Literature DB >> 31696835

Damaged male germ cells induce epididymitis in mice.

Wei-Hua Liu1, Fei Wang1, Xiao-Qin Yu1, Han Wu1, Mao-Lei Gong1, Ran Chen1, Wen-Jing Zhang1, Rui-Qin Han1, Ai-Jie Liu1, Yong-Mei Chen1, Dai-Shu Han1.   

Abstract

Epididymitis can be caused by infectious and noninfectious etiological factors. While microbial infections are responsible for infectious epididymitis, the etiological factors contributing to noninfectious epididymitis remain to be defined. The present study demonstrated that damaged male germ cells (DMGCs) induce epididymitis in mice. Intraperitoneal injection of the alkylating agent busulfan damaged murine male germ cells. Epididymitis was observed in mice 4 weeks after the injection of busulfan and was characterized by massive macrophage infiltration. Epididymitis was coincident with an accumulation of DMGCs in the epididymis. In contrast, busulfan injection into mice lacking male germ cells did not induce epididymitis. DMGCs induced innate immune responses in epididymal epithelial cells (EECs), thereby upregulating the pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL-1β), as well as the chemokines such as monocyte chemotactic protein-1 (MCP-1), monocyte chemotactic protein-5 (MCP-5), and chemokine ligand-10 (CXCL10). These results suggest that male germ cell damage may induce noninfectious epididymitis through the induction of innate immune responses in EECs. These findings provide novel insights into the mechanisms underlying noninfectious epididymitis, which might aid in the diagnosis and treatment of the disease.

Entities:  

Keywords:  busulfan; epididymitis; innate immune response; male germ cell; male infertility

Mesh:

Substances:

Year:  2020        PMID: 31696835      PMCID: PMC7523604          DOI: 10.4103/aja.aja_116_19

Source DB:  PubMed          Journal:  Asian J Androl        ISSN: 1008-682X            Impact factor:   3.285


INTRODUCTION

Microbial infections and inflammatory conditions in the male genital tract are responsible for approximately 15.0% of male infertility cases in developed countries,1 and this ratio can be much higher in undeveloped countries.2 Epididymitis and orchitis are more likely to contribute to male infertility than inflammatory conditions in the accessory sexual glands, including the prostate and seminal vesicle glands.3 Epididymitis is more common than orchitis in outpatient visitors.4 Orchitis often occurs with epididymitis and is termed epididymo-orchitis.5 Epididymitis can take an acute form with symptoms lasting several weeks, or it can be chronic lasting more than 3 months. Acute epididymitis can be caused by the reflux of urine into the ejaculatory ducts or by retrograde bacterial infection ascending the urogenital tracts.6 The mumps virus can induce epididymitis as epididymo-orchitis syndrome.7 However, many epididymitis cases lack evidence of microbial infections in the reproductive tract. Various risk factors for noninfectious epididymitis have been identified including a previous systemic infection, adverse reaction to a medication, physical trauma of the scrotum, and prolonged sitting or bicycle riding.58 The mechanisms by which these risk factors induce noninfectious epididymitis are unknown. Most male germ cells are generated in puberty, when a considerable time has passed since the establishment of self-tolerance to autoantigens during the fetal and neonatal periods. Therefore, male germ cells produce immunogenic antigens that may induce an autoimmune response. Male germ cells do not induce inflammation in the testis under physiological conditions because of the immunoprivileged status of the testis.9 However, autoimmune orchitis can occur under certain pathological conditions, such as physical trauma, and exposure to chemical toxins or high temperature that may damage germ cells.10 The accumulation of apoptotic germ cells related to defective clearance mechanisms in the testis favors autoimmune orchitis.11 We previously demonstrated that damaged male germ cells (DMGCs) induce an innate immune response in Sertoli cells, thereby upregulating the expression of pro-inflammatory cytokines and chemokines that promote inflammation.12 These previous studies suggested that DMGCs might induce endogenous inflammation in the testis. Although the epididymis is also considered an immunoprivileged organ, immunosuppression in the epididymis is not as complete as in the testis.13 Therefore, we hypothesized that DMGCs induce epididymitis when they are present in the epididymis. Busulfan is an alkyl sulfonate, a cell cycle nonspecific alkylating antineoplastic agent. Busulfan severely damages male germ cells. We used a busulfan-induced male germ cell damage model to provide substantial evidence that DMGCs induce epididymitis in mice. Therefore, DMGC might be an etiological factor in noninfectious epididymitis associated with various risk factors that may damage male germ cells.

MATERIALS AND METHODS

Animals

C57BL/6J mice were obtained from the Laboratory Animal Center of the Peking Union Medical College (Beijing, China). Tumor necrosis factor-α knockout (TNF-α) mice (B6/129S6-TNFtm1GK1/J) on a C57BL/6J background were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Wild-type (WT) mice were obtained by backcrossing knockout mice to C57BL/6J mice. The mice were maintained in a specific pathogen-free facility with a 12 h/12 h light/dark cycle and were provided with food and water ad libitum. The mice were handled in compliance with the guidelines (ACUC-A01-2018-008) for the Care and Use of Laboratory Animals established by the Chinese Council on Animal Care. The experimental procedures were approved by the Institutional Animal Care and Use Committee of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (Beijing, China).

