Literature DB >> 31701075

Induction of Lysosome-associated Protein Transmembrane 4 Beta via Sulfatase 2 Enhances Autophagic Flux in Liver Cancer Cells.

Yeonjung Ha1,2, Yong Fang1, Paola A Romecin Duran3, Ezequiel J Tolosa3, Catherine D Moser1, Martin E Fernandez-Zapico3, Lewis R Roberts1.   

Abstract

Autophagy has been shown to be a key cellular event controlling tumor growth in different neoplasms including hepatocellular carcinoma (HCC). Although this biological role of autophagy has been clearly established, the mechanism underlying its regulation remains elusive. Here, we demonstrate a role of sulfatase 2 (SULF2), a 6-O-endosulfatase modulating various growth factors and cytokine-related signaling pathways controlling tumor cell proliferation and survival, in the regulation of autophagy in HCC cells. SULF2 increased autophagosome formation, shown by increased LC3B-II protein and green fluorescent protein-LC3 puncta. Increased fusion between autophagosomes and lysosomes/lysosomal enzymes, higher expression of lysosomal membrane protein, and an increase in autolysosomes were also shown by western blot, immunofluorescence, and electron microscopy of SULF2-expressing cells, indicating enhanced autophagic flux. In contrast, RNA-interference silencing of SULF2 in Huh7 cells induced lysosomal membrane permeabilization with diffuse cytosolic staining of cathepsin D and punctate staining of galectin-3. Analysis of the mechanism showed that inhibition of lysosome-associated protein transmembrane 4 beta (LAPTM4B), a gene induced by SULF2, resulted in decreased autophagosome formation, decreased fusion between autophagosomes and lysosomes, and increased lysosomal membrane permeabilization. Interestingly, down-regulation of LAPTM4B also phenocopies the knockdown of SULF2, significantly reducing cell viability and colony formation.
Conclusion: Our results demonstrate a role for SULF2 in the regulation of autophagic flux that is mediated through LAPTM4B induction in HCC cells, and provide a foundation for future translational efforts targeting autophagy in liver malignancies.
© 2019 The Authors. Hepatology Communications published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

Entities:  

Year:  2019        PMID: 31701075      PMCID: PMC6824075          DOI: 10.1002/hep4.1429

Source DB:  PubMed          Journal:  Hepatol Commun        ISSN: 2471-254X


dimethyl sulfoxide green fluorescent protein hepatocellular carcinoma human embryonic kidney lysosome‐associated membrane protein 1 lysosome‐associated protein transmembrane lysosomal membrane permeabilization 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide poly(adenosine diphosphate ribose) polymerase phosphate‐buffered saline polymerase chain reaction short hairpin RNA small interfering RNA sulfatase 2 Autophagy plays a key role in maintaining cellular homeostasis in all living cells by removing and recycling damaged intracellular components.1, 2 The perturbation of autophagic activity is known to be involved in the pathogenesis of multiple diseases, including neoplastic disease.1, 3, 4, 5, 6 When normal cells are not able to clear cellular debris, dysfunctional organelles, and misfolded proteins, chronic tissue damage that can lead to malignant transformation occurs. At the early stages of carcinogenesis, transformed cells can be sensed and eliminated by autophagy. At later disease stages when intracellular components such as nutrition and oxygen are relatively deficient, activation of autophagy helps cancer cells adapt and survive.1, 2, 7 Thus, increasing our understanding of the mechanism regulating the activation of autophagy will be key for the development of new therapeutic approaches targeting this cellular event in different tumors. Here, we provide evidence of a mechanism involving sulfatase 2 (SULF2) expression in the regulation of autophagy in hepatocellular carcinoma (HCC) cells. SULF2 is an enzyme that modulates signaling pathways by selectively removing 6‐O‐sulfate groups from the heparan sulfate chains of heparan sulfate proteoglycans (HSPGs), which serve as co‐receptors or sequestration sites for numerous growth factor and cytokine signaling ligands.8 Our data unveiled a pathway driven by SULF2 that controls autophagy in HCC cells by inducing the expression of lysosome‐associated protein transmembrane 4 beta (LAPTM4B). We report in this study that LAPTM4B is an essential effector for this role of SULF2 in the regulation of autophagy in HCC cells.

Results

SULF2 Induces Autophagy in HCC Cells

Overexpression of SULF2 promotes autophagy in HCC cells (Fig. 1). Both Huh7 scrambled short hairpin RNA (shRNA) transfected cells and Hep3B SULF2 plasmid transfected cells, which express high levels of SULF2 protein, showed higher LC3B‐II and lower p62 on western blot (Fig. 1A), demonstrating an increased autophagy in cells overexpressing SULF2. When treated with bafilomycin‐A1, LC3B‐II was further increased. Bafilomycin‐A1 blocks fusion between autophagosomes and lysosomes in the late phase of autophagy by inhibiting lysosomal vacuolar‐type H+‐adenosine triphosphatase. This result suggests that increased LC3B‐II in SULF2‐expressing cells is not due to the blocking of autophagic flux, but occurs due to increased autophagosome formation.
Figure 1

SULF2 induces autophagic flux. (A) Western blot analysis shows protein‐expression changes of LC3B conversion and p62 levels according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. (B) Confocal microscopic images shows GFP‐LC3 puncta according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. (C) Tandem RFP‐GFP‐LC3B assay shows autophagosomes (RFP+/GFP+, yellow puncta) and autolysosomes (RFP+/GFP‐, red puncta) according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. Yellow bar indicates autophagosomes and red bar indicates autolysosomes. (D) Ultrastructural evidence of autophagy according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. Yellow arrows indicate autophagosomes and red arrows indicate autolysosomes (scale bars: 500 nm). Bafilomycin‐A1 (100 nM) was treated to inhibit the fusion between autophagosomes and lysosomes. Quantification was performed by counting a total of 50 cells in 10 random fields (5 cells/field) and presented as bar graphs (mean ± SEM). Abbreviations: GFP, green fluorescent protein; RFP, red fluorescent protein; SEM; standard error of the mean; SULF2, sulfatase 2.

