Literature DB >> 31704540

Generation of a genetically modified human embryonic stem cells expressing fluorescence tagged ATOX1.

Meng-Hsuan Wen1, Xihong Xie1, Jian Tu2, Dung-Fang Lee3, Tai-Yen Chen4.   

Abstract

ATOX1 is a copper chaperone involved in intracellular copper homeostasis, cell proliferation, and tumor progression. To investigate the physiologically relevant molecular mechanism of ATOX1 by using imaging-based approaches, we genetically modified ATOX1 in H1 hESCs to express mCherry-ATOX1 fusion protein under endogenous regulatory machinery. The fluorescence engineered hESC clone maintains characteristic stem cell features and can differentiate to all three germ layers, serving as a unique tool to dissect the role of ATOX1 in various cellular processes.
Copyright © 2019 The Author(s). Published by Elsevier B.V. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31704540      PMCID: PMC6939864          DOI: 10.1016/j.scr.2019.101631

Source DB:  PubMed          Journal:  Stem Cell Res        ISSN: 1873-5061            Impact factor:   2.020


Resource utility

We have engineered the ATOX1 exon 2 in a H1 human embryonic stem cell line to express mCherry-ATOX1 fusion proteins. This cell line can differentiate to different germ layers, which is useful for imaging-based studies on molecular mechanisms of ATOX1.

Resource details

ATOX1 is an intracellular copper chaperone, a cell-cycle modulator, and a therapeutic cancer target (Celauro, Mukaj, Fierro-Gonzalez, and Wittung-Stafshede, 2017; Hamza et al., 2001; Matson Dzebo, M., S., S., and E., 2018). ATOX1 deficiency results in perturbed intracellular trafficking of copper transporters and altered cell proliferation during early development. ATOX1 is ubiquitously observed in different cells and tissues. However the detail intracellular molecular behaviors, such as subcellular distribution and interaction dynamics, of ATOX1 in response to environmental cues are still unclear. To dissect the roles of ATOX1 in different cell contexts under endogenous regulatory by using single-molecule super-resolution microscopy in live cell (Chen et al., 2015), here we genetically tagged ATOX1 with fluorescence protein in the H1 stem cell to generate the mCherry-ATOX1 knocked-in (H1_mCh-ATOX1, KI) clone. We genetically modified H1 human embryonic stem cells (hESCs) by CRISPR-Cas9 mediated homologous recombination (Fig. 1A). H1 hESCs were co-transfected with the single-guide RNAs (sgRNAs)-Cas9 containing plasmids together with corresponding recombination donor plasmids. After puromycin selection, the emerged hESC clones were picked and screened for mCherry insertion by Southern blotting (Suppl. Fig. 1) and DNA sequencing. We obtained a heterozygous mCherry-ATOX1 KI clone: One allele carries mCherry in-framed insertion upstream to the ATOX1 start codon, yet the other allele has a 51 bp deletion at −12 to the ATOX1 start codon and no mCherry insertion (Fig. 1B & Suppl. Fig. 2). Nevertheless, the deletion has no overt impacts because the KI clone still grows normally and exhibits characteristic hESC morphology (i.e., densely packed cell clusters with well-defined borders, Fig. 1C). This KI clone is free of mycoplasma contamination tested by PCR-based method (Table 1). Immunofluorescence staining demonstrated expression of pluripotency transcription factors NANOG, OCT3/4, and SOX2 in KI clone (Fig. 1D). We further quantified the transcription of pluripotency genes, ATOX1, and mCherry by qRT-PCR (Fig. 1E). Compared with the parental H1 hESCs, KI cells showed comparable expression of all three pluripotency genes (NANOG, 97 ± 3%; OCT4, 87 ± 6%; and SOX2, 107 ± 2%), but the level of ATOX1 transcript in KI clone was reduced (26 ± 1%). Despite the reduced transcript level, immunoblotting results against ATOX1 showed increased mCherry-ATOX1 protein level in the KI lysate compared to the endogenous ATOX1 in the parental H1 lysates (Fig. 1F), probably due to improved protein stability. The un-tagged ATOX1, expected to be endogenous ATOX1 expressed from mCherry-null allele, was barely detectable in the KI hESC lysate, suggesting that endogenous ATOX1 was effectively knocked out in the mCherry-null allele. G-band karyotype analysis confirmed the normal karyotype of KI hESCs (Fig. 1G). Histological staining of KI hESC-derived teratoma showed characteristics of epithelium (endoderm), cartilage (mesoderm), and melanin (ectoderm), confirming the differentiation capability of KI hESCs to three germ layers (Fig. 1H). The short tandem repeat (STR) profile also confirmed that the KI cell still maintains its identity to the parental H1 hESCs (data available upon request). The characterization of KI hESCs is summarized in Table 1.
Fig. 1.
Table 1

Characterization and validation.