Antibodies and major reagents

Rat monoclonal anti-F4/80 (ab6640), rabbit polyclonal anti-CD45 (ab10558), rabbit monoclonal anti-CD4 (ab183685), rabbit polyclonal anti-CD8 (ab203035), and rat monoclonal anti-B220 (ab64100) antibodies and pan-cytokeratin (ab7753) were purchased from Abcam (Cambridge, UK). Horseradish peroxidase (HRP)-conjugated secondary antibodies and 3,3'-diaminobenzidine (DAB) were purchased from Zhongshan Biotechnology Co. (Beijing, China). Collagenase type IV (C0130-100MG), hyaluronidase (H3506-100MG), and busulfan (S85543-229) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Busulfan injection

Busulfan was dissolved in dimethyl sulfoxide (DMSO) at 5 mg ml−1 and diluted with 2× phosphate-buffered saline (PBS) at a ratio of 1:1. Ten-week-old male mice received an intraperitoneal injection of a single dose of busulfan (25 mg kg−1). Mice injected with the same volume of a mixture of DMSO and PBS served as the controls. Five mice per group were injected for one experiment, and the total number of mice in the study is listed in . Incidence of epididymitis C57BL/6J male mice (10-old-week) were intraperitoneally injected with 25 mg kg-1 body weight for the indicated durations. The incidence and percentage of males with epididymitis were determined from histological analysis and immunohistochemical staining

Histology and immunohistochemical staining

For histological analysis, the testes and epididymides were fixed in 4% (w/v) paraformaldehyde (Sigma-Aldrich) for 24 h. The tissues were embedded in paraffin and cut into 5-μm-thick sections on a Leica CM1950 (Leica Biosystems, Nussloch, Germany). The sections were stained with hematoxylin and eosin (H and E) and mounted with neutral balsam (Zhongshan Biotechnology Co.) for observation by a light microscope (BX-51, Olympus, Osaka, Japan). For immunohistochemical staining, the sections were soaked in citrate buffer (11 mmol l−1, pH 6.0; Zhongshan Biotechnology Co.) and heated in a microwave oven at 100°C for 10 min to retrieve the antigens. The sections were washed three times with 1× PBS and then incubated in 1× PBS containing 3% (v/v) H2O2 (Zhongshan Biotechnology Co.) for 15 min to inhibit endogenous peroxidase activity. After being washed three times, the sections were blocked with 5% (v/v) normal goat sera (Zhongshan Biotechnology Co.) in PBS for 1 h at room temperature and then incubated with the primary antibodies overnight at 4°C. The sections were washed three times with PBS and incubated with the appropriate HRP-conjugated secondary antibodies at room temperature for 30 min. The HRP activity was visualized using the DAB method. The negative controls were incubated with preimmune rabbit sera (Zhongshan Biotechnology Co.) instead of primary antibodies. The sections were counterstained with hematoxylin and mounted with neutral balsam for observation.

Cell isolation

Primary epididymal epithelial cells (EECs) were isolated from 4-week-old C57BL/6J mice based on previously described procedures.14 In brief, mice were anesthetized with CO2 and euthanized by cervical dislocation. The entire epididymis of each mouse was collected and incubated with 10 mg ml−1 collagenase type IV (Sigma-Aldrich) in F12 Dulbecco's modified Eagle's medium (DMEM; Life Technologies Inc., Gaithersburg, MD, USA) at 37°C for 30 min to remove the interstitial cells. The epididymal tubules were collected after filtration through an 80-μm copper mesh and then treated with 0.5 mg ml−1 hyaluronidase (Sigma-Aldrich) in F12/DMEM at 37°C for 15 min to remove peritubular smooth muscle cells. The tubules were cut into small pieces (approximately 1 mm) and treated with 1.0 mg ml−1 hyaluronidase at 37°C for 30 min with occasional gentle pipetting. The suspensions were filtered through an 80-μm copper mesh. EECs were collected and cultured in a humidified atmosphere containing 5% (v/v) CO2 at 37°C in F12/DMEM supplemented with 1.2 mg ml−1 sodium bicarbonate (Sinopharm Chemical Reagent Co., Ltd., Beijing, China), 10% (v/v) fetal bovine serum (Life Technologies), 100 U ml−1 penicillin, and 100 μg ml−1 streptomycin. The EEC purity was >95% from assessment by immunofluorescence staining for pan-cytokeratin, a marker of pan-epithelial cells.15 Male germ cells were isolated from 10-week-old mice on the basis of previously described procedures.16 Briefly, the testes were decapsulated and incubated with 1 mg ml−1 collagenase type IV at 37°C for 15 min with gentle oscillation. The suspensions were filtered through an 80-μm copper mesh to remove the interstitial cells. The seminiferous tubules were cut into small pieces of approximately 1 mm and incubated with 0.5 mg ml−1 hyaluronidase at 37°C for 10 min with pipetting. After filtration through an 80-μm copper mesh, cell suspensions were collected and cultured in F12/DMEM at 37°C for 6 h. During that time, the testicular somatic cells attached to the culture dishes, and the germ cells were subsequently recovered by collecting the nonadherent cells. The purity of the germ cells was >95% from immunostaining for mouse vasa homolog (MVH), a marker of germ cells.17 The germ cells were cultured in serum-free F12/DMEM to induce damage, and more than 80% of the germ cells underwent apoptosis or necrosis 24 h after culture. The apoptotic and necrotic cells, as well as cellular debris, were collected after centrifugation (Beijing Jingli Centrifuge Co., Ltd., Beijing, China) at 300 g for 5 min and were used as DMGCs.