SULF2 induces autophagic flux. (A) Western blot analysis shows protein‐expression changes of LC3B conversion and p62 levels according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. (B) Confocal microscopic images shows GFP‐LC3 puncta according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. (C) Tandem RFP‐GFP‐LC3B assay shows autophagosomes (RFP+/GFP+, yellow puncta) and autolysosomes (RFP+/GFP‐, red puncta) according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. Yellow bar indicates autophagosomes and red bar indicates autolysosomes. (D) Ultrastructural evidence of autophagy according to SULF2 status in Huh7 and Hep3B cells in the absence or presence of bafilomycin‐A1. Yellow arrows indicate autophagosomes and red arrows indicate autolysosomes (scale bars: 500 nm). Bafilomycin‐A1 (100 nM) was treated to inhibit the fusion between autophagosomes and lysosomes. Quantification was performed by counting a total of 50 cells in 10 random fields (5 cells/field) and presented as bar graphs (mean ± SEM). Abbreviations: GFP, green fluorescent protein; RFP, red fluorescent protein; SEM; standard error of the mean; SULF2, sulfatase 2. Confocal microscopy of HCC cells stably expressing green fluorescent protein (GFP)‐LC3 also confirmed increased autophagosome formation in SULF2‐expressing cells (Fig. 1B). The proportion of cells showing LC3 puncta (> 30 puncta/cell) was significantly higher in SULF2‐expressing cells, and the proportion further increased after bafilomycin‐A1 treatment. To demonstrate further whether the increased autophagosomes in SULF2‐expressing cells complete the process of autophagic flux through fusion with lysosomes, the red fluorescent protein (RFP)‐GFP‐LC3B assay was performed. Both autophagosome (yellow puncta) and autolysosomes (red puncta) were increased in SULF2‐expressing cells (Fig. 1C). Finally, electron microscopic studies revealed that autophagosomes and autolysosomes are both increased in SULF2‐overexpressing cells (Fig. 1D). These results indicate that the increase in autophagosomes in cells overexpressing SULF2 undergo complete autophagic flux.

SULF2 Depletion Is Associated With Disrupted Lysosomal Function

Because the increase in autolysosomes was significantly higher in SULF2‐expressing cells, we investigated the functional underpinnings of this observation by assessing the levels of proteins associated with lysosomes. The expression of lysosome‐associated membrane protein 1 (LAMP1), was decreased in whole cell lysates of cells with silenced or low SULF2 expression. No differences were observed in the levels of the uncleaved apoptotic initiator caspases, caspase‐8 and caspase‐9, or poly(adenosine diphosphate ribose) polymerase (PARP). Further, the cleaved forms of the caspases and PARP were not seen in the HCC cell lines by western blot (Fig. 2). Expression of Bak and Bax proteins also did not significantly differ between SULF2‐negative and SULF2‐positive HCC cells. Bcl‐2 proteins were not expressed in either the Huh7 or Hep3B cells. Significant differences were seen in the levels of the lysosomal enzymes cathepsin D and cathepsin B, which were increased in silenced or low SULF2‐expressing cells (Fig. 2).
Figure 2

SULF2 is associated with expression of lysosome‐related proteins. Western blot analyses show protein expressions of LAMP1, cathepsin D, and cathepsin B (left column) according to SULF2 status in Huh7 and Hep3B cells. Common markers for apoptosis (right column) are also assessed. Abbreviations: Cas‐8, caspase‐8; Cas‐9, caspase‐9; CTSB, cathepsin B; CTSD, cathepsin D; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; LAMP1, lysosome‐associated membrane protein 1; SULF2, sulfatase 2.

SULF2 is associated with expression of lysosome‐related proteins. Western blot analyses show protein expressions of LAMP1, cathepsin D, and cathepsin B (left column) according to SULF2 status in Huh7 and Hep3B cells. Common markers for apoptosis (right column) are also assessed. Abbreviations: Cas‐8, caspase‐8; Cas‐9, caspase‐9; CTSB, cathepsin B; CTSD, cathepsin D; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; LAMP1, lysosome‐associated membrane protein 1; SULF2, sulfatase 2. A potential explanation for the lower levels of LAMP1 and increase in cathepsin D and cathepsin B in cells with silenced or low SULF2 expression is that suppression of SULF2 is associated with disruption of lysosomal integrity and increased release of lysosomal enzymes (i.e., lysosomal membrane permeabilization [LMP]). To confirm this hypothesis, we performed immunofluorescence analysis. In SULF2‐expressing cells, the colocalization between autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green) was significantly higher than in SULF2‐silenced or negative cells (Fig. 3A). Similarly, when cells were stained for autophagosomes (anti‐LC3B, red) and lysosomal enzymes (anti‐cathepsin D, green), significantly higher colocalization between the two proteins was again observed in SULF2‐expressing cells (Fig. 3B).
Figure 3

SULF2 is associated with increased fusion between autophagosomes and lysosomes/lysosomal enzymes. (A) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in Huh7 and Hep3B cells. (B) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomal enzyme (anti‐cathepsin D, green) according to SULF2 status in Huh7 and Hep3B cells. The correlation coefficients of colocalization between autophagosomes and lysosomes/lysosomal enzymes of 150 cells (50 cells × 3 independent experiment) are presented as dot plots (mean ± SEM). Abbreviations: LAMP1, lysosome‐associated membrane protein 1; SEM, standard error of the mean; SULF2, sulfatase 2.

SULF2 is associated with increased fusion between autophagosomes and lysosomes/lysosomal enzymes. (A) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in Huh7 and Hep3B cells. (B) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomal enzyme (anti‐cathepsin D, green) according to SULF2 status in Huh7 and Hep3B cells. The correlation coefficients of colocalization between autophagosomes and lysosomes/lysosomal enzymes of 150 cells (50 cells × 3 independent experiment) are presented as dot plots (mean ± SEM). Abbreviations: LAMP1, lysosome‐associated membrane protein 1; SEM, standard error of the mean; SULF2, sulfatase 2. Next, the cells were labeled with anti‐cathepsin D and anti‐LAMP1 antibody to demonstrate the presence of LMP. In SULF2‐expressing cells, more colocalization between cathepsin D and LAMP1 was observed (Fig. 4A). On the other hand, SULF2‐silenced Huh7 cells showed diffuse cytosolic staining of cathepsin D and irregular LAMP1 staining, a characteristic finding of LMP (Fig. 4A, lower panel in Huh7). To verify this finding, we additionally performed a galectin‐3 puncta formation assay. When the lysosomes are damaged, galectin‐3 translocates from the cytosol to the disrupted lysosomes, which induces a change in its staining pattern from diffuse to punctate form. SULF2‐positive Huh7 cells showed diffuse cytosolic galectin‐3 staining (Fig. 4B, upper panel in Huh7). In contrast, increased colocalization between punctate galectin‐3 and LAMP1 was identified in the SULF2‐silenced Huh7 cells, again suggesting LMP (Fig. 4B, lower panel in Huh7).
Figure 4