ClassificationTestResultData
MorphologyPhotographyNormal Fig. 1 panel C
PhenotypeQualitative analysis: ImmunocytochemistryPositive staining for pluripotency factors NANOG, OCT3/4, and SOX2 Fig. 1 panel D
Quantitative analysis: RT-qPCRComparable expression levels of NANOG, OCT3/4, and SOX2 compared with H1 Fig. 1 panel E
GenotypeKaryotype (G-banding) and resolution46XY; Resolution 450–500 Fig. 1 panel G
IdentityMicrosatellite PCR (mPCR) ORN/AN/A
STR analysis8 sites tested; all sites match parental H1Data available with authors
Mutation analysis (IF APPLICABLE)SequencingHeterozygous insertionFig. 1 panel B and Supplementary figure 2
Southern BlotTag insertion in one allele, small deletion in the other allele, no apparent off-target effect Supplementary figure 1
Microbiology and virologyMycoplasmaMycoplasma test shows negative Supplementary figure 3
Differentiation potentialTeratoma formationDifferentiation to three germ layers confirmed by H&E staining Fig. 1 panel H
Donor screening (OPTIONAL)HIV 1 + 2 Hepatitis B, Hepatitis CN/AN/A
Genotype additional info (OPTIONAL)Blood group genotypingN/AN/A
HLA tissue typingN/AN/A
In summary, the fluorescence KI hESC clone is pluripotent and possesses normal karyotypes. With fluorescence protein mCherry directly tagged on ATOX1 whose expression is still controlled by endogenous regulatory machinery, KI hESCs enable imaging-based approaches to study the cell-type-specific function of ATOX1.

Materials and methods

Cell culture

H1 hESCs (NIH Registration Number: 043, WiCell, passage 28–30) were maintained in mTeSR™1/Matrigel™ feeder-free system at 37 °C with 5% CO2 until cells reach 80% confluent. Cells were genetically engineered via CRISPR/Cas9 mediated homologous recombination by co-electrotransfecting sgRNA-Cas9 plasmids and homology-direct recombination (HDR) donor plasmid. Transfected cells were plated on puromycin-resistant MEF feeders overnight followed by puromycin selection for four days. Clones were picked and seeded in plates under feeder-free culture system again then passaged for clonal expansion and characterization.

CRISPR plasmid design

We adopted the protocol from Ran et al. (Ran et al., 2013) and designed the sgRNAs using web tool from Benchling. The sgRNAs targeting to the upstream of ATOX1 coding region (Table 2) were cloned into the pSpCas9(BB)–2A-Puro (PX459) V2.0 plasmid (Addgene). A 3 kb genome region covering ATOX1 exon 2 (NC_000005.10, 151,757,164..151760261) were PCR amplified from H1 genome and cloned into pMiniT2 plasmid (NEB) as HDR arm. The mCherry sequence was PCR amplified and assembled into the donor plasmid by seamless cloning (NEB).
Table 2

Reagents details.

Antibodies used for immunocytochemistry/immunoblotting
AntibodyDilutionCompany Cat # and RRID

Pluripotency MarkersGoat anti-NANOG1:500 (ICC)R&D Systems Cat# AF1997 RRID: AB_355,097
Mouse anti-OCT3/41:250 (ICC)Santa Cruz Biotechnology Cat# sc-9081, RRID:AB_2,167,703
Goat anti-SOX21:250 (ICC)Santa Cruz Biotechnology Cat# sc-17,320, RRID:AB_2,286,684
Characterization MarkersRabbit anti-mCherry1:500 (ICC)Abcam Cat# ab167453, RRID:AB_2,571,870
1:1000 (IB)
Rabbit anti-ATOX11:1000 (IB)Abcam Cat# ab154179 RRID:
Mouse anti- β Actin1:2000 (IB)Sigma-Aldrich Cat# A5441, RRID:AB_476,744
Secondary antibodiesDonkey anti-Goat IgG (Alexa Fluor488 conjugate)1:1000 (ICC)Jackson ImmunoResearch Labs Cat# 705–545–003, RRID:AB_2,340,428
Donkey anti-Mouse IgG (Alexa Fluor488 conjugate)1:1000 (ICC)Thermo Fisher Scientific Cat# A-21,202, RRID:AB_141,607
Donkey anti-Rabbit IgG (Alexa Fluor594 conjugate)1:1000 (ICC)Thermo Fisher Scientific Cat# A-21,207, RRID:AB_141,637
Peroxidase-AffiniPure Goat Anti-Mouse IgG1:10,000 (IB)Jackson ImmunoResearch Labs Cat# 115–035–003, RRID:AB_10,015,289
Peroxidase-AffiniPure Goat Anti-Rabbit IgG1:10,000 (IB)Jackson ImmunoResearch Labs Cat# 111–035–045, RRID:AB_2,337,938