Immunofluorescence staining

For immunofluorescence staining, EECs were cultured on Lab-Tek chamber slides (Merck Millipore, Billica, MA, USA). The cells were fixed with methanol at −20°C for 30 min and then permeabilized with 0.5% (v/v) Triton X−100 in PBS for 10 min. After being blocked with 10% (v/v) normal goat sera in PBS at room temperature for 30 min, the cells were incubated with the primary antibodies at 37°C for 2 h. After being washed three times with PBS, the cells were incubated with appropriate tetramethylrhodamine-5-(and-6)-isothiocyanate (TRITC)-conjugated secondary Abs (Zhongshan Biotechnology Co.) for 30 min. The cells were counterstained with 4', 6'-diamidino-2-phenylindole (DAPI; Zhongshan Biotechnology Co.) according to the manufacturer's instructions. The slides were mounted with Antifade Mounting Medium (Vector Laboratories, Inc., Burlingame, CA, USA) for observation by a fluorescence microscope BX-51 (Olympus, Tokyo, Japan).

Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total RNA was extracted from EECs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. RNA was treated with RNase-free DNase I (Invitrogen) to remove genomic DNA contaminants. RNA (1 μg) was reverse transcribed into cDNA in a 20-μl reaction mixture containing 2.5 μmol l−1 random primer, 2 μmol l−1 dinucleotide triphosphates, and 200 U Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA). PCR was performed with a Power SYBR Green PCR master mix kit (Applied Biosystems, Foster City, CA, USA) in an ABI PRISM 7300 real-time cycler (Applied Biosystems). The relative mRNA levels were determined using the comparative 2−△△Ct method by normalizing to β-actin as described in Applied Biosystems User Bulletin No. 2 (P/N 4303859).18 The primer sequences are listed in . Primers used for quantitative reverse transcription polymerase chain reaction TNF-α: tumor necrosis factor-α; IL-6: interleukin-6; IL-1β: interleukin-1β; MCP-1: monocyte chemotactic protein-1; MCP-5: monocyte chemotactic protein-5; CCL3: chemokine (C-C motif) ligand 3; CXCL10: chemokine ligand-10

Stimulation of EECs with DMGCs

EECs were cultured in 6-well plates at a density of 5 × 105 cells per well. DMGCs (1 × 106 per well) were added to the EECs. At specific time points after stimulation, DMGCs were removed and EECs were collected for analysis of gene expression.

Enzyme-linked immunosorbent assay (ELISA)

Cytokine levels were measured with ELISA kits according to the manufacturer's instruction. A mouse tumor necrosis factor (TNF-α) ELISA kit (CME0004) was purchased from Beijing 4A Biotech (Beijing, China). ELISA kits for mouse monocyte chemoattractant protein-1 (MCP-1; BMS6005) and C-X-C motif chemokine 10 (CXCL10; BMS6018) were purchased from eBioscience (San Diego, CA, USA).

Statistical analyses

All data were presented as the mean ± standard deviation (s.d.). Statistical significance between individual comparisons was determined using the Student's t-test. For multiple comparisons, one-way analysis of variance (ANOVA) with a Bonferroni (selected pairs) post hoc test was used. The calculations were performed using SPSS version 13.0 (SPSS, Chicago, IL, USA), and P < 0.05 was considered statistically significant.

RESULTS

Busulfan-induced male germ cell damage

To determine the extent of busulfan-induced male germ cell damage, 25 mg kg−1 of busulfan was intraperitoneally injected into 10-week-old C57BL/6J mice. Germ cell damage was evaluated once each week for 8 weeks after busulfan injection (). All stages of male germ cells, including spermatogonia (black arrows), spermatocytes (white arrows), round spermatids (black arrowheads), and elongating spermatids (white arrowheads), were observed 1 week after busulfan injection. Spermatogonia and spermatocytes had mostly disappeared at 2 weeks after busulfan injection, whereas round and elongated spermatids remained. Only elongating spermatids were observed in the seminiferous tubules at 3 weeks. The germ cells were almost completely absent except for a few elongating spermatids within a certain seminiferous tubule (asterisks) at 4 weeks. However, the germ cells were gradually recovered at 5–8 weeks after the busulfan injection (, lower panels). Busulfan-induced male germ cell damage. Busulfan was intraperitoneally injected into mice. The testes were collected at the indicated weeks after busulfan injection. Paraffin sections of the testes were stained with H and E. The marked squares (upper panels) are magnified for high resolution (lower panels). Black arrows, white arrows, black arrowheads, and white arrowheads indicate spermatogonia, spermatocytes, round spermatids, and elongated spermatids, respectively. Images are representative of at least five mice at each time point. H and E: hematoxylin and eosin stain.