SULF2 inhibition is associated with LMP. (A) Merged immunofluorescence images show lysosomal enzyme (anti‐cathepsin D, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in the HCC cells. Huh7 cells transfected with scrambled shRNA show more colocalization (upper panel). Huh7 cells transfected with SULF2 shRNA show diffuse cytosolic staining of cathepsin D (lower panel). Control Hep3B cells show less colocalization (upper panel). Hep3B cells transfected with SULF2 plasmid show more colocalization (lower panel). (B) Merged immunofluorescence images show galectin‐3 (anti‐galectin‐3, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in the HCC cells. Huh7 cells transfected with scrambled shRNA show diffuse cytosolic staining for galectin‐3 (upper panel). Huh7 cells transfected with SULF2 shRNA show punctate staining for galectin‐3 colocalized with LAMP1 (lower panel). Control Hep3B cells and Hep3B cells transfected with SULF2 plasmid show diffuse cytosolic staining for galectin‐3. The Huh7 cells showing diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 were counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as a bar graph (mean ± SEM). Abbreviation: CTSD, cathepsin D.

SULF2 inhibition is associated with LMP. (A) Merged immunofluorescence images show lysosomal enzyme (anti‐cathepsin D, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in the HCC cells. Huh7 cells transfected with scrambled shRNA show more colocalization (upper panel). Huh7 cells transfected with SULF2 shRNA show diffuse cytosolic staining of cathepsin D (lower panel). Control Hep3B cells show less colocalization (upper panel). Hep3B cells transfected with SULF2 plasmid show more colocalization (lower panel). (B) Merged immunofluorescence images show galectin‐3 (anti‐galectin‐3, red) and lysosomes (anti‐LAMP1, green) according to SULF2 status in the HCC cells. Huh7 cells transfected with scrambled shRNA show diffuse cytosolic staining for galectin‐3 (upper panel). Huh7 cells transfected with SULF2 shRNA show punctate staining for galectin‐3 colocalized with LAMP1 (lower panel). Control Hep3B cells and Hep3B cells transfected with SULF2 plasmid show diffuse cytosolic staining for galectin‐3. The Huh7 cells showing diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 were counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as a bar graph (mean ± SEM). Abbreviation: CTSD, cathepsin D. In Hep3B cells transfected with SULF2 plasmid, a significantly higher rate of colocalization was also observed between cathepsin D and LAMP1 (Fig. 4A, lower panel in Hep3B). However, in control vector–transfected Hep3B cells, LMP was not evident (Fig. 4A, upper panel in Hep3B). When Hep3B cells were stained for galectin‐3 and LAMP1, similar findings were observed. Although SULF2‐overexpressed Hep3B cells showed more staining for lysosomes (Fig. 4B, lower panel in Hep3B), both SULF2‐negative and SULF2‐positive Hep3B cells only showed diffuse cytosolic staining for galectin‐3, indicating no significant lysosomal damage in these cells (Fig. 4B). Consistent with these western blot and immunofluorescence findings, cathepsin D and cathepsin B activity were significantly higher in the whole cell lysates of HCC cells with low SULF2 levels (Fig. 5). Therefore, depletion of SULF2 substantially disrupts lysosomal function.
Figure 5

SULF2 is associated with cathepsin D (A) and cathepsin B (B) activity. Abbreviations: CTSB, cathepsin B; CTSD, cathepsin D; SULF2, sulfatase 2.

SULF2 is associated with cathepsin D (A) and cathepsin B (B) activity. Abbreviations: CTSB, cathepsin B; CTSD, cathepsin D; SULF2, sulfatase 2.

LAPTM4B Mediates SULF2‐Associated Autophagy

Next, we sought to identify interacting molecules mediating SULF2‐induced autophagy. Previously, we reported HCC‐associated genes that are also correlated with SULF2 expression.9 Lysosome‐associated protein transmembrane 5 (LAPTM5) was positively correlated with SULF2 expression in our previous study (r = 0.42). Although its function is not fully known, LAPTM4B also belongs to the LAPTM family and shares several characteristics with LAPTM5.10 In addition, LAPTM4B is known to be associated with poor prognosis in HCC, whereas LAPTM5 is primarily expressed and functional in bone marrow and blood cells. Therefore, we assessed the expression of both LAPTM5 and LAPTM4B in HCC cells. Quantitative real‐time polymerase chain reaction (PCR) analysis showed that both LAPTM5 and LAPTM4B are positively associated with SULF2 expression in HCC cells (Fig. 6A). We focused our subsequent experiments on LAPTM4B and identified that LAPTM4B protein levels are also increased in SULF2‐expressing HCC cells (Fig. 6B).
Figure 6

SULF2 is positively correlated with LAPTM4B expression. (A) Quantitative real‐time PCR analysis shows mRNA expression of LAPTM4B and LAPTM5 according to SULF2 status in Huh7 and Hep3B cells. 7C represents Huh7 cells transfected with scrambled shRNA and 7E represents Huh7 cells transfected with SULF2 shRNA. 3C represents Hep3B cells transfected with control plasmid and 3E represents Hep3B cells transfected with SULF2 plasmid. (B) Western blot analysis shows protein expression of LAPTM4B according to SULF2 status in Huh7 and Hep3B cells. Abbreviations: LAPTM4B, lysosome‐associated protein transmembrane 4 beta; LAPTM5, lysosome‐associated protein transmembrane 5; PCR, polymerase chain reaction; SULF2, sulfatase 2.

SULF2 is positively correlated with LAPTM4B expression. (A) Quantitative real‐time PCR analysis shows mRNA expression of LAPTM4B and LAPTM5 according to SULF2 status in Huh7 and Hep3B cells. 7C represents Huh7 cells transfected with scrambled shRNA and 7E represents Huh7 cells transfected with SULF2 shRNA. 3C represents Hep3B cells transfected with control plasmid and 3E represents Hep3B cells transfected with SULF2 plasmid. (B) Western blot analysis shows protein expression of LAPTM4B according to SULF2 status in Huh7 and Hep3B cells. Abbreviations: LAPTM4B, lysosome‐associated protein transmembrane 4 beta; LAPTM5, lysosome‐associated protein transmembrane 5; PCR, polymerase chain reaction; SULF2, sulfatase 2. To determine the impact of LAPTM4B on autophagy, SULF2‐expressing cells were treated with small interfering RNA (siRNA) targeting LAPTB4B. Forced depletion of LAPTM4B resulted in decreased autophagy, as evidenced by low LC3B‐II expression on western blot (Fig. 7A). In contrast, similar to the result seen with SULF2 silencing, cathepsin D was increased and LAMP1 was decreased following LAPTM4B siRNA treatment, suggesting that both SULF2 silencing and LAPTM4B depletion induce LMP. SULF2 protein levels did not change after forced depletion of LAPTM4B; thus, SULF2 appears to be upstream of LAPTM4B in this signaling axis.
Figure 7