Primers
TargetForward/Reverse primer (5′–3′)

CRISPR Plasmid 1 (sgRNA)ATOX1CACCAGCGCCTCTCTGGATTCGGA/ AAACTCCGAATCCAGAGAGGCGCT
CRISPR Plasmid 2 (sgRNA)ATOX1CACCGGGCATGACTGAGGCAGCGG/ AAACCCGCTGCCTCAGTCATGCCC
HDR GenomeATOX1 intron 1–2TTCCTTCAGCTGTTATCTTGTGGTA/ ACTTTTCACTGTACGCTACTTTGTG
Site direct mutagenesisPAM of ATOX1 sgRNA 1GCCGAACCCGTCCTCCGAATC/ TGCGCTTCCGAGAGTGCG
Site direct mutagenesisPAM of ATOX1 sgRNA 2CGCCGCCACATCGCCGCTGCC/ GTGTGGCGGCGGTGTCAGCAGC
Donor Plasmid AssemblyATOX1-mCherryGCATTCCCTAACACAAGCTTGAC/ GACTGAGGCAGCGGCGATGTGG
Donor Plasmid AssemblymCherryGCTGCCTCAGTCATGGTGAGCAAG/ TGGTCCACTGCCCTTGTACAGCTCGTCCATG
Donor Plasmid AssemblymCherry-ATOX1GGCAGTGGACCAATGCCGGTGAGTG/ AGACGCACATGCGGCCGCCTCGAG
Pluripotency Markers (qPCR)NANOGTTTGTGGGCCTGAAGAAAACT/ AGGGCTGTCCTGAATAAGCAG
Pluripotency Markers (qPCR)OCT4AACCTGGAGTTTGTGCCAGGGTTT/ TGAACTTCACCTTCCCTCCAACCA
Pluripotency Markers (qPCR)SOX2AGAAGAGGAGAGAGAAAGAAAGGGAGAGA/ GAGAGAGGCAAACTGGAATCAGGATCAAA
Target mutation analysis (qPCR)ATOX1CATGCCGAAGCACGAGTT/ CTTCAGGGTTGCAAGCAGAG
Target mutation analysis (qPCR)mCherryCCCCGTAATGCAGTGTCGT/ CTCTGCTTGATCTCGCCCTT
House-Keeping Genes (qPCR)GAPDHCCACTCCTCCACCTTTGAC/ ACCCTGTTGCTGTAGCCA
GenotypingATOX1 exon 2GGGCCCTTTCAGCTCAGAAT/ GTGTGACTGCTTTTGCCTGG

PCR, sequencing, and str

Genomic DNA was isolated from ~2 ×106 cells by using MasterPure™ Complete DNA and RNA Purification Kit (Epicentre). PCR was performed using primers (Table 2) and AccuStart™ II GelTrack PCR SuperMix (QuantaBio). PCR protocol: 95 °C for 3 min; 25 cycles of 95 °C for 30 s, 60 °C for 10 s, and 68 °C for 3.5 min; and 72 °C for 5 min. Sanger sequencing was performed by Eton Bioscience. STR DNA fingerprinting was done by the CCSG-funded Characterized Cell Line Core Facility (The University of Texas M.D. Anderson Cancer Center). The STRs at 8 loci were assessed.

qRT-PCR

Total RNA was isolated the same way as DNA. Two microgram of total RNA were converted to cDNA by using All-in-One RT MasterMix (Applied Biological Materials Inc). qPCR was performed using primers (Table 2) following the protocol of iQ SYBR Green Supermix (BioRad). Results were calculated using the ΔΔCT method and normalized to GAPDH expression.

Immunoblotting and immunofluorescence staining

An equal amount of total protein from cell lysate was resolved in a SDS-PAGE for immunoblotting analysis. For immunofluorescence staining, cells were fixed with 4% paraformaldehyde in PBS for 15 min, blocked and incubated with primary antibodies (Table 2) overnight at 4 °C, incubated with secondary antibodies, and counterstained with DAPI.