Cell infiltration in the epididymis

The structure of the epididymis was histologically examined after H and E staining (). At 1 week (, left panels) and 2 weeks (, right panels) after busulfan injection, the epididymides displayed a normal histological structure. The corpus and cauda epididymal tubules were filled with many elongated spermatozoa (asterisks). At 3 weeks (, left panels) after busulfan injection, massive cell infiltration (arrows) was observed in the stroma of 75.0% (15/20) of the cauda epididymal tubules. Cell infiltration was not evident in the caput or corpus epididymis 3 weeks after busulfan injection. Cell infiltrations were observed in 83.3% (25/30) of the cauda epididymis (, right panels) 4 weeks after busulfan injection. By contrast, cell infiltration was not present in the epididymides of the control mice 4 weeks after injection with DMSO alone (). Many degenerated spermatozoa (arrowheads) were observed within the lumen of the cauda epididymal tubules of mice 3 and 4 weeks after busulfan injection (). Degenerated spermatozoa were not observed in the epididymides of the control mice (, left panel). The percentage of epididymides with cell infiltrations was markedly decreased after 4 weeks post busulfan injection. Evident cell infiltration (data not shown) was observed in only 5.0% (1/20) of mice 7 and 8 weeks after busulfan injection. The incidence of epididymitis at different time points after busulfan injection is shown in . Cell infiltration in the epididymis was not observed in the control mice injected with 50.0% DMSO alone (data not shown). Histology of the epididymis. The caput, corpus, and cauda epididymides were collected at the indicated weeks after busulfan injection; (a) 1 and 2 weeks; (b) 3 and 4 weeks. Paraffin sections of the epididymides were stained with H and E. The marked squares (left panels) are magnified for high resolution (right panels). Asterisks indicate the epididymal tubules containing spermatozoa. Arrows and arrowheads indicate cell infiltration and DMGCs, respectively. (c) Histology of the Ctrl epididymis. Mice were injected with DMSO for 4 weeks. Sections were stained with H and E. (d) High magnification of the epididymal tubules show DMGCs (arrowheads). Images represent the epididymides of at least 20 mice. H and E: hematoxylin and eosin stain; DMGCs: damaged male germ cells; DMSO: dimethyl sulfoxide; Ctrl: control.

Immune cells in the epididymitis

Cell infiltration into the epididymis suggested epididymitis. Therefore, we characterized the immune cell types in the epididymitis. Immunohistochemical staining for immune cell markers showed that most infiltrating cells were macrophages (black arrows) positively stained for F4/80 (, middle and right panels). Few macrophages were detected in the epididymides of the control mice injected with DMSO (, left panel). Immunostaining for CD45 demonstrated that pan-lymphocytes (black arrowheads) were increased in the epididymitis (, middle and right panels) compared with the controls (left panel). CD4+ lymphocytes (white arrows) were markedly increased in the epididymitis (). By contrast, CD8+ lymphocytes (white arrowheads) were rare in both epididymitis and the controls (). B lymphocytes were not detected by staining for B220 (). The specificity of antibodies for detecting lymphocytes was confirmed by immunohistochemical staining of the mouse spleen (). Identification of immune cells. Mice were injected with busulfan for 4 weeks (middle panels) and with DMSO for the controls (left panels). Paraffin sections of the cauda epididymis were immunohistochemically stained for (a) macrophages, (b) pan-lymphocytes, (c) CD4, (d) CD8, and (e) B lymphocytes using specific primary antibodies against F4/80, CD45, CD4, CD8, and B220, respectively. Right panels show high magnification of the marked squares. (f) Assessment of antibody specificity. Paraffin sections of mouse spleens were immunohistochemically stained using the antibodies against the indicated markers. Insets in the upper right corners represent the negative controls. Images of the epididymis represent the results of at least three mice, and the spleen sections were from one mouse. DMSO: dimethyl sulfoxide.

Busulfan injection and induction of epididymitis in mice lacking germ cells

To confirm that epididymitis was induced by DMGCs after busulfan injection, mice that lacked germ cells in the testis were injected with a second dose of busulfan, 4 weeks after the first busulfan injection. The testis and epididymis were analyzed 4 weeks after the second busulfan injection. Germ cells were completely lost in the testis of all 20 mice (). Only Sertoli cells (black arrows) were observed within the seminiferous tubules. Massive cell infiltration (black arrowheads) was found in 1 of the 20 mice (), but not in the other 19 mice (data not shown). Immunohistochemical staining showed many macrophages (white arrows) in the epididymitis (). However, CD45+ lymphocytes (white arrowheads) were not increased (). Male germ cell damage and epididymitis after a second busulfan injection. Busulfan was intraperitoneally injected into mice for 4 weeks, and then the mice were given a second busulfan injection. The testes and epididymides were collected 4 weeks after the second busulfan injection. (a) Germ cell damage. The paraffin sections of the testis were stained with H and E. The marked square (left panel) is magnified for high resolution (right panel). Black arrows indicate Sertoli cells. (b) Cell infiltrations. Paraffin sections of the cauda epididymis were stained with H and E. Black arrowheads indicate cell infiltrations. (c) Macrophages and (d) pan-lymphocytes were identified by immunohistological staining using specific antibodies against F4/80 and CD45, respectively. The insets in the upper right corners represent the negative controls. The white arrow and arrowheads indicate macrophages and lymphocytes, respectively. Images are the results from one mouse. H and E: hematoxylin and eosin stain.