LAPTM4B inhibition reverses the effect of SULF2‐induced changes in autophagy. (A) Western blot analysis shows decreased LAMP1 and increased cathepsin D in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells that are depleted of LAPTM4B. (B) Confocal microscopic images show GFP‐LC3 puncta according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. (C) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. The LC3 puncta‐positive cells are counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as bar graphs (mean ± SEM). The correlation coefficients of colocalization between autophagosomes and lysosomes of 150 cells (50 cells × 3 independent experiment) are presented as dot plots (mean ± SEM). Abbreviations: GFP, green fluorescent protein; LAMP1, lysosome‐associated membrane protein 1; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; SEM, standard error of the mean; SULF2, sulfatase 2.

LAPTM4B inhibition reverses the effect of SULF2‐induced changes in autophagy. (A) Western blot analysis shows decreased LAMP1 and increased cathepsin D in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells that are depleted of LAPTM4B. (B) Confocal microscopic images show GFP‐LC3 puncta according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. (C) Merged immunofluorescence images show autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. The LC3 puncta‐positive cells are counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as bar graphs (mean ± SEM). The correlation coefficients of colocalization between autophagosomes and lysosomes of 150 cells (50 cells × 3 independent experiment) are presented as dot plots (mean ± SEM). Abbreviations: GFP, green fluorescent protein; LAMP1, lysosome‐associated membrane protein 1; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; SEM, standard error of the mean; SULF2, sulfatase 2. Next, to demonstrate the effect of LAPTM4B on autophagosome formation, SULF2‐expressing cells that were also stably transfected with GFP‐LC3 were treated with LAPTM4B siRNA. Compared with control, LAPTM4B siRNA treatment significantly reduced autophagosome formation, resulting in fewer cells with positive GFP‐LC3 puncta (Fig. 7B). To investigate whether LAPTM4B mediates SULF2‐dependent autophagic flux, including fusion between autophagosomes and lysosomes, SULF2‐expressing cells were treated with scrambled versus LAPTM4B siRNA and stained for autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green). SULF2‐expressing cells treated with scrambled siRNA showed robust colocalization between autophagosomes (anti‐LC3B, red) and lysosomes (anti‐LAMP1, green), and this high degree of colocalization decreased significantly after LAPTM4B siRNA treatment (Fig. 7C). Finally, cells were labeled with markers for LMP. SULF2‐expressing control cells showed more colocalization between the lysosomal enzyme cathepsin D (anti‐cathepsin D, red) and lysosomes (anti‐LAMP1, green) (Fig. 8A, left column). By contrast, LAPTM4B knockdown decreased colocalization between the two markers; instead, cells showing diffuse cytosolic cathepsin D and irregular LAMP1 staining were significantly increased (Fig. 8A, right column). The galectin‐3 puncta formation assay showed consistent results; SULF2‐expressing cells treated with LAPTM4B siRNA showed significantly more galectin‐3 puncta, suggesting LMP (Fig. 8B).
Figure 8

LAPTM4B depletion induces LMP. (A) Merged immunofluorescence images show lysosomal enzyme (anti‐cathepsin D, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. (B) Merged immunofluorescence images show galectin‐3 (anti‐galectin‐3, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. The cells showing diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 were counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as a bar graph (mean ± SEM). Abbreviations: CTSD, cathepsin D; LAMP1, lysosome‐associated membrane protein 1; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; LMP, lysosomal membrane permeabilization; SEM, standard error of the mean; SULF2, sulfatase 2.

LAPTM4B depletion induces LMP. (A) Merged immunofluorescence images show lysosomal enzyme (anti‐cathepsin D, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. (B) Merged immunofluorescence images show galectin‐3 (anti‐galectin‐3, red) and lysosomes (anti‐LAMP1, green) according to LAPTM4B status in SULF2‐positive Huh7 cells and SULF2‐transfected Hep3B cells. The cells showing diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 were counted by examining a total of 50 cells in 10 random fields (5 cells/field) and presented as a bar graph (mean ± SEM). Abbreviations: CTSD, cathepsin D; LAMP1, lysosome‐associated membrane protein 1; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; LMP, lysosomal membrane permeabilization; SEM, standard error of the mean; SULF2, sulfatase 2. We also attempted to characterize the distribution and colocalization of LAPTM4B protein by immunofluorescence. The anti‐LAPTM4B antibody that we used for identifying protein expression was only usable for western blot. Another antibody that we tried was reportedly designed for both western blot and immunofluorescence. However, unfortunately, in initial western blot experiments, the LAPTM4B protein was not identified in the region corresponding to the predicted molecular weight of LAPTM4B protein in either HCC cells or human embryonic kidney (HEK) 293 cells, which were used as a positive control. Consequently, we were unable to reliably assess the localization of LAPTM4B by immunofluorescence.

Inhibition of the SULF2‐LAPTM4B Axis Suppresses Growth of SULF2‐Expressing HCC Cells

Next, to assess the effects of the SULF2LAPTM4B axis on HCC cell growth, SULF2‐expressing Hep3B cells were subjected to MTT (3‐[4,5‐dimethylthiazol‐2‐yl]‐2,5‐diphenyltetrazolium bromide) analysis after treatment with the scrambled siRNA, LAPTM4B siRNA, SULF2 siRNA, or both LAPTM4B and SULF2 siRNAs for 48 hours. Compared with the control, the percentage of viable cells was significantly lower in LAPTM4B siRNA‐treated cells (81.9% ± 7.1%; P < 0.001) and SULF2 siRNA‐treated cells (71.5% ± 6.1%; P < 0.001). When cells were treated simultaneously with both LAPTM4B and SULF2 siRNA, the cell viability was decreased further (61.2% ± 10.7%; Fig. 9A).
Figure 9

LAPTM4B and SULF2 depletion inhibits proliferation and colony formation in HCC cells. MTT assay shows decreased viability after 48 hours (A) and cell transformation assay shows decreased colony formation after 7 days (B) in SULF2‐transfected Hep3B cells treated with scrambled siRNA, LAPTM4B siRNA, SULF2 siRNA, and combined LAPTM4B and SULF2 siRNA. Values for cell viability (percentage of control) and colony formation (absorbance at 570 nm) are presented as a bar graph (mean ± SEM). Abbreviations: LAPTM4B, lysosome‐associated protein transmembrane 4 beta; MTT, 3‐(4,5‐demerthylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; SEM, standard error of the mean; siRNA; small interfering RNA; SULF2, sulfatase 2.

