA, LjCD74si, or LjCXCR4si-treated MO/MΦ. This suggests that LjDDT and LjMIF have an antagonistic effect on the migration of Japanese sea bass MO/MΦ through the mediation of LjCD74, but not of LjCXCR4. In conclusion, we characterized a DDT gene from Japanese sea bass. Upon V. harveyi infection, the LjDDT expression profiles were significantly altered in immune tissues. Antibody neutralization of LjDDT had protective effects on the survival rate of V. harveyi-infected Japanese sea bass. In vivo and in vitro studies revealed that LjDDT participates in the immune response by mediating the trafficking of lymphocytes and resting and M1-type MO/MΦ. After knocking down the expression of LjCD74, the chemotaxis of rLjDDT on MO/MΦ decreased significantly. Our present work investigated the primary role of LjDDT in Japanese sea bass immune responses. Further studies on the precise chemotactic mechanism of LjDDT and LjMIF release in response to pathogenic infections should provide insight into their immunological functions. Supplementary data to this article can be found online. Click here for additional data file.

COMPETING INTERESTS

The authors declare that they have no competing interests.

AUTHORS' CONTRIBUTIONS

J.C. and M.Y.L. drafted the experiments; F.X. performed the experiments. F. X. and J. C. analyzed the data and wrote the paper. All authors read and approved the final version of the manuscript.
  56 in total

1.  Full-length and a smaller globular fragment of adiponectin have opposite roles in regulating monocyte/macrophage functions in ayu, Plecoglossus altivelis.

Authors:  He Liu; Xin-Jiang Lu; Jiong Chen
Journal:  Fish Shellfish Immunol       Date:  2018-08-18       Impact factor: 4.581

2.  Characterization of MIF family proteins: MIF and DDT from rock bream, Oplegnathus fasciatus.

Authors:  Minyoung Oh; Saranya Revathy Kasthuri; Qiang Wan; S D N K Bathige; Ilson Whang; Bong-Soo Lim; Hyung-Bok Jung; Myung-Joo Oh; Sung-Ju Jung; Sung Yeon Kim; Jehee Lee
Journal:  Fish Shellfish Immunol       Date:  2013-05-18       Impact factor: 4.581

3.  Macrophage Migration Inhibitory Factor-CXCR4 Receptor Interactions: EVIDENCE FOR PARTIAL ALLOSTERIC AGONISM IN COMPARISON WITH CXCL12 CHEMOKINE.

Authors:  Deepa Rajasekaran; Sabine Gröning; Corinna Schmitz; Swen Zierow; Natalie Drucker; Maria Bakou; Kristian Kohl; André Mertens; Hongqi Lue; Christian Weber; Annie Xiao; Gary Luker; Aphrodite Kapurniotu; Elias Lolis; Jürgen Bernhagen
Journal:  J Biol Chem       Date:  2016-05-19       Impact factor: 5.157

4.  Delayed hypersensitivity in vitro: its mediation by cell-free substances formed by lymphoid cell-antigen interaction.

Authors:  J R David
Journal:  Proc Natl Acad Sci U S A       Date:  1966-07       Impact factor: 11.205

5.  Combined Knockdown of D-dopachrome Tautomerase and Migration Inhibitory Factor Inhibits the Proliferation, Migration, and Invasion in Human Cervical Cancer.

Authors:  Qingying Wang; Yingze Wei; Jiawen Zhang
Journal:  Int J Gynecol Cancer       Date:  2017-05       Impact factor: 3.437

6.  Mechanism of a reaction in vitro associated with delayed-type hypersensitivity.

Authors:  B R Bloom; B Bennett
Journal:  Science       Date:  1966-07-01       Impact factor: 47.728

7.  The Golgi-associated protein p115 mediates the secretion of macrophage migration inhibitory factor.

Authors:  Melanie Merk; John Baugh; Swen Zierow; Lin Leng; Utpal Pal; Seung Joon Lee; Antje D Ebert; Yuka Mizue; John O Trent; Robert Mitchell; Walter Nickel; Paula B Kavathas; Jürgen Bernhagen; Richard Bucala
Journal:  J Immunol       Date:  2009-06-01       Impact factor: 5.422

8.  Cooperative regulation of non-small cell lung carcinoma angiogenic potential by macrophage migration inhibitory factor and its homolog, D-dopachrome tautomerase.

Authors:  Arlixer M Coleman; Beatriz E Rendon; Ming Zhao; Ming-Wei Qian; Richard Bucala; Dan Xin; Robert A Mitchell
Journal:  J Immunol       Date:  2008-08-15       Impact factor: 5.422

Review 9.  Insight into the biology of macrophage migration inhibitory factor (MIF) revealed by the cloning of its cell surface receptor.

Authors:  Lin Leng; Richard Bucala
Journal:  Cell Res       Date:  2006-02       Impact factor: 25.617

10.  Soluble CD74 Reroutes MIF/CXCR4/AKT-Mediated Survival of Cardiac Myofibroblasts to Necroptosis.

Authors:  Josefin Soppert; Sandra Kraemer; Christian Beckers; Luisa Averdunk; Julia Möllmann; Bernd Denecke; Andreas Goetzenich; Gernot Marx; Jürgen Bernhagen; Christian Stoppe
Journal:  J Am Heart Assoc       Date:  2018-09-04       Impact factor: 5.501

View more
  1 in total

Review 1.  Application-Oriented Marine Isomerases in Biocatalysis.

Authors:  Antonio Trincone
Journal:  Mar Drugs       Date:  2020-11-21       Impact factor: 5.118

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.