DMGCs and cytokine production in EECs

To explore the mechanisms underlying epididymitis, we examined the expression of various immune cytokines, including pro-inflammatory cytokines and chemokines in EECs after stimulation with DMGCs. The purity of EECs was >95.0% by immunofluorescence staining for pan-cytokeratin (). Real-time qRT-PCR results showed that the presence of DMGCs upregulated the expression of major pro-inflammatory cytokines, including TNF-α, interleukin (IL-6), and IL-1β, in a time-dependent manner (). The mRNA levels of the pro-inflammatory cytokines were significantly upregulated at 4 h (P < 0.01), 8 h (P < 0.01), and 16 h (IL-6 and IL-1β, P < 0.05) after the presence of DMGCs. Moreover, DMGCs also significantly upregulated the expression of several chemokines, including monocyte chemotactic protein-1 (MCP-1), monocyte chemotactic protein-5 (MCP-5), and chemokine ligand-10 (CXCL10), in EECs at 8 h (P < 0.01), 16 h (P < 0.01), and 24 h (MCP-1, P < 0.05; MCP-5 and CXCL10, P < 0.01) (). In contrast, DMGCs did not significantly upregulate other chemokines, including chemokine (C-C motif) ligand 3 (CCL3), CCL17, or CCL22 (). ELISA results confirmed that the presence of DMGCs significantly increased the secretion of TNF-α, MCP-1, and CXCL10 in the culture media of EECs at 24 h (P < 0.01; ). Expression of immune cytokines in EECs. (a) The purity of EECs. EECs were costained with DAPI and specific antibodies against pan-cytokeratin. (b) Pro-inflammatory factors. EECs were cultured in the presence of DMGCs or in the absence of DMGCs (Ctrl) for the indicated hours. The relative mRNA levels of TNF-α, IL-6, and IL-1α were determined by real-time qRT-PCR. The relative mRNA levels of (c) MCP-1, MCP-5 and CXCL10, (d) chemokine (C-C motif) ligand 3 (CCL3), CCL17, and CCL22 were determined by real-time qRT-PCR. EECs were treated as described in b. (e) Cytokine secretion in culture medium. EECs were cultured in the presence or absence of DMGCs for 24 h. The protein levels of TNF-α, MCP-1, and CXCL10 were measured using ELISA. The data are the mean ± s.d. of three independent experiments. *P < 0.05 and **P < 0.01. qRT-PCR: quantitative reverse transcription polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; s.d.: standard deviation. EECs: epididymal epithelial cells; DAPI: 4',6-diamidino-2-phenylindole; DMGCs: damaged male germ cells; TNF-α: tumor necrosis factor-α; IL: interleukin; MCP-1: monocyte chemotactic protein-1; CXCL10: chemokine ligand-10.