LAPTM4B and SULF2 depletion inhibits proliferation and colony formation in HCC cells. MTT assay shows decreased viability after 48 hours (A) and cell transformation assay shows decreased colony formation after 7 days (B) in SULF2‐transfected Hep3B cells treated with scrambled siRNA, LAPTM4B siRNA, SULF2 siRNA, and combined LAPTM4B and SULF2 siRNA. Values for cell viability (percentage of control) and colony formation (absorbance at 570 nm) are presented as a bar graph (mean ± SEM). Abbreviations: LAPTM4B, lysosome‐associated protein transmembrane 4 beta; MTT, 3‐(4,5‐demerthylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; SEM, standard error of the mean; siRNA; small interfering RNA; SULF2, sulfatase 2. In addition, we tested the effect of suppression of LAPTM4B, SULF2, or both LAPTM4B and SULF2 on the ability of the SULF2‐overexpressing Hep3B cell line to grow in soft agar. Temporary knockdown of these genes with siRNA markedly inhibited anchorage‐independent growth as compared with negative control (Fig. 9B). In particular, combined LAPTM4B and SULF2 siRNA treatment led to the largest decrease in colony formation compared with the LAPTM4B siRNA–only or SULF2 siRNA–only treated group. Taken together, our results suggest that activation of the SULF2LAPTM4B axis enhances the complete autophagic process in HCC cells, which leads to the progression of HCC. Perturbing autophagic flux by inhibition of the SULF‐LAPTM4B axis resulted in LMP as well as in decreased cell viability and colony formation (Fig. 10).
Figure 10

Working model for the SULF2‐LAPTM4B‐dependent autophagic pathway in HCC cells. Abbreviations: HCC, hepatocellular carcinoma; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; SULF2, sulfatase 2.

Working model for the SULF2LAPTM4B‐dependent autophagic pathway in HCC cells. Abbreviations: HCC, hepatocellular carcinoma; LAPTM4B, lysosome‐associated protein transmembrane 4 beta; SULF2, sulfatase 2.

Discussion

Autophagy is a fundamental process that is needed for all living cells, including cancer cells, to survive.1, 2, 3 Autophagy helps to maintain an optimal cellular environment by degrading and removing unnecessary or dysfunctional intracellular components. If this machinery does not function in a synchronized manner, abnormal cells appear, accumulate, and finally dominate the environment, leading to development of diseases such as cancer.1, 2 Various molecular pathways are involved in autophagy, including mammalian target of rapamycin and beclin 1‐interacting complex.1, 2 These pathways elaborately regulate autophagy in response to external stimuli. SULF2, an enzyme that specifically removes the 6‐O‐sulfate groups of HSPGs, also modulates the function of various intracellular pathways by altering the binding sites of many heparin‐binding growth factors and cytokines.8 Our previous study identified that SULF2 increases resistance to chemotherapeutics by activating the phosphatidylinositol 3‐kinase‐Akt pathway.8, 11 The acquisition of resistance to drug treatment is also a typical consequence of autophagy.12 Therefore, we investigated whether the expression levels of SULF2 have an influence on the autophagic flux in HCC cells. SULF2‐expressing cells showed a significantly higher number of autophagosomes and autolysosomes compared with controls, suggesting that SULF2 expression results in “complete” autophagic flux, comprising the entire sequence from autophagosome formation to lysosomal degradation. Because the increment of autolysosome numbers was higher than that of autophagosomes, we specifically focused on lysosomes. We found that SULF2‐expressing cells clearly showed more colocalization between (1) autophagosomes and lysosomes (autolysosome formation) and (2) lysosomes and lysosomal enzymes (enzymatic degradation), which again suggests that the entire autophagic process is enhanced without interruption. However, no direct relationship between SULF2 expression and lysosomal fusion has been reported thus far. Consequently, we sought to identify a potential mediator that is associated with both SULF2 and lysosomal fusion. In our previous study, one of the genes that was positively correlated with SULF2 was LAPTM5.9 However, LAPTM5 mostly distributes in the hematologic system and is involved in adult hematopoiesis or embryogenesis,10 and thus has been studied in hematologic malignancies.13, 14 However, LAPTM4B, another gene that belongs to the LAPTM family and shares several characteristics with LAPTM5,10 has been investigated widely for its clinical significance in various solid cancers including HCC.15, 16 In fact, LAPTM4B is structurally similar to LAPTM5 and is one of the top interactants of LAPTM5.17 LAPTM4B belongs to the LAPTM4B/LAPTM5 transporter family and is located in the late endosomes and lysosomes.18 The role of LAPTM4B is not fully understood; however, it is thought to be involved in maintaining optimal lysosomal function.19 Previous studies identified LAPTM4B as a potential oncogene, as overexpression was associated with increased colony formation, cell proliferation, migration, and invasion.16, 20 Furthermore, in human specimens, higher levels of LAPTM4B were observed in HCC compared with the adjacent normal tissue and were associated with poor clinical outcomes.16, 21 Because we have shown that SULF2 expression positively correlated with expression of LAPTM4B, these results are consistent with our previous report of poor clinical outcomes in patients with HCCs expressing SULF2.11, 22, 23 In this manuscript, we have explored the functional interaction between SULF2 and the effects of LAPTM4B on autophagy. We found that LAPTM4B acts as a crucial mediator of enhanced autophagy in SULF2‐expressing cells. In contrast, inhibition of LAPTM4B decreased autophagy but instead induced LMP. This result is comparable to the previous study by Li et al. that identified that LAPTM4B depletion was associated with increased LAMP and decreased autophagic flux in breast cancer cell lines.24 In addition, when LAPTM4B and SULF2 are simultaneously suppressed, cell viability and colony formation were significantly decreased in SULF2‐expressing HCC cells, compared with suppressing LAPTM4B or SULF2 alone. Because LAPTM4B and SULF2 have separately been shown to increase HCC cell proliferation and colony formation,8, 9, 11, 15, 16, 20, 21, 22, 24 our results suggest that inhibition of SULF2LAPTM4B axis could exert a greater effect on HCC progression by additionally modulating autophagy. One of the limitations of our study is that the anti‐LAPTM4B antibody that we used for identifying protein expression was only usable for western blot; thus, we were not able to demonstrate the distribution of LAPTM4B protein by immunofluorescence. In conclusion, activation of a SULF2LAPTM4B axis contributes to enhanced autophagic flux in HCC cells. LMP occurs when the SULF2LAPTM4B axis is suppressed. Inhibition of the SULF2LAPTM4B‐dependent autophagic pathway could be a therapeutic target in HCC patients.