Karyotyping

The cultures were harvested and G-banded using standard protocols. Clonal chromosomal changes identified by G-banding were described according to an International System for Human Cytogenetic Nomenclature ISCN (McGowan-Jordan & An, n.d.). Twenty metaphase chromosome spreads at 400 band resolution were analyzed.

Teratoma assay

Cells grown under log-phase were dissociated and resuspended in 50% Matrigel/DMEM-F12. Immunodeficient NOD SCID mice (Charles River Laboratories) were injected subcutaneously with 2 × 107 cells in each flank and observed for palpable teratoma formation. After six weeks, teratomas were excised then fixed in 10% formalin (Sigma). Histology was analyzed using H&E staining.

Mycoplasma testing

Mycoplasma detection was performed using PCR Mycoplasma Detection Kit (Applied Biological Materials Inc.) according to the instructions from manufacturer
Resource Table
Unique stem cell lines identifierWAe001-A-29
Alternative names of stem cell linesH1_mCh-ATOX1 (KI) / UHMCe002-A-29
InstitutionUniversity of Houston, Houston, TX, United States
Contact information of distributorTai-Yen Chen (tchen37@central.uh.edu)
Type of cell linesESC
OriginHuman embryonic stem cell line
Additional origin infoAge: N/ASex: Male Ethnicity if known: N/A
Cell SourceH1 hESCs
ClonalityClonal
Method of reprogrammingN/A
Gene modificationYes
Type of modificationTransgene expression (fluorescence protein)
Associated diseaseN/A
Gene/locus5q33.1; ATOX1 exon 2
Method of modificationCRISPR
Name of transgene or resistancemCherry
Inducible/constitutive systemN/A
Date archived/stock date5/18/2019
Cell line repository/bank https://hpscreg.eu/cell-line/WAe001-A-29
Ethical approvalCell lines were used according to institutional guidelines. UTHealth approval number: SCRO–16–01
  5 in total

1.  Copper chaperone ATOX1 regulates pluripotency factor OCT4 in preimplantation mouse embryos.

Authors:  Emanuele Celauro; Amisa Mukaj; Juan Carlos Fierro-González; Pernilla Wittung-Stafshede
Journal:  Biochem Biophys Res Commun       Date:  2017-07-12       Impact factor: 3.575

2.  The metallochaperone Atox1 plays a critical role in perinatal copper homeostasis.

Authors:  I Hamza; A Faisst; J Prohaska; J Chen; P Gruss; J D Gitlin
Journal:  Proc Natl Acad Sci U S A       Date:  2001-06-05       Impact factor: 11.205

3.  Genome engineering using the CRISPR-Cas9 system.

Authors:  F Ann Ran; Patrick D Hsu; Jason Wright; Vineeta Agarwala; David A Scott; Feng Zhang
Journal:  Nat Protoc       Date:  2013-10-24       Impact factor: 13.491

4.  Concentration- and chromosome-organization-dependent regulator unbinding from DNA for transcription regulation in living cells.

Authors:  Tai-Yen Chen; Ace George Santiago; Won Jung; Łukasz Krzemiński; Feng Yang; Danya J Martell; John D Helmann; Peng Chen
Journal:  Nat Commun       Date:  2015-07-06       Impact factor: 14.919

5.  Copper Chaperone Atox1 Interacts with Cell Cycle Proteins.

Authors:  Maria Matson Dzebo; Stéphanie Blockhuys; Sebastian Valenzuela; Emanuele Celauro; Elin K Esbjörner; Pernilla Wittung-Stafshede
Journal:  Comput Struct Biotechnol J       Date:  2018-10-31       Impact factor: 7.271

  5 in total
  2 in total

Review 1.  Crossroads between membrane trafficking machinery and copper homeostasis in the nerve system.

Authors:  Meng-Hsuan Wen; Xihong Xie; Pei-San Huang; Karen Yang; Tai-Yen Chen
Journal:  Open Biol       Date:  2021-12-01       Impact factor: 6.411

2.  Generation of a homozygous knock-in human embryonic stem cell line expressing mEos4b-tagged CTR1.

Authors:  Yi-Hung Chen; Pei-San Huang; Meng-Hsuan Wen; Manhua Pan; Dung-Fang Lee; Tai-Yen Chen
Journal:  Stem Cell Res       Date:  2022-06-14       Impact factor: 1.587

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.