Role of TNF-α in the epididymitis after busulfan injection

Given that TNF-α plays an important role in orchitis and epididymitis,1920 we assessed the role of TNF-α in the epididymitis after busulfan injection into TNF-α−/− mice. Germ cells were comparably damaged in TNF-α−/− (, right panels) and WT (left panels) mice 4 weeks after busulfan injection. In controls, mice injected with DMSO alone had normal germ cells. Only Sertoli cells (black arrows) were observed in the seminiferous tubules after busulfan injection (). Cell infiltration (black arrowheads) was observed in the epididymides of WT mice (, left panels). However, we did not find cell infiltration in TNF-α mice 4 weeks after busulfan injection (, right panels). DMGCs were abundant within the epididymal tubules (asterisks) of WT and TNF-α mice (). Immunohistochemical results confirmed many F4/80+ macrophages (white arrows) in the caudal epididymides of WT mice (, left panel). There were considerably fewer macrophages in the cauda epididymides of TNF-α mice (, right panel) than in WT mice. More CD45+ lymphocytes (white arrowheads) were found in the cauda epididymides of WT mice (, left panel) than in TNF-α mice (right panel) 4 weeks after busulfan injection. Role of TNF-α in epididymitis. (a) Germ cell damage in the testis. Busulfan was intraperitoneally injected into WT and TNF-α−/− mice for 4 weeks. Mice injected with DMSO alone served as the Ctrls. Paraffin sections of the testes were stained with H and E. Black arrows indicate Sertoli cells. (b) Cell infiltrations. Paraffin sections of the cauda epididymides were stained with H and E at 4 weeks after busulfan injection. Asterisks and black arrowheads indicate epididymal tubules with DMGCs and cell infiltrations. (c) Macrophages. Paraffin sections were stained with specific antibodies against F4/80. (d) Lymphocytes. Paraffin sections of the epididymides were stained with primary antibodies against CD45. The insets in the upper right corners represent the negative controls. Images are representatives of at least five mice. (e) Expression of chemokines. EECs were cultured in the presence or absence (Ctrl) of DMGCs for 8 h. The relative mRNA levels of MCP-1, MCP-5, and CXCL10 were determined by real-time qRT-PCR. (f) Cytokine secretion. EECs were treated as described in e for 24 h. The protein levels of TNF-α, MCP-1, and CXCL10 in culture media were measured by ELISA. (g) Effect of TNF-α on MCP-1 and CXCL10 production. EECs were stimulated with 5 ng ml−1 recombinant mouse TNF-α for 24 h. MCP-1 and CXCL10 levels in media were measured by ELISA. The data are expressed as the mean ± s.d. of three independent experiments. *P < 0.05 and **P < 0.01. qRT-PCR: quantitative reverse transcription polymerase chain reaction; ELISA: enzyme-linked immunosorbent assay; s.d.: standard deviation; Ctrl: control; TNF-α: tumor necrosis factor-α; WT: wild-type; DMSO: dimethyl sulfoxide; DMGCs: damaged male germ cells; MCP: monocyte chemotactic protein; CXCL10: chemokine ligand-10; EECs: epididymal epithelial cells. The expression of chemokines in WT and TNF-α−/− EECs after stimulation with DMGCs was also examined. The mRNA levels of MCP-1 (P < 0.01), MCP-5 (P < 0.01), and CXCL10 (P < 0.01) were markedly upregulated in WT EECs 8 h after the presence of DMGCs (). The upregulation was significantly lower in TNF-α EECs than in WT EECs. ELISA results confirmed that TNF-α was absent from the culture medium of TNF-α EECs (, left panel), whereas MCP-1 (middle panel) and CXCL10 (right panel) levels were insignificantly increased in TNF-α EECs 24 h after the presence of DMGCs. Recombinant TNF-α significantly induced the production of MCP-1 (P < 0.01) and CXCL10 (P < 0.01) in both WT and TNF-α EECs ().