Materials and Methods

Cell Lines

Human hepatocellular carcinoma cell lines, Huh7 and Hep3B, were used in this experiment. Huh7 was purchased from the Japanese Collection of Research Bioresources Cell Bank and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% fetal bovine serum. Hep3B was purchased from American Type Culture Collection (Manassas, VA) and cultured in minimum essential medium (MEM; Gibco) supplemented with 10% fetal bovine serum. Both cell lines were grown at 37°C in a 5% CO2 incubator. The cells were seeded in the 10‐cm plates at 60%‐70% confluence without any chemical compounds, including selecting antibiotics, and maintained for 24 hours for further assay. Bafilomycin‐A1 (100 nM; B1793; Sigma‐Aldrich, St. Louis, MO) was added for the last 2 hours of assay. For control groups without bafilomycin‐A1 treatment, the same volume of dimethyl sulfoxide (DMSO) was added. The expression of SULF2 was examined in both of the cell lines before transfecting shRNA or overexpression plasmid. The presence of mycoplasma contamination was examined by the MycoAlert Mycoplasma Detection Kit (LT07‐418; Lonza, Basel, Switzerland) before performing next‐step assays/experiments or regularly at once a month.

Plasmid, Virus Production, and Transfection

For Huh7 cells that essentially express high SULF2, shRNA targeting SULF2 mRNA was stably transfected. The target sequence, CATCAATGAGACTCACAATTT, was cloned into the pLKO.1 vector that harbors the puromycin‐resistance gene. Subsequently, lentiviral particles were produced by transfecting the plasmids to the HEK 293T cells. The Huh7 cells were infected with lentiviral particles and puromycin was treated for selecting and maintaining the cells. Lentivirus containing scrambled shRNA sequence was used as control. The SULF2‐negative Hep3B cells were transfected with the pcDNA3.1 plasmid (Invitrogen, Carlsbad, CA) harboring full‐length SULF2 complementary DNA (cDNA). These cells were treated with 400 μg/mL of geneticin (Invitrogen) for 14‐21 days for selecting geneticin‐resistance clones. The isolated clones were tested for the SULF2 expression levels and maintained with 200 μg/mL of geneticin. The Hep3B cells transfected with empty pcDNA3.1 were used as control. Fugene 6 Transfection Reagent (11814443001; Roche Diagnostics, Mannheim, Germany) and Lipofectamin LTX with Plus Reagent (15338100; Invitrogen) were used for transfecting HEK 293T and Hep3B cells, respectively.

Western Blots and Antibodies

The Cell Extraction Buffer (FNN0011; Invitrogen) was used to extract the cellular proteins. Whole cell lysates were incubated on ice for 30 minutes and centrifuged at 14,000 G, 4°C, for 10 minutes. The protein concentration of the collected supernatant was measured using Pierce BCA Protein Assay Kit (23227; Thermo Fisher Scientific, Waltham, MA). Equal amounts of proteins were electrophoretically separated on 4%‐15% gradient or 15% sodium dodecyl sulfate‐polyacrylamide gels, depending on the molecular weights. Subsequently, the proteins were transferred to polyvinlidene fluoride membrane, blocked with 5% nonfat dry milk, washed with 0.1% Tris‐buffered saline and Tween 20 (TBS/T), and incubated at 4°C overnight with the primary antibodies. After washing out the primary antibody solution with 0.1% TBS/T, the blots were incubated with horseradish peroxidase (HRP)‐conjugated secondary antibodies at room temperature for 1 hour. The chemiluminescent HRP antibody detection reagent HyGlo Quick Spray Kit (E2400; Denville Scientific, Metuchen, NJ) was used for developing the blots. The list of primary antibodies used in the western blot and/or immunofluorescence is as follows: anti‐SULF2 (1:1,000; MBS219851; MyBioSource, San Diego, CA), anti‐LC3B (1:1,000 to 1:2,000; ab192890; Abcam, Cambridge, United Kingdom), anti‐p62 (1:2,000; ab56416; Abcam), anti‐LAMP1 (1:10,000; ab25630; Abcam), anti‐cathepsin D (1:2,000; ab75852; Abcam and 1:100; sc‐13148; Santa Cruz Biotechnology, Dallas, TX), anti‐cathepsin B (1:1,000; ab125067; Abcam), anti‐PARP (1:1,000; 9542, Cell Signaling Technology, Danvers, MA), anti‐cleaved PARP (1:1,000; 5625, Cell Signaling Technology), anti‐caspase 8 (1:200; sc‐73526; Santa Cruz Biotechnology), anti‐caspase‐9 (1:1,000; 9508; Cell Signaling Technology), anti‐Bak (1:10,000; ab32371; Abcam), anti‐Bax (1:1,000; ab32503; Abcam), anti‐Bcl‐2 (1:500; 13‐8800; Invitrogen), anti‐galectin‐3 (1:1,000; ab76245; Abcam), anti‐LAPTM4B (1:250; AP20870a; Abgent), anti‐α‐tubulin (1:5,000; ab7291; Abcam), and anti‐GAPDH (1:1,000; 2118; Cell Signaling Technology). Goat anti‐mouse immunoglobulin G (IgG) (5220‐0341; SeraCare, Milford, MA) or goat anti‐rabbit IgG (7074; Cell Signaling Technology) secondary antibodies were used at 1:5,000 dilution.

GFP‐LC3 Fluorescence Microscopy and Quantification

The plasmid vector (pCDH‐CMV‐MCS‐EF1a‐Puro; CD510B‐1; System Biosciences, Palo Alto, CA) expressing fusion GFP‐LC3 protein construct was kindly provided by Dr. Frank Sinicrope. The lentiviral particles were prepared using the plasmid, and the cells were stably transfected. Cells were seeded in the 6‐well plate at 60%‐70% confluence and maintained for 24 hours without any chemical compound including selecting antibiotics. For the last 2 hours of the experiment, cells were treated with bafilomycin‐A1 (100 nM) or control DMSO in a final concentration of 0.1%. Subsequently, the cells were fixed with 4% paraformaldehyde (PFA), and the nuclei were counterstained with 4′,6‐diamidino‐2‐phenylindole (blue). A total of 50 GFP‐LC3 positive cells were examined from 10 random fields (5 cells/field) under the confocal microscope using the × 40 oil immersion objective. If the cytoplasm of the cell showed 30 GFP‐LC3 or more puncta and the nucleus was negative for puncta, it was counted as an autophagic cell. Confocal microscopic images were obtained using the ZEN software on a Zeiss 780 using an Ex/Em 488/510‐nm filter. All experiments were performed in at least triplicate per condition.