DISCUSSION

Epididymitis is the most frequently experienced case of intrascrotal inflammation, which can lead to male infertility.2122 While microbial infections are among the etiological factors responsible for inflammation in the male genital tract, a large number of epididymitis patients lack any evidence of microbial infections.1 Knowledge regarding noninfectious epididymitis is rather limited. Understanding the mechanisms underlying noninfectious epididymitis might benefit the diagnosis and therapy of this disease.23 The present study demonstrated that DMGCs induced epididymitis in mice. Several risk factors for noninfectious epididymitis have been proposed including a previous systemic infection,24 certain medications,2526 and vasectomy.27 Moreover, strenuous labor and long-term sitting or bicycle riding are also associated with epididymitis. However, the causative agents of noninfectious epididymitis remain to be defined. A recent study demonstrated that intraperitoneal injection of lipopolysaccharide (LPS) resulted in epididymitis in mice.20 Epididymitis after LPS injection was associated with an accumulation of DMGCs in the epididymis, suggesting that DMGCs trigger epididymitis caused by a postsystemic infection.20 The present study confirmed that DMGCs induce epididymitis after an intraperitoneal injection of busulfan in mice through the activation of innate immune responses in EECs, which may be an etiological factor of medication-associated epididymitis. It would be interesting to clarify whether DMGCs are triggers of human noninfectious epididymitis associated with different risk factors because most risk factors can damage male germ cells.20282930 Most male germ cells develop a long time after the establishment of immune tolerance to self-antigens, thus allowing them to produce immunogenic antigens. Augmentation of the apoptosis of male germ cells resulted in inflammatory conditions in the testis.3132 Moreover, a defect in the phagocytic removal of apoptotic male germ cells by Sertoli cells favored autoimmune orchitis.11 These early studies suggested that DMGCs might induce orchitis. Although DMGCs may be transmitted luminally to the epididymis from the testis, whether DMGCs induce epididymitis has not been investigated. The present study demonstrated that busulfan injection results in epididymitis concomitant with germ cell damage in the testis and an accumulation of DMGCs in the epididymis. Epididymitis was not induced after a second busulfan injection in mice lacking germ cells in the testis. These results provide substantial evidence that DMGCs induce epididymitis. We did not observe orchitis when male germ cells were damaged in the testis after busulfan injection. The different inflammatory conditions in the testis and the epididymis may be explained by their immune microenvironments. The testis is a remarkable immunoprivileged organ that is tightly controlled by tissue structure, cellular interaction, and dense immunosuppressive networks.33 Although the epididymis has immunoprivileged properties that protect spermatozoa from detrimental immune responses, the immune privilege of the epididymis is not as complete as that of the testis.13 Many immune cells reside in the epididymis.34 Notably, most dendritic cells are localized in the caput epididymis, which is thought to support self-tolerance toward sperm antigens.35 Conversely, blood and lymphatic capillaries are predominantly distributed in the cauda epididymal tubules.36 The differential distributions of immune cells and circulating capillaries might lead to variable susceptibilities to antigen stimulation in different regions of the epididymis, resulting in the predominance of caudal epididymitis. The accumulation of DMGCs in the cauda epididymal tubules should also predominantly induce inflammation in the cauda segment. Accordingly, caudal epididymitis is frequently observed in outpatients, which corresponds to the observations in the present study. To understand the mechanism by which DMGCs induce epididymitis, we examined the expression and function of cytokines that facilitate inflammation. Toll-like receptors (TLR) initiate innate immune responses in many cell types after challenge with TLR ligands, and this facilitates inflammatory conditions by inducing the expression of inflammatory cytokines.37 Various TLRs are expressed in the epididymis and initiate an innate immune response in EECs.3839 High-mobility group box 1 (HMGB1) and heat shock proteins (HSPs) are well-defined endogenous TLR ligands.404142434445 HMGB1 and certain HSPs are abundantly expressed in male germ cells and can be released under stress conditions.4647 Therefore, it is reasonable to speculate that DMGCs release endogenous TLR ligands that trigger innate immune responses in EECs. We previously demonstrated that DMGCs induce inflammatory cytokine expression in Sertoli cells through the activation of TLR2 and TLR4. However, we did not observe immune cell infiltration in the testis. The lower immune privilege of the epididymis may explain why epididymitis occurs more frequently than orchitis in humans.1 We demonstrated that DMGCs induce the expression of major pro-inflammatory cytokines in EECs, including TNF-α, IL-6, and IL-1β, suggesting that innate immune responses can be triggered by endogenous TLR ligands in EECs. Our recent study demonstrated that TNF-α is critical for LPS-induced epididymitis.20 An early study showed that TNF-α has a role in the pathogenesis of experimental autoimmune orchitis.19 Therefore, we assessed the role of TNF-α in the development of epididymitis after busulfan injection in the present study. Epididymitis was not observed in TNF-α mice after busulfan injection, suggesting that TNF-α also plays an important role in DMGC-induced epididymitis. This result confirms that DMGCs induce immune responses in wild-type mice, but this might be because TNF-α mice have a defective immune system. The expression of major chemokines in EECs in the presence of DMGCs was examined to understand the mechanisms underlying leukocyte infiltration. We found that MCP-1, MCP-5, and CXCL10 were significantly upregulated in EECs after challenge with DMGCs, whereas the expressions of CCL3, CCL17, and CCL22 were unaltered. MCP-1 and MCP-5 promote macrophage migration. Accordingly, macrophages were dramatically increased in the epididymitis after busulfan injection. CXCL10 is a pleiotropic cytokine involved in the pathogenesis of autoimmune diseases by recruiting leukocytes and inducing apoptosis.48 We recently demonstrated that the production of CXCL10 by Sertoli cells induced male germ cell apoptosis.49 The role of CXCL10 produced by EECs in the pathogenesis of epididymitis remains unclear. Notably, the upregulation of MCP-1, MCP-5, and CXCL10 was significantly reduced in TNF-α EECs, suggesting that TNF-α is involved in the upregulation of chemokines. We confirmed that recombinant TNF-α significantly upregulated the production of MCP-1 and CXCL10 in EECs. These results correspond to previous observations in other cell types.495051 Therefore, TNF-α might play a central role in the initiation of epididymitis through the induction of chemokines in EECs. Epididymitis was observed in 83.3% of mice 4 weeks after busulfan injection, and this incidence was markedly reduced thereafter. These results suggest that DMGCs might transiently induce epididymitis, which should be mostly recovered. These phenomena correspond to the clinical observations that only minor acute epididymitis advances to chronic disease in humans. Therefore, epididymitis in mice after busulfan injection should be a useful model to investigate the pathomechanism of human noninfectious epididymitis. However, we cannot explain why busulfan injection did not induce epididymitis in some mice.

CONCLUSION

The present study showed that DMGCs induce epididymitis in mice. DMGC-induced TNF-α production in EECs plays a central role in the initiation of epididymitis. It would be interesting to clarify whether germ cell damage is a common etiological factor for human noninfectious epididymitis associated with various risk factors that may damage germ cells. The identification of the specific male germ cell antigens that induce epididymitis might aid in the development of diagnostic and therapeutic strategies for noninfectious epididymitis.

AUTHOR CONTRIBUTIONS

DSH and WHL conceived and designed the experiments and wrote the paper. FW, XQY, HW, MLG, RC, WJZ, RQH, AJL, and YMC performed all the experiments. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declared no competing interests.
Supplementary Table 1

Incidence of epididymitis

+Busulfan (weeks)Total mice (n)Incidence of epididymitis (n)Percentage with epididymitis
12000
22000
3201575.0
4302583.3
5201050.0
620210.0
72015.0
82015.0

C57BL/6J male mice (10-old-week) were intraperitoneally injected with 25 mg kg-1 body weight for the indicated durations. The incidence and percentage of males with epididymitis were determined from histological analysis and immunohistochemical staining

Supplementary Table 2

Primers used for quantitative reverse transcription polymerase chain reaction

Primer pairs (5’→3’)