Tandem mRFP‐GFP Fluorescence Microscopy and Quantification

The Premo Autophagy Tandem Sensor RFP‐GFP‐LC3B kit (P36239; Life Technologies, Carlsbad, CA) was used as the assay for cellular autophagic flux. The LC3B is tagged with both GFP and RFP, thereby enabling differentiation of autophagosomes from autolysosomes, as acid‐sensitive GFP is degraded by lysosomal enzymes once fusion between autophagosomes and lysosomes occurs and the autolysosomal environment becomes acidic. Therefore, autophagosomes are shown as yellow puncta‐positive cells, whereas autolysosomes show only red puncta. The cell preparation for confocal microscopic exams was performed. The number of cells positive for yellow or red puncta was counted after examining 50 cells in 10 random fields (5 cells/field) under a × 40 confocal microscope objective. Confocal microscopic images were obtained using the ZEN software on a Zeiss 780 with the following filters: Ex/Em 488/510 nm for GFP and Ex/Em 568/603 nm for RFP. All experiments were performed in at least triplicate per condition.

Electron Microscopy

The cellular ultrastructure was examined using transmission electron microscopy (JEOL 1400, Peabody, MA). A total of 50 intact cells were observed from 10 random fields (5 cells/field), and the number of autophagosomes and autolysosomes were counted separately.

Measurement of Cathepsin Activity

Cathepsin D (Abcam; 65302) and cathepsin B (Abcam; ab65300) activity kits were used to compare cathepsin activity in SULF2‐expressing versus nonexpressing cells. Briefly, whole cell lysates were collected and an equal amount of protein was placed in each well of a clear‐bottomed, black 96‐well plate after the volume was adjusted to 50 µL with cell lysis buffer. Then 50 µL reaction buffer, together with 2 µL cathepsin D or cathepsin B substrate, was added to each well. The reactions were incubated at 37°C in the dark for 90 minutes. The fluorescence of the converted substrates was read at Ex/Em of 328/460 nm for cathepsin D and Ex/Em of 400/505 nm for cathepsin B. All experiments were performed in at least triplicate, and each experiment was done with the samples in triplicate. The values are presented as relative fluorescence unit after subtracting the background values.

Immunofluorescence

Cells were seeded in the 6‐well plates at 60%‐70% confluence and maintained for 24 hours without any chemical compound, including selecting antibiotics. Bafilomycin‐A1 or DMSO was added for the last 2 hours when needed. For confocal microscopy, the cells were fixed with 4% PFA and then permeabilized in 0.1% Triton‐X‐100 in phosphate‐buffered saline (PBS) for 5 minutes. After washing, the cells were blocked with 5% normal goat serum in PBS at room temperature for 1 hour. The blocking buffer was washed out and the cells were incubated in the primary antibody solution diluted in 5% normal goat serum in PBS at 4°C overnight. The cells were then washed and incubated with appropriate secondary antibodies diluted 1:500 in 5% normal goat serum in PBS (Alexa Fluor 488 goat antimouse [A11001] and Alexa Fluor 568 goat antirabbit [A11011]) (Invitrogen) at room temperature for 1 hour, protected from light. The prepared slides were examined by confocal microscopy. For the evaluation of fusion between autophagosomes and lysosomes, a total of 100 autophagic cells (≥ 30 LC3B puncta in the cytoplasm) were identified for each condition. The ImageJ (National Institutes of Health, Bethesda, MD) plugin JACoP was used to measure the degree of colocalization and calculate the Pearson's correlation coefficients. LMP was evaluated in two different immunofluorescence experiments. First, a co‐immunofluorescence experiment using markers for lysosomal enzyme (cathepsin D) and the LAMP1 were performed. Second, the galectin‐3 puncta formation assay was performed by staining the cells with galectin‐3 and LAMP1. Diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 was detected as a result of LMP. In both experiments, a total of 50 cells from 10 random fields (5 cells/field) were observed, and the percentage of the cells showing diffuse cytosolic staining of cathepsin D or punctate staining of galectin‐3 was calculated, respectively. If the cytoplasm of the cell showed at least 10 galectin‐3 puncta, it was considered as positive for LMP.

Quantitative Real Time‐PCR

Total RNA was extracted from the cells using the Direct‐zol RNA Miniprep Kit (R2050; Zymo Research, Irvine, CA) according to the manufacturer's instructions. cDNA was synthesized from 1 µg of RNA reversed‐transcribed with random primers (High‐Capacity cDNA Reverse Transcription Kit; 4368814; Applied Biosystems, Foster City, CA). The SYBR Green Master Mix (Roche Diagnostics) was used for quantitative real‐time PCR, and the amplified fluorescence signal was detected by Roche LightCycler 480 (Roche Diagnostics). All experiments were performed with three replicates per experiment. The relative mRNA expression was presented as 2(‐ddCt) calculated from the threshold cycle values. The primers used for quantitative real‐time PCR are 5′‐CAACCTCGTGCCCAAGTACT‐3′ (SULF2‐F), 5′‐CACTGAAGTCCCCACCATCC‐3′ (SULF2‐R), 5′‐TCAATGCTGTGGTACTGTTGATT‐3′ (LAPTM4B‐F), 5′‐GTACGCTCCGTAAGTAGCCATA‐3′ (LAPTM4B‐R), 5′‐GCGTCTTGTTGTTCATCGAGC‐3′ (LAPTM5‐F), 5′‐CGATCCTGAGGTAGCCCAT‐3′ (LAPTM5‐R), 5′‐CATGTACGTTGCTATCCAGGC‐3′ (β‐actin‐F), and 5′‐CTCCTTAATGTCACGCACGAT‐3′ (β‐actin‐R).

RNA Interference

The cells were seeded in 6‐well plates at 50%‐60% confluence and maintained for 24 hours without any chemical compound, including selecting antibiotics. Then, siRNA targeting LAPTM4B (5′‐CCUACCUGUUUGGUCCUUATT‐3′ [sense], 5′‐UAAGGACCAAACAGGUAGGAT‐3′ [antisense]; 4392420; Invitrogen) was transfected to the cells and maintained for 48 hours before further analysis. As a control, a scrambled siRNA (4390843; Invitrogen) was used. Lipofectamine RNAiMax (13778075; Invitrogen) together with Opti‐MEM Reduced Serum Medium (31985070; Gibco) were used for transfecting siRNA according to the manufacturer's instructions.

Cell Proliferation Assay

The in vitro cell viability test was performed with a MTT assay. Cells were seeded at a density of 0.5 × 104 cells/well in 96‐well culture plates. After 24 hours, the cells were transfected with the siRNA for 48 hours. The cells were incubated with 20 µL of 5 mg/mL MTT solution, protected from light. After 3 hours, culture medium was carefully discarded and formazan was resuspended with 200 µL of DMSO. Finally, the cell viability in each well was measured in terms of optical density at 560 nm, with 670 nm for reference.

Soft Agar Colony Formation Assay

As for anchorage‐independent growth, CytoSelect 96‐well Cell Transformation Assay Kit (Cell Recovery Compatible, Colorimetric; CBA‐135; Cell Biolabs, Inc., San Diego, CA) was used in accordance with the manufacturer's instructions. Briefly, the mixture of 1.2% agar solution, 2 × DMEM medium, and 500 SULF2‐positive Hep3B cells that were transfected with various siRNAs was plated into a 96‐well microplate. The plates were incubated at 37°C in 5% CO2, and the colonies that had formed after 7 days were quantified by colorimetric assay using MTT in detergent solution. Absorbance was detected at 570 nm. Assays were performed in duplicate, and each experiment was done with the samples in triplicate.

Statistical Analysis

All statistical analyses were performed using SPSS version 22.0 (SPSS Inc., Chicago, IL). The relationships between the experimental condition and continuous variables were assessed by Student t test. GraphPad Prism 5.0 was used for graphical presentations of the data (GraphPad Software Inc., San Diego, CA). All bar graphs represent the mean ± SEM derived from each independent experiment.
  24 in total

Review 1.  Autophagy: renovation of cells and tissues.

Authors:  Noboru Mizushima; Masaaki Komatsu
Journal:  Cell       Date:  2011-11-11       Impact factor: 41.582

2.  The oncogenic effect of sulfatase 2 in human hepatocellular carcinoma is mediated in part by glypican 3-dependent Wnt activation.

Authors:  Jin-Ping Lai; Abdul M Oseini; Catherine D Moser; Chunrong Yu; Sherine F Elsawa; Chunling Hu; Ikuo Nakamura; Tao Han; Ileana Aderca; Hajime Isomoto; Megan M Garrity-Park; Abdirashid M Shire; Jia Li; Schuyler O Sanderson; Alex A Adjei; Martin E Fernandez-Zapico; Lewis R Roberts
Journal:  Hepatology       Date:  2010-11       Impact factor: 17.425

3.  LAPTM5: a novel lysosomal-associated multispanning membrane protein preferentially expressed in hematopoietic cells.

Authors:  C N Adra; S Zhu; J L Ko; J C Guillemot; A M Cuervo; H Kobayashi; T Horiuchi; J M Lelias; J D Rowley; B Lim
Journal:  Genomics       Date:  1996-07-15       Impact factor: 5.736

4.  Lysosomal transmembrane protein LAPTM4B promotes autophagy and tolerance to metabolic stress in cancer cells.

Authors:  Yang Li; Qing Zhang; Ruiyang Tian; Qi Wang; Jean J Zhao; J Dirk Iglehart; Zhigang Charles Wang; Andrea L Richardson
Journal:  Cancer Res       Date:  2011-10-28       Impact factor: 12.701

5.  Overexpression of LAPTM4B-35 promotes growth and metastasis of hepatocellular carcinoma in vitro and in vivo.

Authors:  Hua Yang; Fuxia Xiong; Xuanhui Wei; Yu Yang; Michael A McNutt; Rouli Zhou
Journal:  Cancer Lett       Date:  2010-03-03       Impact factor: 8.679

6.  Sulfatase 1 and sulfatase 2 in hepatocellular carcinoma: associated signaling pathways, tumor phenotypes, and survival.

Authors:  Ju Dong Yang; Zhifu Sun; Chunling Hu; Jinping Lai; Rebecca Dove; Ikuo Nakamura; Ju-Seog Lee; Snorri S Thorgeirsson; Koo Jeong Kang; In-Sun Chu; Lewis R Roberts
Journal:  Genes Chromosomes Cancer       Date:  2011-02       Impact factor: 5.006

Review 7.  Autophagy in malignant transformation and cancer progression.

Authors:  Lorenzo Galluzzi; Federico Pietrocola; José Manuel Bravo-San Pedro; Ravi K Amaravadi; Eric H Baehrecke; Francesco Cecconi; Patrice Codogno; Jayanta Debnath; David A Gewirtz; Vassiliki Karantza; Alec Kimmelman; Sharad Kumar; Beth Levine; Maria Chiara Maiuri; Seamus J Martin; Josef Penninger; Mauro Piacentini; David C Rubinsztein; Hans-Uwe Simon; Anne Simonsen; Andrew M Thorburn; Guillermo Velasco; Kevin M Ryan; Guido Kroemer
Journal:  EMBO J       Date:  2015-02-23       Impact factor: 11.598

8.  Hedgehog signaling pathway regulates autophagy in human hepatocellular carcinoma cells.

Authors:  Ying Wang; Chang Han; Lu Lu; Susan Magliato; Tong Wu
Journal:  Hepatology       Date:  2013-07-30       Impact factor: 17.425

9.  UniProt: a worldwide hub of protein knowledge.

Authors: 
Journal:  Nucleic Acids Res       Date:  2019-01-08       Impact factor: 16.971

10.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

View more
  2 in total

1.  Knockout of sulfatase 2 is associated with decreased steatohepatitis and fibrosis in a mouse model of nonalcoholic fatty liver disease.

Authors:  Tae Hyo Kim; Bubu A Banini; Faizal Z Asumda; Nellie A Campbell; Chunling Hu; Catherine D Moser; Abdirashid M Shire; Shaoshan Han; Chenchao Ma; Anuradha Krishnan; Taofic Mounajjed; Thomas A White; Gregory J Gores; Nathan K LeBrasseur; Michael R Charlton; Lewis Rowland Roberts
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2020-07-20       Impact factor: 4.052

Review 2.  Cathepsin D-Managing the Delicate Balance.

Authors:  Olja Mijanovic; Anastasiia I Petushkova; Ana Brankovic; Boris Turk; Anna B Solovieva; Angelina I Nikitkina; Sergey Bolevich; Peter S Timashev; Alessandro Parodi; Andrey A Zamyatnin
Journal:  Pharmaceutics       Date:  2021-06-05       Impact factor: 6.321

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.