Target genesForwardReverse
β-ActinGAAATCGTGCGTGACATCAAAGTGTAGTTTCATGGATGCCACAG
TNF-αCATCTTCTCAAAATTCGAGTGACAATGGGAGTAGACAAGGTACAACCC
IL-6GAGGATACCACTCCCAACAGACCAAGTGCATCATCGTTGTTCATACA
IL-1βCAACCAACAAGTGATATTCTCCATGGATCCACACTCTCCAGCTGCA
MCP-1TTAAAAACCTGGATCGGAACCAAGCATTAGCTTCAGATTTACGGGT
MCP-5CCTGTGGCCTTGGGCCTCAAGAGGTGCTGATGTACCAGTTGG
CCL3TGTACCATGACACTCTGCAACCAACGATGAATTGGCGTGGAA
CXCL10CCAAGTGCTGCCGTCATTTTCTCCCTAAGGCCCTCATTCTCA
CCL17TGCTCGAGCCACCAATGTAGACAGTCAGAAACACGATGGCA
CCL22ACCTCTGATGCAGGTCCCTACTTGCGGCAGGATTTTGAGG

TNF-α: tumor necrosis factor-α; IL-6: interleukin-6; IL-1β: interleukin-1β; MCP-1: monocyte chemotactic protein-1; MCP-5: monocyte chemotactic protein-5; CCL3: chemokine (C-C motif) ligand 3; CXCL10: chemokine ligand-10

  50 in total

1.  Toll-like receptor 3-initiated antiviral responses in mouse male germ cells in vitro.

Authors:  Tao Wang; Xiaoyan Zhang; Qiaoyuan Chen; Tingting Deng; Yue Zhang; Nan Li; Tao Shang; Yongmei Chen; Daishu Han
Journal:  Biol Reprod       Date:  2012-04-12       Impact factor: 4.285

2.  Reduced sperm yield from testicular biopsies of vasectomized men is due to increased apoptosis.

Authors:  Deirdre A O'Neill; Carmel M McVicar; Neil McClure; Perry Maxwell; Inez Cooke; Katherine M Pogue; Sheena E M Lewis
Journal:  Fertil Steril       Date:  2007-01-22       Impact factor: 7.329

3.  Distribution of leukocytes in the epithelium and interstitium of four regions of the Lewis rat epididymis.

Authors:  C J Flickinger; L A Bush; S S Howards; J C Herr
Journal:  Anat Rec       Date:  1997-07

4.  Detection of four germ cell markers in rats during testis morphogenesis: differences and similarities with mice.

Authors:  Giselly Encinas; Camila Zogbi; Taiza Stumpp
Journal:  Cells Tissues Organs       Date:  2011-09-05       Impact factor: 2.481

5.  Experimental autoimmune orchitis induced by testis and sperm antigen-specific T cell clones: an important pathogenic cytokine is tumor necrosis factor.

Authors:  T D Yule; K S Tung
Journal:  Endocrinology       Date:  1993-09       Impact factor: 4.736

Review 6.  Epididymitis and orchitis: an overview.

Authors:  Thomas H Trojian; Timothy S Lishnak; Diana Heiman
Journal:  Am Fam Physician       Date:  2009-04-01       Impact factor: 3.292

7.  Hsp72 induces inflammation and regulates cytokine production in airway epithelium through a TLR4- and NF-kappaB-dependent mechanism.

Authors:  Margaret A Chase; Derek S Wheeler; Kristin M Lierl; Valerie S Hughes; Hector R Wong; Kristen Page
Journal:  J Immunol       Date:  2007-11-01       Impact factor: 5.422

8.  Amiodarone-associated epididymitis: drug-related epididymitis in the absence of infection.

Authors:  J P Gasparich; J T Mason; H L Greene; R E Berger; J N Krieger
Journal:  J Urol       Date:  1985-06       Impact factor: 7.450

9.  Extracellular Hsp72, an endogenous DAMP, is released by virally infected airway epithelial cells and activates neutrophils via Toll-like receptor (TLR)-4.

Authors:  Derek S Wheeler; Margaret A Chase; Albert P Senft; Sue E Poynter; Hector R Wong; Kristen Page
Journal:  Respir Res       Date:  2009-04-30

10.  HMGB1 mediates endogenous TLR2 activation and brain tumor regression.

Authors:  James F Curtin; Naiyou Liu; Marianela Candolfi; Weidong Xiong; Hikmat Assi; Kader Yagiz; Matthew R Edwards; Kathrin S Michelsen; Kurt M Kroeger; Chunyan Liu; A K M Ghulam Muhammad; Mary C Clark; Moshe Arditi; Begonya Comin-Anduix; Antoni Ribas; Pedro R Lowenstein; Maria G Castro
Journal:  PLoS Med       Date:  2009-01-13       Impact factor: 11.069

View more
  1 in total

Review 1.  The NLRP3 inflammasome: molecular activation and regulation in spermatogenesis and male infertility; a systematic review.

Authors:  Marziyeh Tavalaee; Mohsen Rahmani; Joël R Drevet; Mohammad Hossein Nasr-Esfahani
Journal:  Basic Clin Androl       Date:  2022-05-30
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.